New Insights in Pyrimidine Antagonist Chemotherapy
The role of Pharmacokinetics and Pharmacogenetics
RIJKSUNIVERSITEIT GRONINGEN
New Insights in Pyrimidine Antagonist Chemotherapy
The role of Pharmacokinetics and Pharmacogenetics
PROEFSCHRIFT
ter verkrijging van het doctoraat in deMedische Wetenschappen
aan de Rijksuniversiteit Groningenop gezag van de
Rector Magnificus, dr. F. Zwarts,in het openbaar te verdedigen op
woensdag 12 januari 2005 om 13.15 uur
door
Jan Gerard Maring
geboren op 19 februari 1967
te Assen
Promotores: Prof. dr. E.G.E. de Vries Prof. dr. H.J.M. Groen Prof. dr. D.R.A. Uges
Beoordelingscommissie: Prof. dr. J.H. Beijnen Prof. dr. H.J. Guchelaar Prof. dr. J. Verweij
De gezonde mens heeftDuizend wensen,
De zieke slechts één.
Ton Luiting, dichter
Voor mijn oudersVoor Monique, Sanne en Floor
The following centres participated in the research described in this thesis: Departments of Pharmacy and Internal Medicine, Diaconessen Hospital Meppel and Bethesda Hospital Hoogeveen; Departments of Medical Oncology, Pulmonary Diseases and Pharmacy, Uni-versity Hospital Groningen; Departments of Pharmacy and Internal Medicine, Martini Hospital Groningen; Department of Clinical Chemistry, Section Genetic Metabolic Diseases, Academic Medical Centre Amsterdam; Department of Toxicogenetics, Leiden University Medical Centre; Department of Radiation and Stress Cell Biology, University of Groningen.
Financial support for the publication of this thesis was kindly provided by the executive boards of Diaconessen Hospital Meppel and Bethesda Hospital Hoogeveen, the Stichting OZG, Department of Pharmacy, University Hospital Groningen, MerckSharp&Dohme, Novartis Oncology, Eli Lilly, GlaxoSmithKline, Pfizer, Ortho Biotech, Bristol-Myers Squibb, PharmaChemie, Roche and AstraZeneca.
Cover design and layout: Paula Berkemeyer, Amersfoort, www.PBVerbeelding.nl
Photographs on cover and title pages by Jan Gerard MaringCover photograph: Architectural polymorphism in shape and colour. Manarola, Cinque Terre Unesco World Heritage, Italy 2001.
Printed by: Ponsen & Looijen b.v., Wageningen, The Netherlands
ISBN: 90-367-2199-7
© 2004 J.G. MaringAll rights reserved. No part of this publication may be reproduced, stored in a retrieveal system or transmitted in any form or by any means, mechanically, by photocopy, recording or otherwise, without prior written permission of the author.
Contents
Chapter 1 General introduction, objectives and outline. 9
Chapter 2 Genetic factors influencing pyrimidine antagonist chemo-therapy. 15
Section A FOCUS ON FLUOROURACIL
Chapter 3 A simple and sensitive fully validated HPLC-UV method for the determination of 5-fluorouracil and its metabolite 5,6-dihydrofluorouracil in plasma. 53
Chapter 4.1 Extensive hepatic replacement due to liver metastases has no effect on 5-fluorouracil pharmacokinetics 69
Chapter 4.2 Reduced 5-FU clearance in a patient with low DPD activity due to heterozygosity for a mutant allele of the DPYD gene. 87
Chapter 5 Dihydropyrimidine dehydrogenase phenotyping in human volunteers and a DPD deficient patient by assessing uracil pharmacokinetics after an oral uracil test dose. A preliminary report. 101
Section B FOCUS ON GEMCITABINE
Chapter 6 Selective targeting of homologous DNA recombination repair by gemcitabine 115
Chapter 7 Determination of epirubicin and its metabolite epirubicinol in saliva and plasma by HPLC 133
Chapter 8 Gemcitabine and epirubicin plasma concentrations and excretion in saliva in non-small cell lung cancer patients. 151
Chapter 9 Pharmacokinetics and pharmacogenetics of gemcitabine combined with epirubicin or cisplatin in non-small cell lung cancer patients. 163
Summary 177
General discussion and future perspectives 185
Samenvatting 189
Dankwoord 201
Curriculum Vitae 203
List of Publications 205
Introduction
10
Chapter 1 Introduction
11
Lean back and read. Louisiana, USA 2000.
10
Chapter 1 Introduction
11
Introduction
Background
Pyrimidine antagonists belong to the group of antimetabolite anti-cancer drugs and show
structural resemblance with naturally occurring nucleotides. Their action is accomplished
through incorporation as false precursor in DNA or RNA or through inhibition of proteins
involved in nucleotide metabolism. The most commonly used pyrimidine antagonists
are 5-fluorouracil, gemcitabine and cytarabine. Newer oral variants of 5-fluorouracil are
capecitabine and tegafur. 5-Fluorouracil and its analogues are used e.g. in the treatment
of colorectal-, breast- and head and neck cancer [1-3], whereas gemcitabine is especially
prescribed for non-small cell lung cancer and pancreatic cancer [4,5]. Cytarabine is ad-
ministered in the treatment of leukaemia [6]. All pyrimidine antagonists are prodrugs
and intracellular conversion into cytotoxic nucleosides and nucleotides is needed to
produce cytotoxic metabolites. Proteins, involved in pyrimidine metabolism handle these
synthetic drugs, as if they were naturally occurring substrates. The extensive metabolism
of pyrimidine antagonists implies that the intracellular concentrations of cytotoxic me-
tabolites, largely depend on intracellular metabolic enzyme activity. Therefore, under-
standing of the genetics and kinetics of the range of (iso)enzymes involved in pyrimidine
antagonist metabolism is essential for the optimal utilization of these anticancer drugs.
Dihydropyrimidine dehydrogenase is the enzyme that is responsible for the catabolism of
5-fluorouracil and its analogues [7]. Gemcitabine and cytarabine are predominantly me-
tabolized by cytidine deaminase [8]. Thus, not only body surface area, but particularly the
total capacity of metabolizing enzymes in an individual, in combination with some other
factors such as organ function, food and drug interactions, age and gender, determine the
clearance of these drugs.
Aim of the thesis
This thesis aims to clarify the role of a number of potential factors in the clinical pharma-
cology and pharmacogenetics of pyrimidine antagonists, related to the occurrence of side
effects, in order to improve the drug safety of pyrimidine antagonist chemotherapy
Outline of the thesis
In chapter 2, the enzymology and genetics of the proteins, involved in the metabolism
and action mechanism of pyrimidine antagonists are discussed. This should serve as a
basis for adequate understanding of factors involved in the clinical pharmacology of
these drugs.
Section A, comprising chapters 3, 4.1, 4.2, and 5, focuses on a number of clinical phar-
macological and pharmacogenetic aspects of 5-fluorouracil chemotherapy. Chapter
3 describes a novel assay for quantification of 5-fluorouracil in plasma, to be used for
studying 5-fluorouracil pharmacokinetics. 5-Fluorouracil clearance is mainly determined
12
Chapter 1 Introduction
13
by dihydropyrimidine dehydrogenase activity, which is highest in the liver. Therefore,
chapter 4.1 focuses on the impact of liver metastases on 5-fluorouracil pharmacoki-
netics, whereas chapter 4.2 describes the impact of dihydropyrimidine dehydrogenase
deficiency caused by a polymorphism in the dihydropyrimidine dehydrogenase gene on
5-fluorouracil clearance. Since early detection of dihydropyrimidine dehydrogenase defi-
ciency may prevent extreme 5-fluorouracil treatment related toxicity, chapter 5 explores
the use of an oral uracil challenge for dihydropyrimidine phenotyping.
In section B, comprising chapters 6, 7, 8 and 9 a number of clinical pharmacological and
pharmacogenic aspects of gemcitabine chemotherapy are evaluated.
Gemcitabine has been recognized as a potent radiosensitizer, and as such, an interesting
candidate for pre-radiotherapy radiosensitization in non-small cell lung cancer [9]. The
mechanism of gemcitabine mediated radiosensitization is yet poorly understood. Inhibi-
tion of DNA double strand break repair by non-homologous end-joining was previously
excluded as a means of radiosensitization [9]. In Chapter 6 the role of base excision repair
and homologous recombination with respect to gemcitabine induced radiosensitization is
explored in cell line experiments.
Chapter 7 describes a novel assay for determination of epirubicin in plasma and saliva.
The excretion of cytotoxic drugs in saliva may be related to the development of side
effects such as oral mucositis and diarrhea. Therefore, chapter 8 focuses on the excretion
of gemcitabine and epirubicin in saliva. In chapter 9, the potential interaction of gem-
citabine and epirubicin at the level of plasma pharmacokinetics is explored. Additionally,
the possible influence of a common genetic polymorphism in the cytidine deaminase
gene on gemcitabine clearance is evaluated.
Finally, the summary, general discussion and future perspectives chapters summarize
the main findings, strengths and limitations of the studies in the preceding chapters and
give ideas for future research.
12
Chapter 1 Introduction
13
References
1. Harari PM. Why has induction chemotherapy of advanced head and neck cancer become a
United States community standard of practice? J Clin Oncol 1997;15:2050-2055
2. Macdonald JS, Astrow AB. Adjuvant therapy of colon cancer. Semin Oncol 2001;28:30-40
3. Cochrane Review. Multi-agent chemotherapy for early breast cancer. Cochrane Database Syst
Rev. 2002;CD000487
4. Wiernik PH. Current status of and future prospects for the medical management of adenocarci-
noma of the exocrine pancreas. J Clin Gastroenterol 2000;30:357-363
5. Sorenson S, Glimelius B, Nygren P, SBU group. Swedish Council of Technology Assessment in
Health Care. A systematic overview of chemotherapy effects in non-small cell lung cancer. Acta
Oncol 2001;40:327-339
6. Bishop JF. Approaches to induction therapy with adult acute myeloid leukaemia. Acta Haematol
1998; 99:133-137
7. Pinedo HM, Peters GF. Fluorouracil: biochemistry and pharmacology. J Clin Oncol 1988;6:1653-
1664
8. Galmarini CM, Mackey JR, Dumontet C. Nucleoside analogues: mechanisms of drug resistance
and reversal strategies. Leukemia 2001:15:875-890
9. van Putten JWG, Groen HJM, Smid K, Peters GJ, Kampinga HH. End-joining deficiency and radio-
sensitization induced by gemcitabine. Cancer Res 2001;61:1585-1591
Genetic factors influencing pyrimidine-antagonist chemotherapy
Jan Gerard Maring1, Harry J.M. Groen2, Floris M. Wachters2, Donald R.A. Uges3, Elisabeth
G.E. de Vries4
1Department of Pharmacy, Diaconessen Hospital Meppel and Bethesda Hospital
Hoogeveen; Departments of 2Pulmonary Diseases, 3Pharmacy and 4Medical Oncology ,
University Hospital Groningen, The Netherlands
Pharmacogenetics J, revised resubmitted
Chapter 2
16
Genetic factors influencing pyrimidine-antagonist chemotherapy
17
Grandmother & Children. Almeria, Spain 1996.
Chapter 2
16
Genetic factors influencing pyrimidine-antagonist chemotherapy
17
Abstract
Pyrimidine antagonists, e.g. 5-fluorouracil, cytarabine and gemcitabine, are widely used in
chemotherapy regimes for colorectal, breast, head and neck, non-small cell lung cancer,
pancreatic cancer and leukaemias. Extensive metabolism is a prerequisite for conver-
sion of these pyrimidine prodrugs into active compounds. Interindividual variation in
the activity of metabolising enzymes can affect the extent of pro-drug activation and,
as a result, act on the efficacy of chemotherapy treatment. Genetic factors at least partly
explain interindividual variation in anti-tumour efficacy and toxicity of pyrimidine an-
tagonists. In this review, proteins relevant for the efficacy and toxicity of pyrimidine an-
tagonists will be summarised. In addition, the role of germline polymorphisms, tumour
specific somatic mutations and protein expression levels in the metabolic pathways and
clinical pharmacology of these drugs are described. Germ line polymorphisms of uridine
monophosphate kinase (UMPK), orotate phosphoribosyl transferase (OPRT), thymidylate
synthase (TS), dihydropyrimidine dehydrogenase (DPD), and methylene tetrahydrofolate
reductase (MTHFR) and gene expression levels of OPRT, UMPK, TS, DPD, uridine phos-
phorylase, uridine kinase, thymidine phosphorylase, thymidine kinase, dUTP nucleotide
hydrolase are discussed in relation to 5-FU efficacy. Cytidine deaminase (CDA) and 5’-
nucleotidase (5NT) gene polymorphisms and CDA, 5NT, deoxycytidine kinase and MRP5
gene expression levels and their potential relation to gemcitabine and cytarabine cyto-
toxicity are reviewed.
Introduction
Pyrimidine antagonists belong to the group of antimetabolite anti-cancer drugs and
show structural resemblance with naturally occurring nucleotides (see figure 1). Their
action is accomplished through incorporation as false precursor in DNA or RNA or through
inhibition of proteins involved in nucleotide metabolism. The most commonly used pyri-
midine antagonists are 5-fluorouracil (5-FU), gemcitabine and cytarabine (ara-C). Newer
oral variants of 5-FU are capecitabine and tegafur. 5-FU and its analogues are used e.g. in
the treatment of colorectal-, breast- and head and neck cancer [1-3], whereas gemcitabine
is especially prescribed for non-small cell lung cancer and pancreatic cancer [4,5]. Ara-C
is used in the treatment of leukaemia [6]. All pyrimidine antagonists are prodrugs and
intracellular conversion into cytotoxic nucleosides and nucleotides is needed to produce
cytotoxic metabolites. Proteins, involved in pyrimidine metabolism handle these synthetic
drugs, as if they were naturally occurring substrates. The extensive metabolism of pyrimi-
dine antagonists implies that the intracellular concentrations of cytotoxic metabolites,
thus indirectly the potential anti-tumour effects, largely depend on intracellular metabolic
enzyme activity. The aim of this review is to summarise pharmacogenomic data regarding
Chapter 2
18
Genetic factors influencing pyrimidine-antagonist chemotherapy
19
proteins related to the efficacy and toxicity of pyrimidine antagonists and to identify
potential predictive and/or prognostic genetic factors for toxicity and treatment outcome.
The impact of germ line polymorphisms as well as tumour specific somatic mutations and
protein expression levels on the clinical pharmacology and metabolic pathways of these
drugs will be discussed.
Metabolic pathways of pyrimidine antagonists
5-Fluorouracil
The initial metabolism of 5-FU into nucleotides is essential for its action. Several enzymes
of the pyrimidine metabolic pathway are required for the conversion of 5-FU to nucle-
otides [7]. Cytotoxic nucleotides can be formed by three routes as is illustrated in figure
2: 1. Conversion of 5-FU to 5-fluoro-uridine-monophosphate (5-FUMP) by orotate phos-
phoribosyl transferase (OPRT); 2. Sequential conversion of 5-FU to 5-FUMP by uridine
phosphorylase and uridine kinase; 3. Sequential conversion of 5-FU to 5-fluoro-deoxy-
uridine-monophosphate (FdUMP) by thymidine phosphorylase and thymidine kinase [8].
The antitumour activity results from inhibition of thymidylate synthase (TS) by FdUMP,
as well as from incorporation of 5-FU metabolites into RNA and DNA. Only a small part
�
��
�
��
���
���
�
��
�
�
�
���
��
���
��
�
��
�
�
�
���
�
�
����
��
�
� ��
�
�
�
�
��
�
��
��
�
�
��
��
�
�
���
�
��
�
�
�������� ���������� ����������� ������������
������ �������������� �������
�
Figure 1 Overview of the chemical structures of the naturally occurring pyrimidines cytosine and uracil and the synthetic pyrimidine analogues cytarabine, gemcitabine, capecitabine, 5-fluorouracil and tegafur.
Chapter 2
18
Genetic factors influencing pyrimidine-antagonist chemotherapy
19
of the dose is activated via these routes, as in humans 80-90% of the administered dose
is degraded by dihydropyrimidine dehydrogenase (DPD). 5-FU degradation occurs in all
tissues, including tumour tissue, but is highest in the liver [9].
Capecitabine and tegafur
Capecitabine is an oral prodrug of 5-FU. After absorption from the gut capecitabine
is converted into 5’-deoxy-5-fluorocytidine (5’-dFCR) by carboxyl-esterase in the liver,
and subsequently further converted into 5’-deoxy-5-fluorouridine (5’-dFUR) by cytidine
deaminase (CDA). Finally, 5-FU results from bioconversion of 5’-dFUR by thymidine phos-
phorylase [10] (see figure 2). Tegafur is another oral 5-FU prodrug, that is converted into
5-FU by cytochrome P450 (CYP450) enzymes in the liver. CYP2A6 is the main CYP450
enzyme involved in tegafur metabolism, but CYP1A2 and CYP2C8 also play a role (see
Figure 2 Metabolism of 5-FU and 5-FU analogues. For explanation of symbols and metabolic routes see text.
������������
�������� ��������
������
�������� ���������
������
��������� �������������
����������������������������������
�� � ��������������
������
��������������������
����������������������
���������������������
�����������
����������
���������������
������
�������������
�����
���������������
��������������������
������
������
������������������
������
������
��������������������
������
�������������������
����������������
�����������������
�����
�������
�������������������
����
����
�
Chapter 2
20
Genetic factors influencing pyrimidine-antagonist chemotherapy
21
figure 2). Tegafur is combined with uracil in a molar proportion of 1:4 available in the com-
mercial preparation UFT®. Uracil is a competitive substrate for DPD and its role in UFT® is
to diminish 5-FU catabolism by DPD.
Gemcitabine and cytarabine
The metabolic pathways of gemcitabine and ara-C are almost alike [11,12] (see figure 3).
Membrane transport of both gemcitabine and ara-C is mediated by equilibrative nucle-
oside transporters. Subsequently gemcitabine (dFdC) is phosphorylated into gemcitabine
monophosphate (dFdCMP) by deoxycytidine kinase (dCK). The same enzyme is respon-
sible for the intracellular phosphorylation of ara-C into cytarabine monophosphate (ara-
CMP). dCK is the rate limiting enzyme in the biotransformation of both gemcitabine and
ara-C. Inactivation of dFdCMP and ara-CMP can occur through dephosphorylation by 5’-
nucleotidase (5NT). Monophosphates, escaping from dephosphorylation are available for
further phosphorylation into di- and triphospates by dCMP kinase and nucleoside diphos-
phate kinase, respectively. Gemcitabine diphosphate (dFdCDP) is a potent inhibitor of the
enzyme ribonucleotide reductase (RNR), which will lead to depletion of dCDP and dCTP
in the cell. This may favour the incorporation of dFdCTP into DNA. Moreover, gemcitabine
has the unique property that after incorporation of gemcitabine monophosphate in DNA,
one deoxynucleotide molecule more can be inserted. This stops DNA polymerase [13]. This
pattern is distinct from that of ara-C, which halts polymerase progression at the analogue
insertion site. The “masked termination” of gemcitabine makes the inserted analogue more
resistant to removal from DNA [13]. Other differences with ara-C are the faster membrane
transport velocity of dFdC, the greater effectiveness of dFdC phosphorylation by dCK and
the longer intracellular retention of dFdCTP. These factors may, at least in part, explain the
different spectra of antitumour activity of both drugs. Only a small part of the gemcitabine
and ara-C dose is responsible for the cytotoxic effects, since more than 90% of the dose is
inactivated by the enzyme cytidine deaminase into dFdU and ara-U respectively.
Germline polymorphisms and fluoropyrimidine efficacy
5-fluorouracil
Genetic polymorphisms of enzymes involved in the metabolic activation pathway of 5-FU
have been described for the enzymes uridine kinase (UMPK) and orotate phosphorylase
transferase (OPRT). Three allelic variants of UMPK have been recognised in the human
population: UMPK1, UMPK2 and UMPK3 [14]. The UMPK1 allele is associated with about
3 times the catalytic activity of the UMPK2 allele. Therefore UMPK2 homozygotes are
relatively deficient of total UMPK enzyme. The allele frequency of UMPK1 is about 95-97%
and that of UMPK2 3-5%, in both Caucasians and Asians [15-17]. UMPK3 is rarely seen. The
consequences of this polymorphism for 5-FU chemotherapy have not yet been studied.
Chapter 2
20
Genetic factors influencing pyrimidine-antagonist chemotherapy
21
In the OPRT gene a G213A mutation in exon 3 and a 440G mutation in exon 6 have been
observed, with allele frequencies of 26% and 27% respectively [18]. Both mutations do
not significantly compromise in vitro OPRT activity, and therefore it seems unlikely that
they affect 5-FU anti-tumour efficacy.
Contrary to 5-FU activating enzymes, much more information is available regarding
Figure 3 Metabolism of gemcitabine and cytarabine. For explanation of symbols and metabolic routes see text.
����������� ������
���������� �������
����� ������� ������������
���������� �����������
���� � ������������� ���������
���������
������������� ������� � �������������
������ � ����������������������������
���������
���� ������
��������������������
���������
���
����
����
���
���������� �����������������
������
���
�
Chapter 2
22
Genetic factors influencing pyrimidine-antagonist chemotherapy
23
polymorphisms of target enzyme TS and 5-FU degrading enzyme DPD. For TS, at least
two genotypes have been identified, characterised by triple and double tandem repeat
sequences in the DNA promoter enhancer region (TSER). The triple tandem 3R genotype
is associated with higher TS mRNA and TS protein levels [19-22]. The allele frequency of
the 3R genotype is subject to considerable ethnic variation, being about 67% in Asians
and 38% in Caucasians [23]. The consequences of the TSER genotype for fluoropyrimi-
dine chemosensitivity have been studied in tumour cell lines and in clinical trials. In the
only study performed in tumour cell lines, the TSER polymorphism had no effect on 5-
FU chemosensitivity [24]. In 65 patients with rectal cancer, tumour downstaging after
preoperative 5-FU based chemoradiation was observed in only 22% of homozygotes
for triple tandem repeat sequences (3R/3R genotype) compared to 60% of patients who
were heterozygous (3R/2R) or homozygous for double tandem repeats (2R/2R) [25]. In
another small retrospective study of 24 patients with metastatic colorectal cancer, 3 out
of 4 patients with the 2R/2R genotype responded on capecitabine, whereas only 1 out
of 12 of heterozygotes and 2 out of 8 patients with the 3R/3R genotype responded [26].
Furthermore, in a study of 221 patients with Dukes C colorectal cancer, patients with the
3R/3R genotype gained no survival benefit from 5-FU treatment, whereas survival was
increased in patients with a 2R/2R or 2R/3R genotype [27]. However, the TSER genotype
did not seem to be an efficacious marker for tumour sensitivity to 5-FU based oral
adjuvant chemotherapy in 135 Japanese colorectal patients [28]. Surprisingly, in a small
study of 54 colorectal cancer patients, not the 2R but the 3R/3R genotype correlated with
an increased disease free survival after adjuvant 5-FU chemotherapy [29].
Several factors can possibly explain these inconclusive data. Firstly, within the second 28
bp tandem repeat sequence, a G/C polymorphism was recently discovered. Functional
analysis revealed that the 3R/G genotype has three to four times greater efficiency of
translation than other polymorphic sequences. [30,31]. In a study of the G/C polymor-
phism in 258 primary colorectal tumours was found that all low expression genotypes
were associated with longer survival after adjuvant fluoropyrimidine chemotherapy,
whereas no benefit was seen for high expression genotypes [30].
Secondly, a 6bp deletion genotype (TS1494del6) in the 3’ untranslated region of the TS
gene has been associated with reduced TS mRNA stability [32,33]. The frequency of this
genotype was found to be 41% in non-Hispanic whites, 26% in Hispanic whites, 52% in
African-Americans and 76% in Singapore Chinese. The relative instability of TSmRNA may
have its effect on TS protein activity and thus indirectly on fluoropyrimidine chemosensi-
tivity. However, this polymorphism was not directly related to in vitro chemosensitivity in
tumour cell lines [24] or disease free survival after adjuvant 5-FU chemotherapy in a small
study of 54 colorectal cancer patients [29]. Another cause of conflicting data is the loss
of heterozygosity (LOH), that is frequently observed for TS [34]. The TS gene is located on
chromosome 18p11.32, a region most frequently lost in colorectal cancer. In a small study
of 30 stage IV colorectal cancer patients, LOH was observed in 17 out of 22 heterozygotes
Chapter 2
22
Genetic factors influencing pyrimidine-antagonist chemotherapy
23
[35]. The presence of a 3R allele (3R/3R, 3R/loss, 2R/3R) was associated with lower survival
on fluoropyrimidine chemotherapy. LOH in tumour tissue is a significant factor, to be
taken into account when TS genotypes are to be considered for outcome prediction. It is
important to bear in mind that LOH limits the use of germ line DNA from e.g. blood for pre-
dictive genotyping. Finally, it must be stressed that many studies of the TS polymorphism
were underpowered to detect relations of the different genotypes with clinical outcome.
Hence, the exact consequences of the triple tandem repeat genotypes for 5-FU chemo-
sensitivity are not yet clear. Sufficiently powered clinical trials and additional mechanistic
studies may be needed to elucidate the cause of so far unexpected outcomes.
Besides the TS polymorphisms, the phenomenon of inherited DPD deficiency is an
important issue. DPD deficiency is caused by molecular defects in the DPD gene that
result in complete or partial loss of DPD activity [36]. This can cause extreme 5-FU toxicity.
So far, in patients suffering from severe 5-FU associated toxicity, 11 different mutations
in the dihydropyrimidine dehydrogenase (DPYD) gene have been identified, including at
least 1 polymorphism [36-38]. In patients who are deficient for DPD, 5-FU clearance is dra-
matically reduced and standard doses of 5-FU cause excessive toxicity in these patients
[36,39,40]. The frequency of DPD deficiency has been estimated to be as high as 2-3% in
Caucasians based on measurements of DPD activity in peripheral mononuclear cells in
patients and healthy volunteers [41,42]. This percentage is probably high enough to justify
screening on DPD deficiency prior to 5-FU based chemotherapy. Instead of screening for
specific mutations in the DPYD gene, Mattison et al. developed a simple uracil breath test
for DPD phenotyping, based on the release of 13CO2 from 2-13C uracil in the presence of
intact DPD [43]. Expired air was collected 5-90 min after oral ingestion of 6 mg/kg 2-13C
uracil. Partially deficient DPD breath profiles were well differentiated from normal profiles.
An oral challenge with uracil, prior to chemotherapy, with subsequent measurement of
the uracil clearance in plasma, might also give a good prediction of the patient’s DPD
status. Such tests are currently developed, but not yet available [44].
A polymorphism that might also influence the efficacy of 5-FU and its analogues is that of
the methylene tetrahydrofolate reductase (MTHFR) gene. MTHFR catalyses the conversion
of 5,10-methyltetrahydrofolate to 5-methyltetrahydrofolate. 5,10-methyltetrahydrofolate
is an essential cofactor in the biosynthesis of dTMP (see figure 2). The dissociation of FdUMP
from the ternairy complex with thymidylate synthase and 5,10-methyltetrahydrofolate is
suppressed when levels of 5,10- methyltetrahydrofolate are increased [45]. A common
C677T transition in the MTHFR gene results in a variant with lower specific activity [46].
The geographic and ethnic distribution of this genotype was studied by Wilcken et al.
[47]. The homozygote T genotype was found to be particularly common in northern China
(20%), southern Italy (26%) and Mexico (32%). In two studies with respectively 45 and 51
colorectal cancer patients, the MTHFR genotype has been shown to affect the folate pool
[48,49]. In the latter study, no effect was seen of the MTHFR genotype on overall survival
after oral 5-FU based chemotherapy [49]. Contrary to this, in another study of 43 meta-
Chapter 2
24
Genetic factors influencing pyrimidine-antagonist chemotherapy
25
static colorectal cancer patients receiving fluoropyrimidine-based chemotherapy, the
presence of one or two mutant alleles was associated with increased tumour response
[50]. In vitro transfection of mutant 677T MTHFR cDNA in colon and breast cancer cells
increased the chemosensitivity of these cells to 5FU [51], suggesting at least a modulating
role of the MTHFR genotype on cellular fluoropyrimidine sensitivity. The exact role of the
MTHFR genotype has to be elucidated in larger clinical trials.
Capecitabine and tegafur
Polymorphisms in capacitabine metabolising enzymes have only been reported for
cytidine deaminase. Since this polymorphism may also be relevant for gemcitabine and
ara-C metabolism it will be discussed in the next paragraph. Furthermore, mutations in
CYP2A6 have recently been identified to affect tegafur metabolism [52]. Two mutant
alleles, CYP2A6*4C and CYP2A6*11 were detected in a patient with largely reduced
tegafur clearance. The prevalence of these mutations and its impact on clinical outcome
are not yet clear.
Gemcitabine and cytarabine
There are at least two polymorphisms in the metabolising pathway, that might be
relevant for gemcitabine and ara-C toxicity and efficacy. Firstly, cloning of human cytidine
deaminase revealed two protein variants (CDD1 and CDD2) with different in vitro deami-
nation rates of ara-C [53]. Theoretically, patients who deaminate gemcitabine or ara-C more
efficiently, are shorter exposed to the parent drugs, while faster metabolism of capecitab-
ine results in increased 5-FU levels. In vitro transfection of human bladder cancer cells with
CDD2 cDNA did increase CDD activity, and indeed made the cells more sensitive to 5’dFUR
and capecitabine, but resistant to gemcitabine [54]. This warrants further investigation of
the possible role of the CDD genotype in fluoropyrimidine chemosensitivity.
Secondly, 5’-nucleotidase deficiency, is an autosomal recessive condition, known to
cause haemolytic anaemia. Several mutations causing 5’-nucleotidase deficiency have
been identified [55]. On theoretical grounds, in patients with 5’-nucleotidase deficiency,
treatment with gemcitabine or ara-C may result in increased toxicity although this has not
yet been published.
An overview of polymorphic genes and related enzymes with possible relevance for
fluoropyrimidine chemotherapy is presented in table 1.
Chapter 2
24
Genetic factors influencing pyrimidine-antagonist chemotherapy
25
Tabl
e 1
Ove
rvie
w o
f pro
tein
s tha
t pot
entia
ly m
ay a
ffect
dru
g tre
atm
ent o
utco
me
due
to g
enet
ic p
olym
orph
isms
Enzy
me
Po
lym
orp
his
mA
llel
e fr
equ
ency
Dru
gP
atie
nt
dat
aC
on
seq
uen
ces
Dih
ydro
pyr
imid
ine
deh
y-d
rog
enas
e (D
PD)
11 m
uta
tio
ns
fou
nd
in p
ar-
tial
DPD
defi
cien
t p
atie
nts
IVS1
4+1G
→A
mu
tati
on
m
ost
freq
uen
t0.
5-1%
5-FU
an
d a
nal
og
ues
mis
cella
neo
us
can
cer t
ypes
Incr
ease
d to
xici
ty o
f 5-
FU
Met
hyl
ene
tetr
ahyd
rofo
late
re
du
ctas
e (M
FHFR
)C
667T
in e
xon
3d
ecre
ased
MFH
FR a
ctiv
ity
45%
in n
ort
her
n C
hin
a51
% in
so
uth
ern
Ital
y56
% in
Mex
ico
5-FU
an
d a
nal
og
ues
colo
rect
al c
ance
rPo
ssib
ly d
ecre
ased
ef
ficac
y
Oro
tate
ph
osp
ho
rib
osy
l tr
ansf
eras
e (O
PRT
)G
213A
in e
xon
3in
crea
sed
OPR
T ac
tivi
ty26
%5-
FU a
nd
an
alo
gu
esco
lore
ctal
can
cer
Poss
ibly
incr
ease
d
effic
acy
Thym
idyl
ate
syn
thas
e (T
S)TS
ER*3
incr
ease
d T
S ac
tivi
ty
1494
del
6
38%
in C
auca
sian
s67
% in
Asi
ans
29%
5-FU
an
d a
nal
og
ues
colo
rect
al c
ance
rPo
ssib
ly d
ecre
ased
ef
ficac
y
Un
kno
wn
Uri
din
e m
on
op
ho
sph
ate
kin
ase
(UM
PK)
UM
PK1
vari
ant
UM
PK2
vari
ant
UM
PK3
vari
ant
95-9
7%3-
5%<
1%
5-FU
an
d a
nal
og
ues
colo
rect
al c
ance
rU
nkn
ow
n
Cyt
och
rom
e P4
50 2
A6
(CY
P2A
6)C
YP2
A6*
4CC
YP2
A6*
19U
nkn
ow
nte
gaf
ur
colo
rect
al c
ance
rD
ecre
ased
met
abo
-lis
m o
f teg
afu
r in
to
5-FU
Cyt
idin
e d
eam
inas
e (C
DA
)C
DA
1 va
rian
tC
DA
2 va
rian
t70
%30
%C
apec
itab
ine,
gem
ci-
tab
ine,
ara
-Cn
ot
avai
lab
leU
nkn
ow
n
5’-n
ucl
eoti
das
e(5
NT
)Se
vera
l mu
tati
on
su
nkn
ow
nG
emci
tab
ine
and
ar
a-C
leu
kaem
iaU
nkn
ow
n
Chapter 2
26
Genetic factors influencing pyrimidine-antagonist chemotherapy
27
Impact of somatic mutations and gene expression levels: 5-fluorouracil and its metabolic enzymes
5-Fluorouracil
Data on expression levels of enzymes involved in the metabolic activation of 5-FU in
relation to chemosensitivity is sparse. Low UMPK levels were observed in 29 colorectal
tumour samples of patients with acquired 5-FU resistance [56]. Low OPRT as well as UP and
UK activity have been associated with 5-FU resistance in tumour cell lines [57-60]. The role
of OPRT has also been investigated in a few clinical studies. High OPRT activity was associ-
ated with good in vitro sensitivity to 5-FU, measured by Collagen Gel Droplet Embedded
Culture Drug Sensitivity test, Fluoresceine Diacetate Assay or Histoculture Drug Response
Assay, in human colorectal cancer tissues [61,62]. Furthermore, in 37 patients treated with
oral tegafur-uracil for disseminated colorectal cancer, responding tumours had higher
expressions of OPRT than non-responding tumours [63]. In the same study, there was no
difference in UP mRNA between responding and non-responding tumours. The role of UP
in 5-FU sensitivity is probably marginal, since transfection of tumour cells with UP cDNA,
did not affect fluoropyrimidine sensitivity [64]. More research is needed to establish the
exact role of OPRT in 5-FU sensitivity.
Most research of fluoropyrimidine activation pathways has been focused on the role
of TP. Results regarding the role of tumoural TP expression appear to be contradictory.
In patients, high as well as low TP mRNA expression levels have been correlated with
response to 5-FU therapy. An increase in both relapse free survival and overall survival
was suggested in TP-positive compared to TP-negative breast tumours in a small study of
109 patients treated with adjuvant cyclophosphamide, methotrexate and 5-FU (CMF) [65].
Furthermore, in 38 metastatic colorectal cancer patients treated with 5-FU and leucovorin,
TP mRNA levels in non-responding tumours were higher than in responding patients [66].
In 28 patients treated for advanced gastric cancer with 5-FU plus pirarubicin and cisplatin,
high tumour tissue TP expression was associated with response on chemotherapy [67].
In another 126 advanced gastric cancer patients, TP overexpression was associated with
increased patient survival after fluoropyrimidine chemotherapy, but correlated with unfa-
vourable prognosis in patients not treated with fluoropyrimidines [68]. Consequently, it is
hard to draw conclusions from current, in general small trials.
Taking a close look at 5-FU metabolism, one might expect that cells with higher TP levels
would be more sensitive to 5-FU, due to higher FdUMP levels resulting from increased
5-FU activation (see figure 2). However, TP also functions as angiogenesis factor since TP
and platelet derived endothelial cell growth factor (ECGF1) have been recognised as the
same protein. High TP gene expression might therefore be associated with a more aggres-
sive and malignant tumour phenotype [66]. Transfection of cancer cells with TP cDNA has
been performed in several in vitro studies to investigate the effect of TP overexpression
on chemosensitivity. A clear correlation was found between TP activity and in vitro sensi-
Chapter 2
26
Genetic factors influencing pyrimidine-antagonist chemotherapy
27
tivity to the 5-FU analogue 5’-dFUR, and to a lesser extent to 5-FU itself [69-74]. Marchetti
et al. also studied the effect of TP overexpression on in vivo tumour growth in a rat model
[69]. The impact on tumour growth turned out to be relatively modest and only involved
the initial stages of tumour growth. These results suggest that tumour growth and
chemosensitivity are independently related to TP expression. A major point of interest in
interpreting the clinical data in relation to in-vitro data is the role of infiltrating stromal fi-
broblasts and macrophages in TP expression. In most tumour types, TP expression is much
higher in infiltrating cells compared to tumour cells [75]. This may largely trouble the inter-
pretation of data of in vivo PCR as well as IHC studies. Consequently, this aspect particulary
has to be taken into account in study designs to validate TP as predictive marker.
Data on the role of TK in 5-FU chemosensitivity are also contradictory. Chemosensitivity
was unchanged in TK deficient colon cancer cells compared to parent cells, suggesting
only a marginal role of TK in 5FU sensitivity [76]. In another study, TK overexpression has
been associated with 5-FU resistance in gastric tumour cell lines [59], but other groups
found a reduction of TK activity in chemoresistant colon cancer cell lines [58,60]. Intra-
cellular availability of deoxyribose-1-phosphate might account for these differences,
since the activation of 5-FU by TP and TK is fully dependent on the availability of this
co-substrate. If cellular levels of this co-substrate are too low, hardly any 5-FU can be me-
tabolised via this route. Only one patient study is available regarding tumour TK activity in
relation to treatment efficacy. In this study, tumour TK activity could not be related to the
efficacy of second line 5-FU (poly)chemotherapy in 121 advanced breast cancer patients
who failed on first-line tamoxifen treatment [77]. Thus, TK is probably not a strong factor
related to 5-FU sensitivity.
A route that has been extensively evaluated in relation to 5-FU chemoresistance is the in-
tracellular biodegradation of 5-FU by DPD. In vitro experiments in human tumour cell lines
demonstrated an inverse correlation between both DPD mRNA expression and activity
with 5-FU response [78]. DPD mRNA levels were also related to primary 5-FU resistance
in 7 human gastrointestinal cell lines [79]. Furthermore, high DPD activity and DPD mRNA
levels were correlated with low sensitivity to 5FU in 3 human gastric, 2 colon, 1 breast
and 1 pancreatic carcinoma xenografts in the nude mice model [80]. However, data of
presently available clinical studies are less unequivocal. An overview of clinical relevant
studies is presented in table 2. Most studies have been performed in colorectal cancer
[61,81-84 ], some in gastric [85-87], head and neck [88-90], and non-small cell lung cancer
[91-93], and few in breast and bladder cancer [94,95]. A number of studies have indicated
that there is no strong link between DPD mRNA levels and DPD protein activity levels. It
has been reported that DPD mRNA, but not DPD activity, is reduced in colorectal tumours
compared with normal mucosa, although considerable overlap exists in measured mRNA
levels [96-103]. Reduced mRNA levels have also been reported in ovarian cancer [104].
DPD activity appears to be increased in breast cancer (see table 3) [94,105]. This suggests
that DPD is not only regulated at transcriptional and translational but also at the post-
Chapter 2
28
Genetic factors influencing pyrimidine-antagonist chemotherapy
29
Tabl
e 2
Ove
rvie
w o
f stu
dies
rega
rdin
g in
tratu
mor
ial D
PD e
xpre
ssio
n le
vels
in re
latio
n to
chem
osen
sivity
can
cer
pat
ien
tsch
emo
ther
apy
reg
imen
assa
yo
utc
om
ere
fere
nce
Co
lore
ctal
33 100
348
54 309
5-FU
/LV
5-FU
5-FU
5-FU
5-FU
mRN
AEL
ISA
mRN
Aac
tivi
tym
RNA
Low
DPD
rela
ted
to re
spo
nse
No
co
rrel
atio
ns
fou
nd
No
co
rrel
atio
ns
fou
nd
No
co
rrel
atio
ns
fou
nd
Low
DPD
rela
ted
to lo
ng
er s
urv
ival
[81]
[82]
[83]
[61]
[84]
Gas
tric
81 22 38
5-FU
DFU
R5-
FU/M
TX
Act
ivit
yEL
ISA
IHC
Hig
h D
PD re
late
d to
po
or s
urv
ival
Low
DPD
rela
ted
to D
FUR
sen
siti
vity
No
co
rrel
atio
ns
fou
nd
[85]
[86]
[87]
hea
d a
nd
nec
k 62 82 10
9
5-FU
5-FU
/LV
/cis
pla
tin
UFT
acti
vity
acti
vity
IHC
No
co
rrel
atio
ns
fou
nd
No
co
rrel
atio
ns
fou
nd
Low
DPD
co
rrel
ated
wit
h U
FT re
spo
nse
[88]
[89]
[90]
NSC
LC54 68 60
UFT
5-FU
5-FU
IHC
IHC
acti
vity
Low
DPD
co
rrel
ated
wit
h b
ette
r pro
gn
osi
sH
igh
DPD
co
rrel
ated
wit
h p
oo
r su
rviv
alN
o c
orr
elat
ion
s fo
un
d
[91]
[92]
[93]
bre
ast
191
5-FU
acti
vity
Hig
h D
PD re
late
d to
po
or D
FS[9
4]
bla
dd
er74
5-FU
acti
vity
Low
DPD
rela
ted
to 5
-FU
sen
siti
vity
[95]
MTX
= m
etho
trexa
te;; I
HC =
imm
unoh
istoc
hem
istry
Chapter 2
28
Genetic factors influencing pyrimidine-antagonist chemotherapy
29
transcriptional level. This hampers the use of DPD mRNA as predictive marker for 5-FU
efficacy. Inhomogeneity of tumour tissue samples may, in part, also account for conflicting
results.
Summarising, it can be concluded that data on tumour expression levels of 5-FU metabo-
lising enzymes in relation to chemosensitivity is sparse and that studies show conflicting
results. This may at least partly be due to small numbers and therefore lack of statistical
power in the studies.
Capecitabine/tegafur
In the animal model, high TP/DPD ratios have been associated with antitumour efficacy of
capecitabine and its metabolite 5’dFUR in human tumour xenografts [106]. In vivo, high
TP/DPD ratios suggested a better clinical outcome after adjuvant treatment with 5’dFUR
in a study of 88 colorectal cancer patients, and in 17 metastatic gastric cancer patients
[107,108]. TP expression was examined by immunohistochemistry in 650 breast tumours
of patients with early breast cancer receiving adjuvant 5’dFUR [109]. Eight-year follow-up
data showed that high TP expression in the tumour was a favourable prognostic indicator.
Thus, TP expression seems to be a predictive factor for 5’dFUR efficacy. Since the activa-
tion of tegafur depends on several CYP450 enzymes, interindividual variations in enzyme
expression may affect the rate of tegafur metabolism. Indeed, the relative contribution
of each enzyme is known to differ among patients but the clinical consequences of this
phenomenon are unclear [110].
Impact of somatic mutations and gene expression levels: 5-fluorouracil and its target enzymes
Contrary to enzymes related to the 5-FU metabolic activation pathway, the target enzyme
TS has been extensively studied in relation to 5-FU efficacy.
A large amount of preclinical in vitro data suggest a correlation between TS activity and
sensitivity to 5-FU. In a panel of 19 nonselected breast, digestive tract and head and neck
cancer cell lines as well as in a panel of 13 non selected human colon cancer cell lines, the
TS activity was inversely correlated with 5-FU sensitivity [78,111]. Several in vitro studies
in tumour cell lines also suggest TS overexpression as a mechanism of resistance after
repeated exposure to 5-FU [79,112,113]. Chemosensitivity to 5-FU was also increased after
transfection of human colon cancer cells with antisense TS cDNA [114]. However, conflict-
ing data have been observed in clinical studies evaluating the prognostic role of mRNA,
protein and activity levels of TS in relation to tumour response and clinical outcome to 5FU
based chemotherapy. An overview of relevant clinical studies is presented in table 4. Most
studies regarding TS expression in relation to chemosensitivity have been performed in
patients with disseminated colorectal cancer [61,84,115-127], some in gastric cancer
Chapter 2
30
Genetic factors influencing pyrimidine-antagonist chemotherapy
31
[87,128-131] and few studies in head and neck cancer [88,89,132], non-small cell lung
cancer [92,93] pancreatic and breast cancer [77,133,134].
Several factors may account for the difficult interpretation of combined clinical data.
Firstly, it has been reported that TS protein can down-regulate its own translation,
whereas its transcription is regulated by E2F, a cell cycle checkpoint regulator. Together,
this results in low TS levels in stationary phase cells. Although cells with a low TS might
theoretically be more sensitive to 5-FU, the low proliferation rate prevents induction of
DNA damage and 5-FU antitumour efficacy [135]. Secondly, a specific interaction exists
between oncogenes and TS, by binding of TS protein to the p53 and c-myc RNA, while wild
type p53 can also inhibit TS promotor activity. TS inhibition by 5-FU can also result in a
depression of TS protein mediated inhibition of TS mRNA translation leading to induction
of more TS protein synthesis, and p53 protein may further deregulate this process. These
complex indirect and direct interactions between oncogenes and TS may have as yet
Table 3 DPD expression and activity in different tissue types
Tumour type Samples Parameter Tumour vs. Normal reference
Gastrointestinal 51, matched
41, matched
10 tumours + 7 me-tastases, matched
15 tumours + 10 metastases, 25 non-matched controls
36, matched
43, matched
36, matched
40, matched
mRNAactivity
mRNAactivity
mRNA
protein
protein
mRNAproteinactivity
protein
mRNAproteinactivity
lowerno difference
lowerno difference
lower
lower
no difference
lowerno differenceno difference
lower
lowerlowerno difference
[96]
[97]
[98]
[99]
[100]
[101]
[102]
[103]
Ovarian 85 tumour + 27 non-matched controls
mRNA lower [104]
Breast 26, matched49, matched
activityactivity
higherhigher
[105][94]
Chapter 2
30
Genetic factors influencing pyrimidine-antagonist chemotherapy
31
Tabl
e 4
Ove
rvie
w o
f stu
dies
rega
rdin
g in
tratu
mor
ial T
S ex
pres
sion
leve
ls in
rela
tion
to ch
emos
ensiv
ity
can
cer
pat
ien
tsch
emo
ther
apy
reg
imen
assa
yo
utc
om
ere
fere
nce
colo
rect
al
47 46 36 41 52 48 108
27 29 50 134
124
309
54 54
5-FU
/LV
bo
lus
5-FU
/LV
pro
trac
ted
5-FU
/LV
5-
FU/L
V b
olu
s5-
FU/L
V p
rotr
acte
d5-
FU/L
V/M
TX5-
FU/L
V/M
TX5-
FU/L
V/M
TX5-
FU/L
V/M
ITO
or M
ITO
X
5-FU
/LV
/oxa
lipla
tin
5-FU
/IFN
alfa
-2b
5-FU
/LV;
5-F
U/M
TX5F
U/L
V5-
FU5-
FU/L
V
acti
vity
mRN
Am
RNA
+ IH
C T
S106
IHC
po
lycl
on
alIH
C T
S106
IHC
po
lycl
on
alIH
C T
S106
IHC
po
lycl
on
alm
RNA
mRN
AIH
C p
oly
clo
nal
IHC
MRN
AA
ctiv
ity
acti
vity
hig
h T
S re
late
d to
no
n-r
esp
on
seh
igh
TS
rela
ted
to n
on
-res
po
nse
low
TS
rela
ted
to re
spo
nse
low
TS
rela
ted
to re
spo
nse
hig
h T
S re
late
d to
no
n-r
esp
on
selo
w T
S re
late
d to
resp
on
selo
w T
S re
late
d to
resp
on
selo
w m
eta-
TS re
late
d to
resp
on
selo
w T
S re
late
d to
resp
on
seh
igh
TS
rela
ted
to n
on
-res
po
nse
no
co
rrel
atio
ns
fou
nd
low
TS
rela
ted
to re
spo
nse
5FU
/LV
hig
h T
S re
late
d to
lon
ger
su
rviv
allo
w T
S re
late
d to
5-F
U s
ensi
tivi
tylo
w T
S re
late
d to
5-F
U re
spo
nse
Pete
rs e
t al
. [11
4]Le
ich
man
et
al. [
115]
Len
z et
al.
[116
]C
asci
nu
et
al. [
117]
Wo
ng
et
al. [
118]
Asc
hel
e et
al.
[119
]Pa
rad
iso
et
al. [
120]
Asc
hel
e et
al.
[121
]K
orn
man
n e
t al
. [12
2]Sh
iro
ta e
t al
. [12
3]Fi
nd
lay
et a
l. [1
24]
Asc
hel
e et
al.
[125
]K
orn
man
n e
t al
. [84
]Fu
jii e
t al
. [61
]N
oo
rdh
uis
et
al. [
126]
gas
tric
65 38 30 39 38
5-FU
/LV
/cis
pla
tin
5-FU
/LV
/cis
pla
tin
5-FU
/LV
/cis
pla
tin
5-FU
/cis
pla
tin
5-FU
/MTX
mRN
Am
RNA
IHC
TS1
06IH
C
IHC
low
TS
rela
ted
to lo
ng
er s
urv
ival
hig
h T
S re
late
d to
no
n-r
esp
on
seh
igh
TS
rela
ted
to n
on
-res
po
nse
low
TS
rela
ted
to re
spo
nse
no
co
rrel
atio
ns
fou
nd
Len
z et
al.
[127
]M
etzg
er e
t al
. [12
8]Ye
h e
t al
. [12
9]B
oku
et
al. [
130]
Tah
ara
et a
l. [8
7]
hea
d a
nd
nec
k 70 82 52
5-FU
/LV
/cis
pla
tin
/MTX
/IFN
5-FU
/LV
/cis
pla
tin
5-FU
IHC
TS1
06TS
act
ivit
yTS
act
ivit
y
hig
h T
S re
late
d to
no
n-r
esp
on
sen
o c
orr
elat
ion
s fo
un
dn
o c
orr
elat
ion
s fo
un
d
Joh
nst
on
et
al. [
131]
Etie
nn
e et
al.
[89]
Etie
nn
e et
al.
[88]
NSC
LC60 68
in v
itro
5-F
U s
ensi
tivi
ty5-
FU o
r UFT
®Fd
UM
P b
ind
ing
IHC
po
lycl
on
alTS
no
t re
late
d to
5-F
U s
ensi
tivi
tylo
w T
S re
late
d to
lon
ger
su
rviv
alH
igas
hiy
ama
et a
l. [9
3]H
uan
g e
t al
. [92
]
bre
ast
75 121
CA
F re
gim
enC
AF
or C
MF
reg
imen
mRN
ATS
act
ivit
yn
o c
orr
elat
ion
s fo
un
dh
igh
TS
rela
ted
to b
ette
r tre
atm
ent
ef-
ficac
y af
ter f
ailu
re o
n t
amox
ifen
Liza
rd-N
aco
l et
al. [
132]
Foek
ens
et a
l. [7
7]
pan
crea
tic
735-
FU b
ased
TS m
RNA
Hig
h T
S re
late
d to
5-F
U re
spo
nse
Hu
et
al. [
133]
MTX
= m
etho
trexa
te; M
ITO
= m
itom
ycin
e; M
ITOX
= m
itoxa
ntro
ne; IH
C =
imm
unoh
istoc
hem
istry
; TS1
06 =
mon
oclo
nal a
ntib
ody
agai
nst T
S; IF
N =
inte
rfero
n
Chapter 2
32
Genetic factors influencing pyrimidine-antagonist chemotherapy
33
unclear clinical implications [136].
Finally, the assay type may have influenced the outcome of some studies, since
immunohistochemistry as well as rt-PCR were used to measure TS expression.
Immunohistochemistry has been performed using different types of antibodies, including
monoclonal TS106 was well as polyclonal antibodies. Differences in binding specificity
and selectivity may have had a decisive impact on study outcome. Furthermore, the issue
of infiltrating cells disturbing tumour tissue homogeneity and thus troubling PCR data, as
mentioned earlier when interpreting TP data, may also hold for TS.
Acknowledging the importance of TS expression in colorectal cancer, another determinant
for 5-FU cytotoxicity may be the enzyme dUTP nucleotidohydrolase (dUTPase), which is
the key regulator of dUTP pools. There are at least two isoforms of dUTPase, a nuclear
and a mitochondrial form, encoded by the same gene. In tumour cell lines, increased
dUTPase levels accounted for resistance to the 5-FU metabolite 5’dFUR [136,137]. In a
small retrospective study in tumours of 20 metastatic colorectal cancer patients, high
nuclear dUTPase protein expression was associated with poor tumour response on 5-FU
therapy [138]. However, larger studies are needed to establish the role of dUTPase in 5-FU
chemoresistance.
Impact of somatic mutations and gene expression levels: gemcitabine and cytarabine
Resistance to nucleoside analogues can be due to a number of factors, affecting drug
metabolism, including increased deamination, loss of expression of activating kinases,
and increased activity of nucleotidases. In vitro, gene transfer of CDA cDNA into murine
fibroblast cells was shown to induce cellular resistance to ara-C through increased deami-
nation [140]. In patients with acute myeloid leukaemia (AML), pre-treatment CDA activity
did correlate with response on ara-C induction treatment in two studies both involving 36
patients [141,142]. Ara-C resistance has also been associated with low dCK activity both
in vitro [143,144] and in 21 AML patients [145]. In turn, increased dCK activity was associ-
ated with increased activation of both compounds to cytotoxic nucleoside triphosphate
derivates. However, mutational inactivation of dCK is not thought to confer resistance to
ara-C in AML patients because mutations in the dCK gene are rarely found in refractory
or relapsed AML patients [146,147]. Alternatively, inactivation of dCK by the formation of
alternatively spliced dCK transcripts has been demonstrated in 7 out of 12 patients with
resistant AML compared to 1 out of 10 patient with sensitive AML [148]. This mechanism
is probably a cause of therapy failure in patients with resistant AML [149]. Finally, high
5NT expression in blast cells was shown to be an independent prognostic factor for poor
outcome in 108 AML patients after ara-C containing regimens [150]. The balance between
dCK and 5NT might predict drug toxicity, since strongly increased 5NT activity combined
Chapter 2
32
Genetic factors influencing pyrimidine-antagonist chemotherapy
33
with reduced dCK activity was observed in a human leukaemic cell line, resistant to ara-C
and gemcitabine [151].
Apart from resistance to nucleoside analogues caused by aberrant drug metabolism,
altered drug transport may cause decreased chemosensitivity. Recently, overexpression of
the human multidrug resistance protein 5 (MRP5), an ABC transporter known to transport
nucleotide monophosphates, has been associated with resistance to gemcitabine in vitro
[152]. MRP5 mediated efflux of gemcitabine metabolites may lower the accumulation of
gemcitabine in cells. So far, other chemoresistance related transport mechanisms have
not been identified for pyrimidine antagonists.
Other proteins related to pyrimidine antagonist chemosensitivity
As mentioned in the previous sections, expression levels of specific proteins, directly
involved in drug metabolism of pyrimidine antagonists may affect treatment efficacy.
However, expression of genes related to cell growth and the apoptotic pathway may also
affect chemosensitivity. This interaction of apoptosis regulator proteins with chemosen-
sitivity is an intriguing issue, but an extensive analysis of current literature on this subject
falls outside the scope of this review. The most extensively studied genes with regard
to pyrimidine antagonist chemotherapy are bcl-2, bax, c-myc and p53 [153-161]. Here,
we will only briefly report on the putative role of p53 with respect to 5-FU efficacy, as
this relationship has been most extensively studied. Mutations in the p53 gene and p53
overexpression have been associated with 5-FU chemoresistance both in vitro [162-164]
and in vivo in colorectal [117,165-168], head and neck [169,170], and breast cancer [171].
However, results in some other studies are less unequivocal [172,173]. Recently, it has been
suggested that only patients whose primary colorectal tumour contain amplified c-myc
and wild-type p53 might benefit from 5-FU based chemotherapy [174]. Interestingly,
there is an increasing evidence of interactions between TS and p53. P53 gene mutation
and protein overexpression are associated with increased TS mRNA levels and TS cyto-
plasmatic protein in colorectal tumours [117,121,175]. It has been demonstrated that
wild-type p53 is able to bind TS mRNA which results in a feedback regulation of TS protein
synthesis [176]. In cells with mutated p53 this feedback mechanism fails and, as previously
mentioned, overexpression of TS is associated with poor clinical outcome.
Impact of current data on clinical practice
Summarising, we conclude that in tumour material none of the enzymes discussed above
can currently function as predictive marker by itself. So far, only small studies have been
performed and drawing conclusions from combined data of these often statistically
Chapter 2
34
Genetic factors influencing pyrimidine-antagonist chemotherapy
35
Tabl
e 5
Ove
rvie
w o
f pro
tein
s tha
t pot
entia
ly m
ay a
ffect
dru
g tre
atm
ent o
utco
me
due
to a
ltere
d ge
ne e
xpre
ssio
n
Pro
tein
Dru
gP
atie
nt
dat
aC
on
seq
uen
ces
Dih
ydro
pyr
imid
ine
deh
ydro
gen
ase
(DPD
)5-
FU
mis
cella
neo
us
can
cer
typ
esH
igh
DPD
act
ivit
y in
tu
mo
ur t
issu
e as
soci
ated
wit
h
red
uce
d 5
-FU
effi
cacy
dU
TP n
ucl
eoti
do
hyd
rola
se (d
UTP
ase)
5-
FU a
nd
an
alo
gu
esco
lore
ctal
can
cer
Hig
h d
UTP
ase
acti
vity
may
be
asso
ciat
ed w
ith
red
uce
d
5-FU
effi
cacy
Thym
idin
e ki
nas
e (T
K)
5-FU
an
d a
nal
og
ues
bre
ast
can
cer
Un
kno
wn
, in
con
clu
sive
dat
a
Thym
ine
ph
osp
ho
ryla
se /
En
do
thel
ial c
ell g
row
th fa
cto
r (TP
; EC
GF1
)5-
FU
Co
lore
ctal
can
cer
Gas
tric
can
cer
Bre
ast
can
cer
Un
kno
wn
, in
con
clu
sive
dat
a
Thym
idyl
ate
syn
thas
e (T
S)5-
FU a
nd
an
alo
gu
esco
lore
ctal
can
cer
Hig
h T
S ex
pre
ssio
n a
sso
ciat
ed w
ith
red
uce
d 5
-FU
ef-
ficac
y
Cyt
idin
e d
eam
inas
e (C
DA
)A
ra-C
(gem
cita
bin
e)A
cute
mye
loid
leu
kaem
iaH
igh
CD
A e
xpre
ssio
n a
sso
ciat
ed w
ith
red
uce
d e
ffica
cy
of a
ra-C
Deo
xycy
tid
ine
kin
ase
(dC
K)
Ara
-C(g
emci
tab
ine)
Acu
te m
yelo
id le
uka
emia
Low
dC
K e
xpre
ssio
n a
sso
ciat
ed w
ith
resi
sten
ce to
ar
a-C
5’-n
ucl
eoti
das
e(5
NT
)A
ra-C
(gem
cita
bin
e)A
cute
mye
loid
leu
kaem
iaH
igh
5N
T ex
pre
ssio
n a
sso
ciat
ed w
ith
red
uce
d e
ffica
cy
of a
ra-C
Chapter 2
34
Genetic factors influencing pyrimidine-antagonist chemotherapy
35
underpowered studies is fairly impossible due to differences in applied techniques or
patient groups. Clinical practice affecting studies are not available yet. Good predictive
genetic markers or marker sets are lacking. The specificity of a predictive marker needs to
be high, as it will be used to discriminate between treatment options. Probably, panels of
genes will be needed to obtain an adequate specificity. To find such gene panels, far more
studies are needed. Looking at current data, a combination of the expression of DPD, TS,
TP and OPRT, all four crucial enzymes in the metabolism of 5-FU, at least appears to be a
promising approach in colorectal cancer [61-63,177-179] (table 5).
Future perspectives: the polygenetic approach
Despite the here summarised potential genes and proteins interfering with pyrimidine
antagonist metabolism, only few factors indeed have been proven to affect chemothera-
py efficacy and/or toxicity. Most consistent data is available regarding the role of TS, DPD
and p53 in 5-FU chemotherapy, and that of TP in capecitabine chemotherapy (see table 1
and table 5). The impact of germ line DPD deficiency on 5-FU pharmacokinetics and the
development of severe life threatening toxicity is obvious. Although screening on germ
line DPD deficiency is currently believed to be too expensive, it should become standard
clinical practice as soon as a rapid and cheap test becomes available.
Regarding 5-FU efficacy, some attempts recently have been made to identify putative
markers of response in tumour material for use in patient treatment guidance
[89,131,176,180]. However, despite some promising studies, the overall data are difficult
to interpret and not always in line with previous results in larger patient groups. This
might, at least in part, be due to the complexity in transcription and translation of some of
the genes discussed above (e.g. TS). Additional mechanistic studies are needed to explore
this issue more in detail. Furthermore, as mentioned before, many available studies
are insufficiently powered to reach statistical significance. Therefore, incorporation of
pharmacogenomic issues in future phase II and III clinical trials should be encouraged.
Another cause for inconsistency in current data may be found in the applied scientific
methodology. Crucial factor in the search for predictive markers is the availability of a
standardised, accurate, precise and robust test. Method validation, such as performed
for the TS106 antibody for TS immunohistochemistry, is a prerequisite for standardised
testing [181]. Subsequently, these quality controlled diagnostics should be tested not only
retrospectively, but also in prospective multi-center (and multi-laboratory) clinical trials.
Unfortunately, such tests are not available yet.
Also causing inconsistency in the outcome of monogenetic studies may be the fact that
the impact of other genes related to response and survival is ignored in the final calcula-
tions. Since cancer is a genetically heterogeneous disease, the monogenetic approach is
likely too simple. This implies that far more research is needed to gain more insight in the
Chapter 2
36
Genetic factors influencing pyrimidine-antagonist chemotherapy
37
exact role of genetic polymorphisms and gene expression levels on pyrimidine antagonist
chemotherapy. The interaction between TS and p53, combined with the impact of several
TS polymorphisms illustrates the complexity of pharmacogenomic research.
The two most important approaches in current and near future research to find predic-
tive marker sets will be the candidate gene and the microarray strategies. A broad range
of candidate genes to focus on in future research has been summarised in this review.
On the other hand, further developments in microarray techniques and proteomics may
eventually lead to the identification of a subset of relevant genes for a certain drug in
a certain tumour type. In the near future, identification of relevant germline polymor-
phisms, combined with relevant mRNA expression levels in tumour tissue, might permit
more effective, individualised cancer chemotherapy. Ideally, a process of “chemotyping”,
i.e. choosing the right chemotherapy regimen in the right dose, based on selected geno-
typical and phenotypical information, should precede drug prescribing. The interdiscipli-
nary Pharmacogenetics Anticancer Agents Research (PAAR) group is an example of an
excellent initiative to coordinate research on these issues [182]. Eventually, well-controlled
prospective clinical trials with adequate sample size and statistical power will be needed
to demonstrate the surplus value of new concepts above current practice.
Chapter 2
36
Genetic factors influencing pyrimidine-antagonist chemotherapy
37
References
1. Harari PM. Why has induction chemotherapy of advanced head and neck cancer become a
United States community standard of practice? J Clin Oncol 1997;15:2050-2055
2. Macdonald JS, Astrow AB. Adjuvant therapy of colon cancer. Semin Oncol 2001;28:30-40
3. Cochrane Review. Multi-agent chemotherapy for early breast cancer. Cochrane Database Syst
Rev. 2002;CD000487
4. Wiernik PH. Current status of and future prospects for the medical management of adenocarci-
noma of the exocrine pancreas. J Clin Gastroenterol 2000;30:357-363
5. Sorenson S, Glimelius B, Nygren P, SBU group. Swedish Council of Technology Assessment in
Health Care. A systematic overview of chemotherapy effects in non-small cell lung cancer. Acta
Oncol 2001;40:327-339
6. Bishop JF. Approaches to induction therapy with adult acute myeloid leukaemia. Acta Haematol
1998; 99:133-137
7. Pinedo HM, Peters GF. Fluorouracil: biochemistry and pharmacology. J Clin Oncol 1988;6:1653-
1664
8. Diasio RB, Johnson MR. The role of pharmacogenetics and pharmacogenomics in cancer chemo-
therapy with fluorouracil. Pharmacology 2000;61:199-203
9. Ho DH, Townsend L, Luna MA, Bodey GP. Distribution and inhibition of dihydrouracil dehydro-
genase activities in human tissues using 5-fluorouracil as a substrate. Anticancer Res 1986;6:781-
784
10. Kuhn JG. Fluorouracil and the new oral fluorinated pyrimidines. Ann Pharmacother 2001;35:217-
227
11. Kufe DW, Spriggs DR. Biochemical and cellular pharmacology of cytosine arabinoside. Semin
Oncol 1985;12:34-48
12. Plunkett W, Huang P, Xu YZ, Heinemann V, Grunewald R, Gandhi V. Gemcitabine: metabolism,
mechanisms of action, and self-potentiation. Sem Oncol 1995;22:3-10
13. Plunkett W, Huang P, Gandhi V. Preclinical characteristics of gemcitabine. Anticancer Drugs
1995;6:7-13
14. Giblett ER, Anderson JE, Chen SH, Teng YS, Cohen F. Uridine monophosphate kinase: a new ge-
netic polymorphism with possible clinical implications. Am J Hum Genet 1974;26:627-635
15. Komatsu N, Kimura Y, Kido A, Oya M. Polymorphism of uridine monophosphate kinase: popula-
tion study in Japanese and phenotyping in blood stains. Int J Legal Med 1990;104:13-16
16. Halasa J, Schlesinger D, Manczak M. UMPK polymorphism in the Polish population. Arch Immunol
Ther Exp 1985;33:621-624
17. Gallango ML, Suinaga R. Uridine monophosphate polymorphism in two Venezuelan populations.
Am J Hum Genet 1978;30:215-218
18. Suchi M, Mizuno H, Kawai Y, Tsuboi T, Sumi S, Okajima K, Hodgson mE, Ogawa H, Wada Y. Molecular
cloning of the human UMP synthase gene and characterization of point mutations in two heredi-
tary orotic aciduria families. Am J Hum Genet 1997;60:525-539
Chapter 2
38
Genetic factors influencing pyrimidine-antagonist chemotherapy
39
19. Kawakami K, Omura K, Kanehira E, Watanabe Y. Polymorphic tandem repeats in the thymidylate
synthase gene is associated with its protein expression in human gastrointestinal cancers. Anti-
cancer Res 1999;19:3249-3252
20. Marsh S, McKay JA, Cassidy J, McLeod HL. Polymorphism in the thymidylate synthase promoter
enhancer region in colorectal cancer. Int J Oncol 2001;19:383-386
21. Kawakami K, Salonga D, Park JM, Danenberg KD, Uetake H, Brabender J, et al. Different lengths of
a polymorphic repeat sequence in the thymidylate synthase gene affect translational efficiency
but not its gene expression. Clin Cancer Res 2001;7:4096-4101
22. Merkelbach-Bruse S, Hans V, Mathiak M, Sanguedolce R, Alessandro R, Ruschoff J, et al. Associa-
tions between polymorphisms in the thymidylate synthase gene, the expression of thymidylate
synthase mRNA and the microsatellite instability phenotype of colorectal cancer. Oncol Rep
2004; 11:839-843.
23. Marsh S, Colli-Duguid ES, Li T, Liu X, McLeod HL. Ethnic variation in the thymidylate synthase
enhancer region polymorphism among Caucasians and Asian populations. Genomics 1999;58:
310-312
24. Etienne MC, Ilc K, Formento JL, Laurent-Puig P, Formento P, Cheradame S, et al. Thymidylate syn-
thase and methylenetetrahydrofolate reductase gene polymorphisms: relationships with 5-fluo-
rouracil sensitivity. Br J Cancer 2004;90:526-534.
25. Villafranca E, Okruzhnov Y, Dominguez MA, Garcia-Foncillas J, Azinovic I, Martinez E, et al. Poly-
morphisms of the repeated sequences in the enhancer region of the thymidylate synthase gene
promoter may predict downstaging after preoperative chemoradiation in rectal cancer. J Clin
Oncol 2001;19:1779-1786
26. Park DJ, Stoehlmacher J, Zhang W, Tsao-Wei D, Groschen S, Lenz HJ. Thymidylate synthase gene
polymorphism predicts response to capecitabine in advanced colorectal cancer. Int J Colorectal
Dis 2002;17:46-49
27. Iacopetta B, Grieu F, Joseph D, Elsaleh H. A polymorphism in the enhancer region of the thymi-
dylate synthase promoter influences the survival of colorectal cancer patients treated with 5-
fluorouracil. Br J Cancer 2001;85:827-830
28. Tsuji T, Hidaka S, Sawai T, Nakagoe T, Yano H, Haseba M, Komatsu H, Shindou H, Fukuoka H, Yoshi-
naga M, Shibasaki S, Nanashima A, Yamaguchi H, Yasutake T, Tagawa Y. Polymorphism in the
thymidylate synthase promoter enhancer region is not an efficacious marker for tumor sensi-
tivity to 5-fluorouracil-based oral adjuvant chemotherapy in colorectal cancer. Clin Cancer Res
2003;9:3700-3704
29. Jonker DJ, Maroun JA, Le Francois B, Dahrouge S, Birnboim HC. Correlation between 2 thymi-
dylate synthase gene polymorphisms and clinical outcomes in colorectal cancer patients receiv-
ing adjuvant chemotherapy. Proc Am Soc Clin Oncol 2002; abstract 638
30. Kawakami K, Watanabe G. Identification and functional analysis of single nucleotide polymor-
phism in the tandem repeat sequence of thymidylate synthase gene. Cancer Res 2003;63:6004-
6007.
31. Mandola MV, Stoehlmacher J, Muller-Weeks S, Cesarone G, Yu MC, Lenz HJ, Ladner RD. A novel
Chapter 2
38
Genetic factors influencing pyrimidine-antagonist chemotherapy
39
single nucleotide polymorphism within the 5’ tandem repeat polymorphism of the thymidylate
synthase gene abolishes USF-1 binding and alters transcriptional activity. Cancer Res 2003;63:
2898-2904
32. Ulrich CM, Bigler J, Velicer CM, Greene EA, Farin FM, Potter JD. Searching expressed sequence tag
databases: discovery and confirmation of a common polymorphism in the thymidylate synthase
gene. Cancer Epidemiol Biomarkers Prev 2000;9:1381-1385
33. Mandola MV, Stoehlmacher J, Zhang W, Groshen S, Yu MC, Iqbal S, et al. A 6 bp polymorphism
in the thymidylate synthase gene causes message instability and is associated with decreased
intratumoral TS mRNA levels. Pharmacogenetics 2004;14:319-327.
34. Kawakami K, Ishida Y, Danenberg KD, Omura K, Watanabe G, Danenberg PV. Functional polymor-
phism of the thymidylate synthase gene in colorectal cancer accompanied by frequent loss of
heterozygosity. Jpn J Cancer Res 2002;93:1221-1229.
35. Uchida K, Hayashi K, Kawakami K, Schneider S, Yochim JM, Kuramochi H, et al. Loss of heterozy-
gosity at the thymidylate synthase (TS) locus on chromosome 18 affects tumor response and
survival in individuals heterozygous for a 28-bp polymorphism in the TS gene. Clin Cancer Res
2004;10:433-439.
36. Van Kuilenburg ABP, Haasjes J, Richel DJ, Zoetekouw L, Van Lenthe H, Waterham HR, et al. Clinical
implications of dihydropyrimidine dehydrogenase (DPD) deficiency in patients with severe 5-
fluorouracil associated toxicity. Identification of new mutations in the DPD gene. Clin Cancer Res
2000;6:4705-4712
37. Collie-Duguid ES, Etienne MC, Milano G, McLeod HL. Known variant DPYD alleles do not explain
DPD deficiency in cancer patients. Pharmacogenetics 2000;10: 217-223
38. Van Kuilenburg ABP, De Abreu RA, Van Gennip AH. Pharmacogenetic and clinical aspects of dihy-
dropyrimidine dehydrogenase deficiency. Ann Clin Biochem 2003;40:41-45
39. Diasio RB, Beavers TL, Carpenter JT. Familial deficiency of dihydropyrimidine dehydrogenase. Bio-
chemical basis for familial pyrimidinemia and severe 5-fluorouracil-induced toxicity. J Clin Invest
1988;81:47-51
40. Maring JG, van Kuilenburg ABP, Haasjes J, Piersma H, Groen HJM, Uges DRA, et al. Reduced 5-FU
clearance in a patient with low DPD activity due to heterozygosity for a mutant allele of the
DPYD gene. Br J Cancer 2002;86:1028-103
41. Lu Z, Zhang R, Diasio RB. Dihydropyrimidine dehydrogenase activity in human peripheral blood
mononuclear cells and liver: population characteristics, newly identified deficient patients, and
clinical implication in 5-fluorouracil chemotherapy. Cancer Res 1993;53:5433-5438
42. Etienne MC, Lagrange JL, Dassonville O, Fleming R, Thyss A, Renee N, et al. Population study of
dihydropyrimidine dehydrogenase in cancer patients. J Clin Oncol 1994;12:2248-53
43. Mattison LK, Ezzeldin H, Carpenter M, Modak A, Johnson MR, Diasio RB. Rapid identification of di-
hydropyrimidine dehydrogenase deficiency by using a novel 2-13C-uracil breath test. Clin Cancer
Res 2004;10:2652-2658
44. Maring JG, Oonk BN, De Vries EGE, Hospers GAP. Plasma pharmacokinetics of uracil after an oral
uracil challenge dose for dihydropyrimidine dehydrogenase (DPD) phenotyping. Proc Am Soc
Chapter 2
40
Genetic factors influencing pyrimidine-antagonist chemotherapy
41
Clin Oncol 2004; abstract 2120
45. Danenberg PV, Danenberg KD. Effect of 5, 10-methylenetetrahydrofolate on the dissociation of
5-fluoro-2’-deoxyuridylate from thymidylate synthetase: evidence for an ordered mechanism.
Biochemistry 1978;17:4018-24
46. Stern LL, Bagley PJ. Rosenberg IH, Selhub J. Conversion of 5-formylhydrofolic acid to 5-methylhy-
drofolic acid in unimpaired folate-adequate persons homozygous for the C677T mutation in the
methylene tetrahydrofolate reductase gene. J Nutr 2000;130:2238-2242
47. Wilcken B, Bamforth F, Li Z, Zhu H, Ritvanen A, Redlund M, Stoll C, Alembik Y, et.al. Geographical
an ethnic variation of the 677C>T allele of 5,10 methylenetetrahydrofolate reductase (MTHFR):
findings from over 7000 newborns from 16 areas world wide. J Med Genet 2003;40:619-625
48. Wisotzkey JD, Toman J, Bell T, Monk JS, Jones D. Polymorphisms and stage III colon cancer: re-
sponse to therapy. Mol Diagn 2000;5:5-6
49. Kawakami K, Omura K, Kanehira E, Watanabe G. Methylene tetrahydrofolate reductase polymor-
phism is associated with folate pool in gastrointestinal tissue. Anticancer Res 2001;21:285-289
50. Cohen V, Panet-Raymond V, Sabbaghian N, Morin I, Batist G, Rozen R. Methylenetetrahydrofolate
Reductase Polymorphism in Advanced Colorectal Cancer: A Novel Genomic Predictor of Clinical
Response to Fluoropyrimidine-based Chemotherapy. Clin Cancer Res 2003;9:1611-1615.
51. Sohn KJ, Croxford R, Yates Z, Lucock M, Kim YI. Effect of the methylenetetrahydrofolate reductase
C677T polymorphism on chemosensitivity of colon and breast cancer cells to 5-fluorouracil and
methotrexate. J Natl Cancer Inst 2004;96:134-144.
52. Daigo S, Takahashi Y, Fujieda M, Ariyoshi N, Yamazaki H, Koizumi W, et al. A novel mutant allele of
the CYP2A6 gene (CYP2A6*11) found in a cancer patient who showed poor metabolic pheno-
type towards tegafur. Pharmacogenetics 2002;12:299-306
53. Kirch HC, Schroder JK, Hoppe H, Esche H, Seeber S, Schutte J. Recombinant gene products of two
natural variants of the human cytidine deaminase gene confer different deamination rates of
cytarabine in vitro. Exp Hematol 1998;26:421-425
54. Morita T, Matsuzaki A, Kurokawa S, Tokue A. Forced expression of cytidine deaminase confers
sensitivity to capecitabine. Oncology 2003;65:267-274.
55. Marinaki AM, Escuredo E, Duley JA, Simmonds HA, Amici A, Naponelli V, et al. Genetic basis of
hemolytic anemia caused by 5’-nucleotidase deficiency. Blood 2001;97:3327-3332
56. Banerjee D, Gorlick R, Sowers R, Miles JS, Rode W, Kemeny N, et al. Lack of uridine monophosphate
kinase (UMPK) expression in tumour samples from colorectal cancer patients clinically resistant
to 5-fluorouracil. Proc Am Soc Clin Oncol 2002; abstract 350
57. Inaba M, Mitsuhashi J, Sawada H, Miike N, Naoe Y, Daimon A, et al. Reduced activity of anabolizing
enzymes in 5-fluorouracil-resistent human stomach cancer cells. Jpn J Cancer Res 1996;87:212-
220
58. Inaba M, Naoe Y, Mitsuhashi J. Mechanisms of 5-fluorouracil resistance in human colon cancer
DLD-1 cells. Biol Pharm Bull 1998;21:569-573
59. Chung YM, Park SH, Park JK, Kim YT, Kang YK, Yoo YD. Establishment and characterization of 5-
fluorouracil-resistant gastric cancer cells. Cancer Lett 2000;159:95-101
Chapter 2
40
Genetic factors influencing pyrimidine-antagonist chemotherapy
41
60. Murakami Y, Kazuno H, Emura T, Tsujimoto H, Suzuki N, Fukushima M. Different mechanisms of ac-
quired resistance to fluorinated pyrimidines in human colorectal cancer cells. Int J Oncol 2000;17:
277-283
61. Fujii R, Seshimo A, Kameoka S. Relationships between the expression of thymidylate synthase,
dihydropyrimidine dehydrogenase, and orotate phosphoribosyltransferase and cell proliferative
activity and 5-fluorouracil sensitivity in colorectal carcinoma. Int J Clin Oncol 2003;8:72-78.
62. Isshi K, Sakuyama T, Gen T, Nakamura Y, Kuroda T, Katuyama T, et al. Predicting 5-FU sensitivity
using human colorectal cancer specimens: comparison of tumor dihydropyrimidine dehydroge-
nase and orotate phosphoribosyl transferase activities with in vitro chemosensitivity to 5-FU. Int
J Clin Oncol 2002;7:335-342.
63. Ichikawa W, Uetake H, Shirota Y, Yamada H, Takahashi T, Nihei Z, et al. Both gene expression for
orotate phosphoribosyltransferase and its ratio to dihydropyrimidine dehydrogenase influence
outcome following fluoropyrimidine-based chemotherapy for metastatic colorectal cancer. Br J
Cancer 2003;89:1486-1492.
64. Cuq P, Rouquet C, Evrard A, Ciccolini J, Vian L, Cano JP. Fluoropyrimidine sensitivity of human MCF-
7 breast cancer cells stably transfected with human uridine phosphorylase. Br J Cancer 2001;84:
1677-1680.
65. Fox SB, Engels K, Comley M, Whitehouse RM, Turley H, Gatter KC, et al. Relationship of elevated
tumour thymidine phosphorylase in node-positive breast carcinomas to the effects of adjuvant
CMF. Ann Oncol 1997;8:271-275
66. Metzger R, Danenberg K, Leichman CG, Salonga D, Schwartz EL, Wadler S, et al. High basal level
gene expression of thymidine phosphorylase (platelet-derived endothelial cell growth factor) in
colorectal tumors is associated with nonreponse to 5-fluorouracil. Clin Cancer Res 1998;4:2371-
2376
67. Kikuyama S, Inada T, Shimizu K, Miyakita M, Ogata Y. P53, bcl-2 and thymidine phosphorylase
as predictive markers of chemotherapy in patients with advanced and recurrent gastric cancer.
Anticancer Res 2001;21:2149-2153
68. Saito H, Tsujitani S, Oka S, Kondo A, Ikeguchi M, Maeta M, et al. The expression of thymidine phos-
phorylase correlates with angiogenesis and the efficacy of chemotherapy using fluorouracil
derivatives in advanced gastric carcinoma. Br J Cancer 1999;81:484-489
69. Marchetti S, Chazal M, Dubreuil A, Fischel JL, Etienne MC, Milano G. Impact of thymidine phos-
phorylase surexpression on fluoropyrimidine activity and on tumour angiogenesis. Br J Cancer
2001;85:439-445
70. Morita T, Matsuzaki A, Tokue A. Enhancement of sensitivity to capecitabine in human renal carci-
noma cells transfected with thymidine phosphorylase cDNA. Int J Cancer 2001;92:451-456
71. de Bruin M, van Capel T, Van der Born K, Kruyt FA, Fukushima M, Hoekman K, et al. Role of platelet-
derived endothelial cell growth factor/thymidine phosphorylase in fluoropyrimidine sensitivity.
Br J Cancer 2003;88:957-964
72. Evrard A, Cuq P, Robert B, Vian L, Pelegrin A, Cano JP. Enhancement of 5-fluorouracil cytotoxicity
by human thymidine-phosphorylase expression in cancer cells: in vitro and in vivo study. Int J
Chapter 2
42
Genetic factors influencing pyrimidine-antagonist chemotherapy
43
Cancer 1999;80:465-470
73. Evrard A, Cuq P, Ciccolini J, Vian L, Cano JP. Increased cytotoxicity and bystander effect of 5-fluoro-
uracil and 5-deoxy-5-fluorouridine in human colorectal cancer cells transfected with thymidine
phosphorylase. Br J Cancer 1999;80:1726-1733.
74. Schwartz EL, Baptiste N, Wadler S, Makower D. Thymidine phosphorylase mediates the sensitivity
of human colon carcinoma cells to 5-fluorouracil. J Biol Chem 1995;270:19073-19077.
75. van Triest B, Pinedo HM, Blaauwgeers JL, van Diest PJ, Schoenmakers PS, Voorn DA, et al. Prog-
nostic role of thymidylate synthase, thymidine phosphorylase/platelet-derived endothelial cell
growth factor, and proliferation markers in colorectal cancer. Clin Cancer Res 2000;6:1063-1072
76. Radparvar S, Houghton PJ, Germain G, Pennington J, Rahman A, Houghton JA. Cellular pharma-
cology of 5-fluorouracil in a human colon adenocarcinoma cell line selected for thymidine kinase
deficiency. Biochem Pharmacol 1990;39:1759-1765
77. Foekens JA, Romain S, Look MP, Martin PM, Klijn JG. Thymidine kinase and thymidine synthase in
advanced breast cancer: response to tamoxifen and chemotherapy. Cancer Res 2001;61:1421-
1425
78. Beck A, Etienne MC, Cheradame S, Fischel JL, Formento P, Renee N, et al. A role for dihydropyrimi-
dine dehydrogenase and thymidylate synthase in tumour sensitivity to fluorouracil. Eur J Cancer
1994;30A:1517-1522
79. Kirihara Y, Yamamoto W, Toge T, Nishiyama M. Dihydropyrimidine dehydrogenase, multidrug
resistance-associated protein, and thymidylate synthase gene expression levels can predict 5-
fluorouracil resistance in human gastrointestinal cancer cells. Int J Oncol 1999;14:551-556
80. Ishikawa Y, Kubota T, Otani Y, Watanabe M, Teramoto T, Kumai K, et al. Dihydropyrimidine dehydro-
genase activity and messenger RNA level may be related to the antitumor effect of 5-fluorouracil
on human tumor xenografts in nude mice. Clin Cancer Res 1999;5:883-889
81. Salonga D, Danenberg KD, Johnson M, Metzger R, Groshen S, Tsao-Wei DD, et al. Colorectal tumors
responding to 5-fluorouracil have low gene expression levels of dihydropyrimidine dehydroge-
nase, thymidylate synthase, and thymidine phosphorylase. Clin Cancer Res 2000;6:1322-1327
82. Ikeguchi M, Makino M, Kaibara N. Thymidine phosphorylase and dihydropyrimidine dehydroge-
nase activity in colorectal carcinoma and patients prognosis. Langenbecks Arch Surg 2002;387:
240-245
83. Kornmann M, Link KH, Galuba I, Ott K, Schwabe W, Hausler P et al. Association of time to recur-
rence with thymidylate synthase and dihydropyrimidine dehydrogenase mRNA expression in
stage II and III colorectal cancer. J Gastrointest Surg 2002;6:331-337
84. Kornmann M, Schwabe W, Sander S, Kron M, Strater J, Polat S, et al. Thymidylate synthase and
dihydropyrimidine dehydrogenase mRNA expression levels: predictors for survival in colorectal
cancer patients receiving adjuvant 5-fluorouracil. Clin Cancer Res 2003;9:4116-4124
85. Terashima M, Irinoda T, Fujiwara H, Nakaya T, Takagane A, Abe K, et al. Roles of thymidylate syn-
thase and dihydropyrimidine dehydrogenase in tumor progression and sensitivity to 5-fluoro-
uracil in human gastric cancer. Anticancer Res 2002;22(2A):761-768
86. Terashima M, Fujiwara H, Takagane A, Abe K, Araya M, Irinoda T, et al. Role of thymidine phos-
Chapter 2
42
Genetic factors influencing pyrimidine-antagonist chemotherapy
43
phorylase and dihydropyrimidine dehydrogenase in tumour progression and sensitivity to doxi-
fluridine in gastric cancer patients. Eur J Cancer 2002;38:2375-2381
87. Tahara M, Ochiai A, Fujimoto J, Boku N, Yasui W, Ohtsu A, et al. Expression of thymidylate syn-
thase, thymidine phosphorylase, dihydropyrimidine dehydrogenase, E2F-1, Bak, Bcl-X, and Bcl-2,
and clinical outcomes for gastric cancer patients treated with bolus 5-fluorouracil. Oncol Rep
2004;11:9-15
88. Etienne MC, Cheradame S, Fischel JL, Formento P, Dassonville O, Renee N, et al. Response to fluor-
ouracil therapy in cancer patients: the role of tumoral dihydropyrimidine dehydrogenase activity.
J Clin Oncol 1995;13:1663-1670
89. Etienne MC, Pivot X, Formento JL, Bensadoun RJ, Formento P, Dassonville O, et al. A multifacto-
rial approach including tumoural epidermal growth factor receptor, p53, thymidylate synthase
and dihydropyrimidine dehydrogenase to predict treatment outcome in head and neck cancer
patients receiving 5-fluorouracil. Br J Cancer 1999;79:1864-1869
90. Kawasaki G, Yoshitomi I, Yanamoto S, Mizuno A. Thymidylate synthase and dihydropyrimidine
dehydrogenase expression in oral squamous cell carcinoma: an immunohistochemical and clini-
copathologic study. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2002;94:717-723
91. Nakagawa T, Tanaka F, Takata T, Matsuoka K, Miyahara R, Otake Y, Yanagihara K, Fukushimab M,
Wada H. Predictive value of dihydropyrimidine dehydrogenase expression in tumor tissue,
regarding the efficacy of postoperatively administered UFT (Tegafur + Uracil) in patients with
p-stage I nonsmall-cell lung cancer. J Surg Oncol 2002;81:87-92
92. Huang CL, Yokomise H, Kobayashi S, Fukushima M, Hitomi S, Wada H. Intratumoral expression
of thymidylate synthase and dihydropyrimidine dehydrogenase in non-small cell lung cancer
patients treated with 5-FU based chemotherapy. Int J Oncol 2000;17:47-54
93. Higashiyama M, Kodama K, Yokouchi H, Takami K, Fukushima M, Minamigawa K, et al. Thymidylate
synthase and dihydropyrimidine dehydrogenase activities in non-small cell lung cancer tissues:
relationship with in vitro sensitivity to 5-fluorouracil. Lung Cancer 2001;34:407-416
94. Horiguchi J, Yoshida T, Koibuchi Y, Iijima K, Ninomiya J, Takei H, et al. DPD activity and immunohis-
tochemical DPD expression in human breast cancer. Oncol Rep 2004;11:65-72
95. Mizutani Y, Wada H, Fukushima M, Yoshida O, Ukimura O, Kawauchi A, et al. The significance of di-
hydropyrimidine dehydrogenase (DPD) activity in bladder cancer. Eur J Cancer 2001;37:569-575
96. Uetake H, Ichikawa W, Takechi T, Fukushima M, Nihei Z, Sugihara K. Relationship between intra-
tumoral dihydropyrimidine dehydrogenase activity and gene expression in human colorectal
cancer. Clin Cancer Res 1999;5:2836-2839
97. Ishikawa Y, Kubota T, Otani Y, Watanabe M, Teramoto T, Kumai K, et al. Thymidylate synthetase and
dihydropyrimidine dehydrogenase levels in gastric cancer. Anticancer Res 1999;19(6C):5635-
5640
98. Johnston SJ, Ridge SA, Cassidy J, McLeod HL. Regulation of dihydropyrimidine dehydrogenase in
colorectal cancer. Clin Cancer Res 1999;5:2566-2570
99. Collie-Duguid ES, Johnston SJ, Boyce L, Smith N, Cowieson A, Cassidy J, et al. Thymidine phos-
phorylase and dihydropyrimidine dehydrogenase protein expression in colorectal cancer. Int J
Chapter 2
44
Genetic factors influencing pyrimidine-antagonist chemotherapy
45
Cancer 2001;94:297-301
100. Hiroyasu S, Shiraishi M, Samura H, Tokashiki H, Shimoji H, Isa T, et al. Clinical relevance of the
concentrations of both pyrimidine nucleoside phosphorylase (PyNPase) and dihydropyrimidine
dehydrogenase (DPD) in colorectal cancer. Jpn J Clin Oncol 2001;31:65-68
101. Miyamoto S, Ochiai A, Boku N, Ohtsu A, Tahara M, Yoshida S, et al. Discrepancies between the gene
expression, protein expression, and enzymatic activity of thymidylate synthase and dihydropy-
rimidine dehydrogenase in human gastrointestinal cancers and adjacent normal mucosa. Int J
Oncol 2001;18:705-713
102. Hotta T, Taniguchi K, Kobayashi Y, Johata K, Sahara M, Naka T, et al. Comparative analysis of thymi-
dine phosphorylase and dihydropyrimidine dehydrogenase expression in gastric and colorectal
cancers. Oncol Rep 2004;11:1045-1051
103. Tanaka-Nozaki M, Onda M, Tanaka N, Kato S. Variations in 5-fluorouracil concentrations of color-
ectal tissues as compared with dihydropyrimidine dehydrogenase (DPD) enzyme activities and
DPD messenger RNA levels. Clin Cancer Res 2001;7:2783-2787
104. Fujiwaki R, Hata K, Nakayama K, Fukumoto M, Miyazaki K. Gene expression for dihydropyrimidine
dehydrogenase and thymidine phosphorylase influences outcome in epithelial ovarian cancer. J
Clin Oncol 2000;18:3946-3951
105. Anan K, Mitsuyama S, Tamae K, Suehara N, Nishihara K, Ogawa Y, et al. Increased dihydropyrimi-
dine dehydrogenase activity in breast cancer. J Surg Oncol 2003;82:174-179
106. Ishikawa T, Sekiguchi F, Fukase Y, Sawada N, Ishitsuka H. Positive correlation between the efficacy
of capecitabine and doxifluridine and the ratio of thymidine phosphorylase to dihydropyrimi-
dine dehydrogenase activities in tumors in human cancer xenografts. Cancer Res 1998;58:685-
690
107. Nishimura G, Terada I, Kobayashi T, Ninomiya I, Katigawa H, Fushida S, et al. Thymidine phosphory-
lase and dihydropyrimidine dehydrogenase levels in primary colorectal cancer show a relation-
ship to clinical effects of 5’-deoxy-5-fluorouridine as adjuvant chemotherapy. Oncol Rep 2002;9:
479-482
108. Nishina T, Hyodo I, Moriwaki T, Endo S, Hirasaki S, Doi T, et al. The ratio of thymidine phosphorylase
(TP) to dihydropyrimidine dehydrogenase (DPD) levels in tumour tissues is predictive of re-
sponse to 5’-deoxy-5-fluorouridine (an intermediate metabolite of capecitabine): a prospective
study in patients with metastatic gastric cancer. Proc Am Soc Clin Oncol 2002; abstract 602
109. Tominaga T, Toi M, Ohashi Y, Abe O; on behalf of the 5’-BC study group. Prognostic and predictive
value of thymidine phosphorylase activity in early-stage breast cancer patients. Clin Breast Can-
cer 2002;3:55-64
110. Komatsu T, Yamazaki H, Shimada N, Nakajima M, Yokoi T. Roles of cytochromes P450 1A2, 2A6 and
2C8 in 5-fluorouracil formation from tegafur, an anticancer prodrug, in human liver microsomes.
Drug Metab Dispos 2000;28:1457-1463
111. van Triest B, Pinedo HM, van Hensbergen Y, Smid K, Telleman F, Schoenmakers PS, et al. Thymi-
dylate synthase level as the main predictive parameter for sensitivity to 5-fluorouracil, but not
for folate-based thymidylate synthase inhibitors, in 13 nonselected colon cancer cell lines. Clin
Chapter 2
44
Genetic factors influencing pyrimidine-antagonist chemotherapy
45
Cancer Res 1999;5:643-654
112. Fukushima M, Fujioka A, Uchida J, Nakagawa F, Takechi T. Thymidylate synthase (TS) and ribo-
nucleotide reductase (RNR) may be involved in acquired resistance to 5-fluorouracil (5-FU) in
human cancer xenografts in vivo. Eur J Cancer 2001;37:1681-1687
113. Copur S, Aiba K, Drake JC, Allegra CJ, Chu E. Thymidylate synthase gene amplification in human
colon cancer cell lines resistant to 5-fluorouracil. Biochem Pharmacol 1995;49:1419-1426
114. Matsuoka K, Tsukuda K, Suda M, Kobayashi K, Ota T, Okita A, et al. The transfection of thymidylate
synthase antisense suppresses oncogenic properties of a human colon cancer cell line and aug-
ments the antitumor effect of fluorouracil. Int J Oncol 2004;24:217-222
115. Peters GJ, Van der Wilt CL, Van Groeningen CJ, Smid K, Meijer S, Pinedo HM. Thymidylate synthase
inhibition after adminstration of fluorouracil with or without leucovorin in colon cancer patients:
implications for treatment with fluorouracil. J Clin Oncol 1994;12:2035-2042
116. Leichman CG, Lenz HJ, Leichman L, Danenberg K, Baranda J, Groshen S, et al. Quantitation of intra-
tumoral thymidylate synthase expression predicts for disseminated colorectal cancer response
and resistance to protracted-infusion fluorouracil and weekly leucovorin. J Clin Oncol 1997;15:
3223-3229
117. Lenz HJ, Hayashi K, Salonga D, Danenberg KD, Danenberg PV, Metzger R, et al. P53 point muta-
tions and thymidylate synthase messenger RNA levels in disseminated colorectal cancer: an
analysis of response and survival. Clin Cancer Res 1998;4:1243-1250
118. Cascinu S, Aschele C, Barni S, Debernardis D, Baldo C, Tunesi G, et al. Thymidylate synthase protein
expression in advanced colon cancer: correlation with the site of metastasis and the clinical re-
sponse to leucovorin-modulated bolus 5-fluorouracil. Clin Cancer Res 1999;5:1996-1999
119. Wong NACS, Brett L, Stewart M, Leitch A, Longley DB, Dunlop MG, et al. Nuclear thymidylate syn-
thase expression, p53 expression and 5FU response in colorectal carcinoma. Br J Cancer 2001;85:
1937-1943
120. Aschele C, Debernardis D, Casazza S, Antonelli G, Tunesi G, Baldo C, et al. Immunohistochemical
quantitiation of thymidylate synthase expression in colorectal cancer metastases predicts for
clinical outcome to fluorouracil based chemotherapy. J Clin Oncol 1999;17:1760-1770
121. Paradiso A, Simone G, Petroni S, Leone B, Vallejo C, Lacava J, et al. Thymidylate synthase and p53
primary tumour expression as predictive factors for advanced colorectal cancer patients. Br J
Cancer 2000;82:560-567
122. Aschele C, Debernardis D, Tunesi G, Maley F, Sobrero A. Thymidylate synthase protein expression
in primary colorectal cancer compared with the corresponding distant metastases and relation-
ship with clinical response to 5-fluorouracil. Clin Cancer Res 2000;6:4797-4802
123. Kornmann M, Link KH, Lenz HJ, Pillasch J, Metzger R, Butzer U, et al. Thymidylate synthase is a
predictor for response and resistance in hepatic artery infusion therapy. Cancer Lett 1997;118:
29-35
124. Shirota Y, Stoehlmacher J, Brabender J, Xiong YP, Uetake H, Danenberg KD, et al. EECC1 and thymi-
dylate synthase mRNA levels predict survival for colorectal cancer patients receiving combina-
tion oxaliplatin and fluorouracil chemotherapy. J Clin Oncol 2001;19:4298-4304
Chapter 2
46
Genetic factors influencing pyrimidine-antagonist chemotherapy
47
125. Findley MP, Cunningham D, Morgan G, Clinton S, Hardcastle A, Aherne GW. Lack of correlation
between thymidylate synthase levels in primary colorectal tumours and subsequent response to
chemotherapy. Br J Cancer 1997;75:903-909
126. Aschele C, Debernardis D, Bandelloni R, Cascinu S, Catalano V, Giordani P, et al. Thymidylate
synthase protein expression in colorectal cancer metastases predicts for clinical outcome to
leucovorin-modulated bolus or infusional 5-fluorouracil but not methotrexate-modulated bolus
5-fluorouracil. Ann Oncol 2002;13:1882-1892
127. Noordhuis P, Holwerda U, Van Der Wilt CL, Van Groeningen CJ, Smid K, Meijer S, et al. 5-Fluoro-
uracil incorporation into RNA and DNA in relation to thymidylate synthase inhibition of human
colorectal cancers. Ann Oncol 2004;15:1025-1032
128. Lenz HJ, Leichman CG, Danenberg KD, Danenberg PV, Groshen S, Cohen H, et al. Thymidylate syn-
thase mRNA level in adenocarcinoma of the stomach: a predictor for primary tumour response
and overall survival. J Clin Oncol 1996;14:176-18
129. Metzger R, Leichman CG, Danenberg KD, Danenberg PV, Lenz HJ, Hayashi K, et al. ERCC1 mRNA
levels complement thymidylate synthase mRNA levels in predicting response and survival for
gastric cancer patients receiving combination cisplatin and fluorouracil chemotherapy. J Clin
Oncol 1998;16:309-316
130. Yeh KH, Shun CT, Chen CL, Lin JT, Lee WJ, Lee PH, et al. High expression of thymidylate synthase
is associated with the drug resistance of gastric carcinoma to high dose 5-fluorouracil-based
systemic chemotherapy. Cancer 1998;82:1626-1631
131. Boku N, Chin K, Hosokawa K, Ohtsu A, Tajiri H, Yoshida S, et al. Biological markers as a predictor for
response and prognosis of unresectable gastric cancer patients treated with 5-fluorouracil and
cis-platinum. Clin Cancer Res 1998;4:1469-1474
132. Johnston PG, Mick R, Recant W, Behan KA, Dolan ME, Ratain MJ, et al. Thymidylate synthase ex-
pression and response to neoadjuvant chemotherapy in patients with advanced head and neck
cancer. J Natl Cancer Inst 1997;89:308-13
133. Lizard-Nacol S, Genne P, Coudert B, Riedinger JM, Arnal M, Sancy C, et al. MRD1 and thymidylate
synthase (TS) gene expressions in advanced breast cancer: relationship to drug exposure, p53
mutations, and clinical outcome in the patients. Anticancer Res 1999;19:3575-3582
134. Hu YC, Komorowski RA, Graewin S, Hostetter G, Kallioniemi OP, Pitt HA, et al. Thymidylate synthase
expression predicts the response to 5-fluorouracil-based adjuvant therapy in pancreatic cancer.
Clin Cancer Res 2003;9:4165-4171
135. Peters GJ, Backus HH, Freemantle S, van Triest B, Codacci-Pisanelli G, van der Wilt CL, et al. Induc-
tion of thymidylate synthase as a 5-fluorouracil resistance mechanism. Biochim Biophys Acta
2002;1587:194-205
136. Van Triest B, Pinedo HM, Giaccone G, Peters GJ. Downstream molecular determinants of response
to 5-fluorouracil and antifolate thymidylate synthase inhibitors. Ann Oncol 2000;11:385-391
137. Canman CE, Tang HY, Normolle DP, Lawrence TS, Maybaum J. Variations in patterns of DNA dam-
age induced in human colorectal tumour cells by 5-fluorodeoxyuridine: implications for mecha-
nisms of resistance and cytotoxicity. Proc Natl Acad Sci 1992;89:10474-10478
Chapter 2
46
Genetic factors influencing pyrimidine-antagonist chemotherapy
47
138. Canman CE, Radany EH, Parsels LA, Davis MA, Lawrence TS, Maybaum J. Induction of resistance
to fluorodeoxyuridine cytotoxicity and DNA damage in human tumour cells by expression of
Escherichia coli deoxyuridinetriphophatease. Cancer Res 1994;54:2296-2298
139. Ladner RD, Lynch FJ, Groshen S, Xiong YP, Sherrod A, Caradonna SJ, et al. dUPT nucleotidohydro-
lase isoform expression in normal and neoplasmic tissues: association with survival and response
to 5-fluorouracil in colorectal cancer. Cancer Res 2000;60:3493-3503
140. Schroder JK, Kirch C, Flasshove M, Kalweit H, Seidelmann M, Hilger R, et al. Constitutive over-
expression of the cytidine deaminase gene confers resistance to cytosine arabinoside in vitro.
Leukemia 1996;10:1919-1924
141. Jahns-streubel G, Reuter C, Auf der Landwehr U, Unterhalt M, Schleyer E, Wormann B, et al. Ac-
tivity of thymidine kinase and of polymerase alpha as well as activity and gene expression of
deoxycytidine deaminase in leukemic blasts are correlated with clinical response in the setting
of granulocyte-macrophage colony-stimulating factor-based priming before and during TAD-9
induction therapy in acute myeloid leukemia. Blood 1998;90:1968-1976
142. Schroder JK, Kirch C, Seeber S, Schutte J. Structural and functional analysis of the cytidine deami-
nase gene in patients with acute myeloid leukaemia. Br J Haematol 1998;103:1096-1103
143. Owens JK, Shewach DS, Ullman B, Mitchell BS. Resistance to 1-beta-D-arabinofuranosylcytosine
in human T-lymphoblasts mediated by mutations within the deoxycytidine kinase gene. Cancer
Res 1992;52:2389-2393
144. Kobayashi T, Kakihara T, Uchiyama M, Fukuda T, Kishi K, Shibata A. Low expression of the deoxycy-
tidine kinase (dCK) gene in a 1-beta-D-arabinofuranosylcytosine-resistant human leukemic cell
line KY-Ra. Leuk Lymphoma 1994;15:503-505
145. Colly LP, Peters WG, Richel D, Arentsen-Honders MW, Starrenburg CW, Willemze R. Deoxycytidine
kinase and deoxycytidine deaminase values correspond closely to clinical response to cytosine
arabinoside remission induction therapy in patients with acute myelogenous leukemia. Semin
Oncol 1987;14:257-261
146. Flasshove M, Strumberg D, Ayscue L, Mitchell BS, Tirier C, Heit W, et al. Structural analysis of the
deoxycytidine kinase gene in patients with acute myeloid leukemia and resistance to cytosine
arabinoside. Leukemia 1994;8:780-785
147. Van den Heuvel-Eibrink MM, Wiemer EAC, Kuijpers M, Pieters R, Sonneveld P. Absence of muta-
tions in the deoxycytidine kinase (dCK) gene in patients with relapsed and/or refractory acute
myeloid leukemia (AML). Leukemia 2001;15:855-867
148. Veuger MJ, Honders MW, Landegent JE, Willemze R, Barge RM. High incidence of alternatively
spliced forms of deoxycytidine kinase in patients with resistant acute myeloid leukemia. Blood
2000;96:1517-1524
149. Veuger MJT, Heemskerk MHM, Honders W, Willemze R, Berge RMY. Functional role of alternatively
spliced deoxycytidine kinase in sensitivity to cytarabine of acute myeloid leukemic cells. Blood
2002;99:1373-1380
150. Galmarini CM, Graham K, Thomas X, Calvo F, Rousselot P, El Jafaari A, et al. Expression of high Km
5’-nucleotidase in leukemic blasts is an independent prognostic factor in adults with acute my-
Chapter 2
48
Genetic factors influencing pyrimidine-antagonist chemotherapy
49
eloid leukemia. Blood 2001;98:1922-1926
151. Dumontet C, Fabianowska-Majewska K, Mantincic D, Callet Bauchu E, Tigaud I, Gandhi V, et al.
Common resistance mechanisms to deoxynucleoside analogues in variants of the human eryth-
roleukaemic line K562. Br J Haematol 1999;106:78-85
152. Davidson JD, Ma L, Iverson PW, Lesoon A, Jin S, Horwitz L, et al. Human multidrug resistance pro-
tein 5 (MRP5) confers resistance to gemcitabine. Proc AACR 2002; abstract 3868
153. Mirjolet JF, Barberi-Heyob M, Didelot C, Peyrat JP, Abecassis J, Millon R, et al. Bcl-2/Bax protein ratio
predicts 5-fluorouracil sensitivity independently of p53 status. Br J Cancer 2000;83:1380-1386
154. Yang QF, Sakurai T, Yoshimura G, Shan L, Suzuma T, Tamaki T, et al. Expression of Bcl-2 but not
Bax or p53 correlates with in vitro resistance to a series of anticancer drugs in breast carcinoma.
Breast Cancer Res Treat 2000;61:211-216
155. Keith FJ, Bradbury DA, Zhu YM, Russell NH. Inhibition of bcl-2 with antisense oligonucleotides in-
duces apoptosis and increases the sensitivity of AML blasts to Ara-C. Leukemia 1995;9:131-138
156. Ahmed N, Sammons J, Hassan HT. Bcl-2 protein in human myeloid leukaemia cells and its down-
regulation during chemotherapy-induced apoptosis. Oncol Rep 1999;6:403-407
157. Balkham SE, Sargent JM, Elgie AW, Williamson CJ, Taylor CG. Comparison of BCL-2 and BAX protein
expression with in vitro sensitivity to ARA-C and 6TG in AML. Adv Exp Med Biol 1999;457:335-
340
158. Bold RJ, Chandra J, McConkey DJ. Gemcitabine-induced programmed cell death (apoptosis) of
human pancreatic carcinoma is determined by Bcl-2 content. Ann Surg Oncol 1999;6:279-285
159. Van Slooten HJ, Clahsen PC, van Dierendonck JH, Duval C, Pallud C, Mandard AM, et al. Expression
of Bcl-2 in node-negative breast cancer is associated with various prognostic factors, but does
not predict response to one course of perioperative chemotherapy. Br J Cancer 1996;74:78-85
160. Schneider HJ, Sampson SA, Cunningham D, Norman AR, Andreyev HJ, Tilsed JV, et al. Bcl-2 expres-
sion and response to chemotherapy in colorectal adenocarcinomas. Br J Cancer 1997;75:427-
431
161. Nabeya Y, Loganzo F Jr, Maslak P, Lai L, de Oliveira AR, Schwartz GK, et al. The mutational status of
p53 protein in gastric and esophageal adenocarcinoma cell lines predicts sensitivity to chemo-
therapeutic agents. Int J Cancer 1995;64:37-46
162. Zheng M, Wang H, Zhang H, Ou Q, Shen B, Li N, et al. The influence of the p53 gene on the in vitro
chemosensitivity of colorectal cancer cells. J Cancer Res Clin Oncol 1999;125:357-360
163. Petak I, Tillman DM, Houghton JA. P53 dependence of Fas induction and acute apoptosis in re-
sponse to 5-fluorouracil-leucovorin in human colon carcinoma cell lines. Clin Cancer Res 2000;6:
4432-4441
164. Benhattar J, Cerottini JP, Saraga E, Metthez G, Givel JC. P53 mutations as a possible predictor of
response to chemotherapy in metastatic colorectal carcinomas. Int J Cancer 1996;69:190-192
165. Ahnen DJ, Feigl P, Quan G, Fenoglio-Preiser C, Lovato LC, Bunn PA, et al. Ki-ras mutation and p53
overexpression predict the clinical behavior of colorectal cancer: a Southwest Oncology Group
Study. Cancer Res 1998;58:1149-1158
166. Backus HHJ, Van Riel JMGH, Van Groeningen CJ, Vos W, Dukers DF, Bloemena E, et al. Rb, mcl-1 and
Chapter 2
48
Genetic factors influencing pyrimidine-antagonist chemotherapy
49
p53 expression correlate with clinical outcome in patients with liver metastases from colorectal
cancer. Ann Oncol 2001;12:779-785
167. Liang JT, Huang KC, Cheng YM, Hsu HC, Cheng AL, Hsu CH, et al. P53 overexpression predicts poor
chemosensitivity to high-dose 5-fluorouracil plus leucovorin chemotherapy for stage IV colorec-
tal cancers after palliative bowel resection. Int J Cancer 2002;97:451-457
168. Cabelguenne A, Blons H, de Waziers I, Carnot F, Houllier AM, Soussi T, et al. P53 alterations predict
tumour response to neoadjuvant chemotherapy in head and neck squamous cell carcinoma: a
prospective series. J Clin Oncol 2000;18:1465-73
169. Temam S, Flahault A, Perie S, Monceaux G, Coulet F, Callard P, et al. P53 gene status as a predictor
of tumour response to induction chemotherapy of patients with locoregionally advanced squa-
mous cell carcinomas of the head and neck. J Clin Oncol 2000;18:385-394
170. Kandioler-Eckersberger D, Ludwig C, Rudas M, Kappel S, Janschek E, Wenzel C, et al. TP53 mutation
and p53 overexpression for prediction of response to neoadjuvant treatment in breast cancer
patients. Clin Cancer Res 2000;6:50-56
171. Elsaleh H, Powell B, Soontrapornchai P, Joseph D, Goria F, Spry N, et al. P53 gene mutation, micro-
satellite instability and adjuvant chemotherapy: impact on survival of 388 patients with Dukes C
carcinoma. Oncology 2000;58:52-59
172. Rosty C, Chazal M, Etienne MC, Letoublon C, Bourgeon A, Delpero JR, et al. Determination of
microsatellite instability, p53 and K-RAS mutations in hepatic metastases from patients with
colorectal cancer: relationship with response to 5-fluorouracil and survival. Int J Cancer 2001;95:
162-167
173. Arango D, Corner GA, Wadler S, Catalano PJ. Augenlicht LH. C-myc/p53 interaction determines
sensitivity of human colon carcinoma cells to 5-fluorouracil in vitro and in vivo. Cancer Res
2001;61:4910-4915
174. Lenz HJ, Danenberg KD, Leichman CG, Florentine B, Johnston PG, Groshen S, et al. P53 and thymi-
dylate synthase expression in untreated stage II colon cancer: association with recurrence, sur-
vival and site. Clin Cancer Res 1998;4:1227-1234
175. Peters GJ, Van Triest B, Backus HHJ, Kuiper CM, Van der Wilt CL, Pinedo HM. Molecular downstream
events and induction of thymidylate synthase in mutant and wild-type p53 colon cancer cell
lines after treatment with 5-fluorouracil and the thymidylate synthase inhibitor raltitrexed. Eur J
Cancer 2000;36:916-924
176. McKay RA, Lloret C, Murray GI, Johnston PG, Bicknell R, Ahmed FY, et al. Application of the enrich-
ment approach to identify putative markers of reponse to 5-fluorouracil therapy in advanced
colorectal carcinomas. Int J Oncol 2000;17:153-158
177. Ichikawa W, Uetake H, Shirota Y, Yamada H, Nishi N, Nihei Z, et al. Combination of dihydropyrimi-
dine dehydrogenase and thymidylate synthase gene expressions in primary tumors as predic-
tive parameters for the efficacy of fluoropyrimidine-based chemotherapy for metastatic colorec-
tal cancer. Clin Cancer Res 2003;9:786-791
178. Ichikawa W, Takahashi T, Suto K, Hirayama R. Gene expressions for thymidylate synthase (TS),
orotate phosphoribosyl transferase (OPRT), and thymidine phosphorylase (TP), not dihydropyri-
Chapter 2
50
dimine dehydrogenase (DPD), influence outcome of patients treated with S-1 for gastric cancer.
Proc Am Soc Clin Oncol 2004; abstract 4050
179. Smorenburg CH, Peters GJ, Van Groeningen CJ, Noordhuis P, Van Riel JM, Pinedo HM, et al. First
line tailored chemotherapy in advanced colorectal cancer with 5-fluorouracil/leucovorin or
oxaliplatin/irinotecan chosen by the expression of thymidylate synthase (TS) and dihydropyrim-
inde dehydrogenase (DPD). Proc Am Soc Clin Oncol 2004; abstract 3624
180. Leichman CG, Lyman GH, Remedios P, Leichman L, Litwin A, Loud P, et al. Molecular biologic corre-
lates with continuous infusion 5-FU (CIFU) or capecitabine (C) in disseminated colorectal cancer
(CRC). Proc Am Soc Clin Oncol 2002; abstract 1720
181. Johnston PG, Liang CM, Henry S, Chabner BA, Allegra CJ. Production and characterization of
monoclonal antibodies that localize human thymidylate synthase in the cytoplasm of human
cells and tissue. Cancer Res 1991;51:6668-6676
182. website: http://www.pharmacogenetics.org
Focus on fluorouracil
A simple and sensitive fully validated HPLC-UV method for the determination of 5-fluorouracil and its metabolite 5,6-dihydrofluorouracil in plasma
Jan Gerard Maring1, Leonie Schouten2, Ben Greijdanus3, Elisabeth G.E. de Vries4, Donald
R.A. Uges3
1Department of Pharmacy, Diaconessen Hospital Meppel and Bethesda Hospital
Hoogeveen; 2University Centre for Pharmacy, Groningen; Departments of 3Pharmacy and 4Medical Oncology, University Hospital Groningen, The Netherlands
Therapeutic Drug Monitoring, in press
Chapter 3
54
HPLC-UV analysis of 5-fluorouracil
55
Column of light. Nørre Lyngvig. Danmark 2002.
Chapter 3
54
HPLC-UV analysis of 5-fluorouracil
55
Abstract
Aim The authors developed a simple and sensitive, fully validated HPLC-UV method for
the determination of both 5-FU and its metabolite DHFU in small volume plasma samples.
Methods The analytes were separated on a 4.6 X 250 mm I.D. Atlantis dC18 5 µm column,
with isocratic elution at room temperature. Chlorouracil was used as internal standard. The
analytes were detected with an UV diode array detector. DHFU was detected at 205 nm,
5-FU at 266 nm and chlorouracil at both wavelengths.
Results The limits of quantification in plasma were 0.040 µg /mL for 5-FU and 0.075 µg/
mL for DHFU. Linearity, accuracy, precision, recovery, dilution, freeze-thaw stability and
stability in the sample compartment were evaluated. The method appeared linear over a
range from 0.04-15.90 µg/mL for 5-FU, and from 0.075-3.84 µg/mL for DHFU.
Conclusions The method appeared very suitable for therapeutic drug monitoring and
pharmacokinetic studies of 5-FU, due to the simple extraction and the small sample
volume. Problems in earlier published methods with interfering peaks and variable
retention times were overcome. The method appeared also suitable for detection of uracil
and its metabolite dihydrouracil in plasma.
Introduction
5-Fluorouracil (5-FU) is a fluoropyrimidine anti-cancer agent that was introduced more
than 40 years ago [1]. It belongs to the class of antimetabolites and is still widely used in
the treatment of gastrointestinal-, breast- and head and neck cancer [2]. Before 5-FU can
exert its cytotoxic effects, intracellular metabolic activation is a prerequisite. The principal
cytotoxic metabolite of 5-FU is 5-fluoro-2’-deoxyuridine monophosphate (FdUMP), which
inhibits thymidylate synthase. This results in inhibition of DNA-synthesis due to depletion
of thymidine nucleotides [1,3]. The cytotoxicity, though, is caused by only a small part of
the 5-FU dose, since the majority of 5-FU is rapidly metabolized into inactive metabolites.
The initial and rate-limiting step in the catabolism of 5-FU is the reduction of 5-FU into
5,6-dihydrofluorouracil (DHFU) by the enzyme dihydropyrimidine dehydrogenase (DPD)
[1,3]. As a result, the pharmacokinetic profile of 5-FU displays rapid distribution and rapid
elimination [3,4]. Reported half-lifes range from 6 to 22 min [1,3,4-7]. This large variation
in 5-FU clearance is thought to be due to interindividual differences in DPD activity. Un-
fortunately, DPD activity is largely reduced in 1-2% of the Caucasian population due to a
mutation in the gene encoding DPD [8-11]. When these people are treated with 5-FU, they
risk extreme toxicity due to a largely reduced 5-FU clearance. Since 5-FU based chemo-
therapy is one of the cornerstones of colorectal cancer treatment, combined with the fact
that relatively high 5-FU dosages are applied in this cancer, extreme 5-FU toxicity due to
DPD deficiency most frequently is encountered in colorectal cancer patients.
Chapter 3
56
HPLC-UV analysis of 5-fluorouracil
57
Today, DPD deficiency is recognized as a serious contraindication for 5-FU treatment, and
as a result, several methods so far have been evaluated for early detection of DPD deficien-
cy. DPD activity measured in peripheral blood mononuclear cells (PBMC-DPD) has been
proposed as screening tool to detect DPD deficiency, but the correlation between PBMC-
DPD activity and 5-FU clearance seems to be rather weak [10,12,13]. Alternatively, moni-
toring of the 5-FU/DHFU ratio in plasma might be a reliable predictor for 5-FU clearance,
although this requires the administration of at least one 5-FU dose and the availability
of a rapid screening method for 5-FU plasma levels to guarantee reporting on aberrant
pharmacokinetics before the second gift is administered [13-16].
Several methods for 5-FU and DHFU detection in plasma have been published [4,7,17-
21]. To date various HPLC methods with UV detection have been developed, but most of
these methods lack adequate sensitivity for pharmacokinetic studies or therapeutic drug
monitoring, since 5-FU plasma levels during 5-FU protracted infusion or after administra-
tion of oral 5-FU analogues are generally low [19,21]. Difficulties in the determination
of 5-FU and DHFU in plasma with HPLC-UV are mainly due to the hydrophilicity of the
analytes, causing variable retention on C18-columns, and due to the limited UV-absorp-
tion of DHFU. The HPLC method most suitable for drug level monitoring, published up to
now is, the method of Ackland et al., because of its low limits of quantification (LLQ) [17].
It requires, however, a relatively large sample volume and the method has some analytical
interference. Therefore we developed an analytical method for the simultaneous determi-
nation of 5-FU and DHFU in small volume plasma samples, with sufficiently low limits of
quantification for both substances.
Materials and methods
Chemicals
5-Fluoro 5,6-dihydrouracil (95%) was provided by Roche (Basel, Switzerland).
5-Fluorouracil and the internal standard 5-chlorouracil were obtained from Sigma
(Zwijndrecht, The Netherlands). Methanol (HPLC grade), ethylacetate and acetonitrile
(HPLC grade) were purchased from Merck (Darmstadt, Germany). Ultra pure water was
used in all preparations (Milli-Q water purification system, Millipore Benelux; Etten-Leur,
The Netherlands). All other chemicals were of analytical grade. Human EDTA-plasma for
standard and control samples was provided by the Red Cross Bloodbank (Groningen, The
Netherlands).
Chromatographic equipment
Analysis of 5-FU and DHFU was performed on a HPLC-system consisting of a Merck Hitachi
L-7110 isocratic pump (Merck, Darmstadt, Germany), a Merck Hitachi L-7200 autosampler
and a Merck Hitachi L-7450 UV PDA detector. Integration was performed by Merck Hitachi
Chapter 3
56
HPLC-UV analysis of 5-fluorouracil
57
Model D7000 HPLC System Manager version 3.1.1 (1994-1999). The system and column
operated at room temperature (19-22 oC). The separations were performed on a Atlantis
dC18 (4,6 x 250 mm I.D.) 5 µm column (Waters, Etten-Luer, The Netherlands), equipped
with a Phenomenex C18 (5 µm, 4,0 x 3.0 mm) SecurityGuard guard column (Bester, Am-
stelveen, The Netherlands). The mobile phase consisted of 990 mL 1.5 mM phosphate
buffer (pH 5.8) mixed with 10 mL methanol. The flow during the analysis was 0.8 mL/min.
Spectra were acquired in the 200-300 nm range up to 23 min after injection. The time
between the injections was 22 min, to allow the elution of strongly retained endogenous
compounds. The injection volume was 50 µL.
Preparation of the plasma standards and controls
For each compound, except chlorouracil (internal standard), two independent stock
solutions were prepared in water. One was used for the preparation of the calibration
samples, the second for the preparation of the validation samples.
The 5-FU stock solution contained 100 µg/mL, the DHFU stock solution 25 µg/mL. The
concentration of the chlorouracil internal standard stock solution was 200 µg/mL. An
internal standard working solution (2 µg/mL) was freshly prepared on the day of analysis
by diluting the stock solution 100 times with water. Calibration samples were prepared by
adding the required amount of stock solution to human plasma to obtain concentrations
of 0.04; 0.08; 0.20; 0.32; 0.40; 0.80; 1.60; 4.80 and 15.90 µg/mL 5-FU, and concentrations of
0.08; 0.10; 0.20; 0.40; 0.80; 1.00; 1.20; 2.00 and 3.84 µg/mL DHFU. Calibration samples of 5-
FU and DHFU were combined.
Validation samples were prepared at low, medium and high concentration levels and
contained at low level 0.092 µg/mL 5-FU plus 0.132 µg/mL DHFU, at medium level 0.80
µg/mL 5-FU plus 0.48 µg/mL DHFU, and at high level 4.00 µg/mL 5-FU plus 0.96 µg/mL
DHFU. All standards, controls and stock solutions were stored at –20 oC until use.
Sample preparation
An aliquot of 200 µl plasma sample was mixed with 50 µl internal standard working
solution in an Eppendorf microfuge tube. Subsequently, 150 µl acetonitril was added,
followed by vortex mixing for 10 s. The samples were centrifuged at 11,000 g for 5 min at
room temperature. The supernatant was transferred into a glass centrifuge tube and 7 mL
of ethylacetate was added. The samples were extracted during 15 min in a rotary mixer.
Subsequently, the samples were centrifuged at 3,000 g for 5 min. The organic upper layer
was transferred into a conical tube and evaporated to dryness under a gentle stream of
nitrogen at ambient temperature. The samples were reconstituted in 100 µL mobile phase
and transferred into a glass insert for auto-sampler vials. A 50 µL aliquot was injected into
the HPLC.
Chapter 3
58
HPLC-UV analysis of 5-fluorouracil
59
5-FU pharmacokinetics
A plasma sample was obtained from a colorectal cancer patient who was evaluated for
DPD deficiency. The patient had experienced more than expected toxicity during the first
cycle of a 5-day 5-FU/LV Mayo Clinics schedule. The clearance of 5-FU was evaluated on
the first day of the second cycle. A single blood sample was collected at t=60 min after a
5 min intravenous infusion of 380 mg/m2 5-FU (80% from normal 425 mg/m2 dose). The
samples were placed on ice immediately after collection. Analysis of the plasma sample
was performed on the same day.
Validation procedure
The method was validated on linearity, accuracy, recovery, freeze-thaw stability, sample
compartment stability and sample dilution. On day one, the linearity of the calibration
curves and the stability in the sample compartment were determined. On the days two
to six, precision and accuracy, recovery, freeze/thaw stability and dilution of samples were
tested. During validation, six blank samples obtained from six different human volunteers
were tested to demonstrate that there were no interfering components. The results of the
tests were evaluated against international used acceptance criteria described by Shah et
al [22].
Linearity, Accuracy, and Recovery
To evaluate linearity of the calibration curves three calibration curves were prepared and
analyzed. The curves were judged linear if the correlation coefficient r was better than 0.99
as calculated by weighted linear regression. The goodness of fit and the lack of fit were
determined by ANOVA calculations.
To assess the accuracy and precision of the method, the samples LLQ, low, medium and
high were analyzed three times a day, during five days.
To determine the accuracy, the average bias was calculated. The Relative Standard
Deviation (RSD%) was estimated by ANOVA, and used to determine the within-run and
between-run precision. Relative standard deviations and biases of less then 15% were
accepted, except for the LLQ. For the LLQ relative standard deviations and biases of less
than 20% were accepted.
Accuracy was calculated from the mean of the amount observed and the theoretical con-
centrations at a particular level. The method was considered accurate when the deviation
from the theoretical concentration (bias) was less than 20 % at the LLQ level and less than
15 % at the remaining levels [22].
The recoveries were determined by comparing the peak heights of the validation samples
low, medium and high with the peak heights of analyzed solutions containing all the
compounds of interest at a concentration corresponding with 100 % recovery.
Chapter 3
58
HPLC-UV analysis of 5-fluorouracil
59
Freezing and Thawing
To assess freezing and thawing stability samples with a low concentration and samples
with a high concentration were prepared. The same sample was frozen and thawed each
day for five days. After each freeze/thaw cycle the samples were analyzed in triplicate. Bias
was calculated in the same way as with precision and accuracy. Samples were considered
stable if bias was below 10 % after five freeze/thaw cycles.
Dilution
Because some samples of clinical patients can have concentrations above the higher
limit of quantification (HLQ), these samples have to be diluted to obtain concentrations
within the calibration range. The effect of sample dilution was tested with plasma control
samples spiked with 20.00 µg/mL 5-FU plus 4.80 µg/mL DHFU. These samples were diluted
5 times in triplicate on 5 different days. Blank human plasma was used as diluting agent.
A bias of less then 10% between the measured undiluted concentration and nominal
undiluted concentration was accepted.
Stability during storage in sample compartment
Stability during storage in sample compartment was determined by analyzing samples
with low and high concentration over a period of 30 h. The calculated response at t = 30
h was compared to the calculated response at t = 0 h. Samples were judged stable over a
period of 30 h if the decrease in response was less than 10 %.
Results
Retention times
The retention time of DHFU was approximately 8.2 min. 5-FU and chlorouracil eluted at
approximately 10.1 and 19.9 min respectively. Interfering peaks were found in none of six
different blank plasma samples, except for a small peak at approximately 19.8 min, close
to the peak of the internal standard. Since this small matrix peak turned out to be always
at least 30 times smaller than the internal standard peak, it was considered negligible.
One other matrix peak could potentially interfere with the DHFU peak (see figure 1 in
lower chromatogram at approximately 7.3 min), but this problem was easily overcome
as only the retention time of this interfering substance and not that of DHFU appeared
dependent on the pH of the mobile phase. The pH can at least vary from 5.7 through 6.3,
without affecting the retention times of the peaks of interest. Interference from strongly
retained matrix components in subsequent chromatograms was prevented by introduc-
tion of a 22 min delay after each injection. We recommend to flush the column with 50%
methanol in water for 30 minutes every 3 series of samples, as the column may retain
matrix components.
Chapter 3
60
HPLC-UV analysis of 5-fluorouracil
61
���� �����
����
����
����
����
����
��� ��� ��� ��� ��� ���� ���� ����
����
���� ���� ���� ���� ����
����
����
����
������� ��
��� ����
����
����
���
����
���
����
����
��
���
����
���
����
�
����
�
����
�
����
����
��
����
�
Figure 1 Representative chromatograms of patient plasma sample at t=60 min after the start of a 5 min infusion of 380 mg/m2 5-FU. The upper chromatogram was recorded at 266 nm, the lower at 205 nm. The retention time of DHFU was 8.11 min, the retention time of 5-FU 10.21 min and chlorouracil (internal standard) eluted at 20.17 min.
Chapter 3
60
HPLC-UV analysis of 5-fluorouracil
61
Linearity, Accuracy and Recovery
The correlation coefficient of the calibration curves was always better than 0.99 for both
components . All curves showed no significant lack of fit and for all calibration curves
the Goodness of Fit was significant. Table 1 lists the with-in and between-run relative
standard deviations and the biases of 5-FU and DHFU. All results were within validation
limits. The mean recoveries of 5-FU at low, medium and high concentrations were 75.3%,
77.6% and 81.1% respectively (n=15). For DHFU the values were 65.5%, 68.3% and 70.5%.
For chlorouracil a recovery of 74.2% was found.
Dilution
Bias was below 10% for both 5-FU and DHFU. Detailed results are listed in table 2.
Table 1 Accuracy and within-run and between-run precision of 5-FU and DHFU in plasma in different concentrations (n=15).
Nominal concen-
tration (µg/mL)
Measured concen-
tration (µg/mL)
Mean bias (%) Within-run
RSD (%)
Between-run
RSD (%)
5-FU 0.040 0.043 +6.3 3.7 3.5
0.092 0.099 +7.9 2.9 4.3
0.802 0.831 +3.7 2.7 7.7
4.090 4.260 +4.2 0.8 1.0
DHFU 0.075 0.087 +15.6 3.2 2.4
0.132 0.134 +1.5 2.2 2.5
0.480 0.478 –0.3 3.4 6.7
0.959 0.967 +0.8 1.2 2.5
Table 2 Biases for the dilution test
Analyte Nominal undiluted
concentration
(µg/mL)
Measured concen-
tration (µg/mL)
Bias
(%)
Within-run
RSD (%)
Between-run
RSD (%)
n
5-FU 20.00 20.80 +4 2.3 4.4 15
DHFU 4.80 4.63 –4 3.6 4.4 15
Chapter 3
62
HPLC-UV analysis of 5-fluorouracil
63
Freeze-thaw stability
Figure 2 depicts the results of the freeze-thaw stability test. The biases for 5-FU were less
than 10% during all cycles at both concentration levels. For DHFU, at the 0.142 µg/mL con-
centration level, the bias exceeded 10% after four freeze-thaw cycles. At the 0.921 µg/mL
level, bias overstepped 10 % after three freeze-thaw cycles. This implicates that DHFU is
only stable for two freeze-thaw cycles.
Stability in the sample compartment.
For 5-FU, in low concentration (0.092 µg/mL), the peak height ratio is stable during 20
hours, but at 30 hours this ratio dropped 31.2%. At 8.19 µg/mL 5-FU the peak height ratio
increased linearly 2.3% during 30 hours. For DHFU a linear decrease in peak height ratio
was observed at both concentration levels. After 30 hours, the decrease was 11.6% at the
0.132 µg/mL level, and 2.7% at 1.92 µg /mL.
Human plasma samples
Figure 1 depicts the chromatograms of a plasma sample at t = 60 min after an intravenous
dose of 380 mg/m2 5-FU. The calculated amounts were 0.45 µg/mL for 5-FU and 3.43 µg/
mL for DHFU. These values are within the normal range. The patient was not considered
DPD deficient.
Figure 2 Freeze-thaw characteristics of 5-FU and DHFU during 5 cycles. The 5-FU concentrations at the start of the experiment at low (0.097 µg/mL) and high (4.07 µg/mL) concentration levels were not affected after 5 freeze-thaw cycles. However, the DHFU concentrations at both low (0.142 µg/mL) and high (0.921 µg/mL) concentration levels were largely decreased by freeze-thawing.
���
���
���
���
�
��
� � � � �
����� ������
���
��
���� ���
���� ����
���� ���
���� ����
Chapter 3
62
HPLC-UV analysis of 5-fluorouracil
63
Discussion
In this paper, we present a fully validated, relatively simple method for sensitive detection
of 5-FU and its metabolite DHFU in small volume plasma samples.
The assay procedure was based on a method previously described by Ackland et al. for
extraction of 5-FU and DHFU from 1 mL plasma samples [17]. We wished to improve this
method with regard to extraction procedure and sample size. We discovered that the pH
of the aqueous layer can vary freely between 2 and 8 without affecting the extraction ef-
ficiency. Therefore pH stabilization with an extraction buffer was considered unnecessary.
We managed to simplify the extraction procedure by using acetonitril in stead of trichlo-
roacetic acid 50% for protein denaturation. That disposed of the need for a neutralization
step and, as a result, kept the volume of aqueous phase relatively small, around 350 µL.
In the Ackland method, the aqueous phase comprises about 2 mL after acid neutraliza-
tion with sodium acetate. Because of this relatively large volume of aqueous layer, they
needed to perform a double extraction procedure with twice 5 ml ethylacetate to obtain
recoveries above 70%. The 7 mL ethylacetate used in our procedure is 20-fold in excess
of aqueous material and this resulted in recoveries above 75% in a single extraction step.
Evidently, the ratio of the volumes of aqueous and ethylacetate layers during extraction
appears to be a determinant factor with large impact on the recovery. This is confirmed
by data of Loos et.al. who applied an ethylacetate : aqueous layer ratio above 25 in their
assay for 5-FU and thus gained recoveries of about 90% [23]. They could, however, omit
a deproteinization step, as the dihydrofluorouracil metabolite was not included in their
assay. Due to a deproteinization step, our aqueous layer is somewhat larger. We decided
not to increase the amount of ethylacetate above 7 mL, in order to maintain the extraction
as single-step procedure. Our validation results show that a recovery of about 70% is large
enough to obtain accurate and precise results.
5-FU turned out to be stable for at least five freeze-thaw cycles. DHFU however appeared
stable for only 2 freeze-thaw cycles. Previous reports confirm the observed instability of
DHFU in plasma at room temperature [24]. Therefore, it has been recommended to place
blood samples on ice and to centrifuge blood shortly after collection. If reanalysis of a
plasma sample is needed, it has been proposed to use only once-thawed samples. The
observed freeze-thaw instability has also implications for the conditions during transport:
it is important to transport plasma samples on dry ice, to prevent thawing.
The instability of DHFU also has consequences for the storage of samples in the autosam-
pler compartment. At low concentrations 5-FU and DHFU appeared stable for no longer
than 20 hours at ambient temperature. This implicates that sample runs may not last
longer than 20 hours. Moreover, samples expected to have a low concentration of 5-FU or
DHFU should be placed more forwards in the autosampler compartment. Cooling of the
autosampler compartment is recommended if available on the equipment. The cause of
the non-linear decrease of the 5-FU concentration that we observed during storage in the
Chapter 3
64
HPLC-UV analysis of 5-fluorouracil
65
autosampler is unknown. It could be the result of auto-inducible deterioration or adsorp-
tion to the wall of the vials, but we couldn’t prove these hypotheses.
Our method so far has been applied to clinical research samples and therapeutic drug
monitoring of 5-FU in colorectal cancer patients. A very common colorectal cancer
treatment implies the administration of a bolus dose of 425 mg/m2 5-FU plus 20 mg/m2
folinic acid on 5 consecutive days (total 5-FU dose 2125 mg/m2) in a 28 day cycle (Mayo
Clinic schedule). A large proportion of all colorectal cancer patients is treated this way, at
least in most Anglo-Saxon countries . From previous work we learned that the 5-FU plasma
concentration 5 min after a 5-FU bolus dose of 425 mg/m2 can range from 30 to 60 µg/mL
[25]. With linearity demonstrated up to 15.9 µg/mL and five times dilution possible these
concentrations are covered with the current method. The peak plasma concentration of
DHFU after the same dose of 5-FU normally ranges from 2-6 µg/mL [25]. This concentra-
tion range is also covered by our method with linearity of DHFU demonstrated up to
3.84 µg/mL. The low LLQ values (0.04 µg/mL for 5-FU and 0.075 µg/mL for DHFU) make
it even possible to measure plasma levels during 9-10 half-lifes after 5-FU administration.
As the plasma half-life of 5-FU is about 10 min, blood levels can be monitored until 90-
100 min after administration of a typical 5-FU dose of 425 mg/m2, which is convenient for
most research purposes. Moreover, the current method also appeared very suitable for
therapeutic drug monitoring of 5-FU. In an earlier study in 33 clinical patients, we showed
that the 5-FU plasma levels at t=1 h after an intravenous bolus dose of 425 mg/m2 5-FU
ranges from 0.1 – 2.5 µg/mL (mean value 0.6 µg/ml) [25]. The upper level of 2.5 µg /ml
corresponds with the mean + 3SD value. Thus, in 99% of all individuals with normal DPD
activity, 5-FU levels below this value can be expected. Based on these calculations we
consider levels above 2.5 µg/mL at t=1 h after a standard 425 mg/m2 5-FU bolus dose as
atypical and suspect DPD deficiency in such patients. Previously we have shown that in a
patient with heterozygosity for a IVS14+1G→A splice site mutation in the DPD encoding
gene, the 5-FU level at t=1 h was 10.0 µg/mL, which is indeed higher than our proposed
cut-off level of 2.5 µg/mL [11]. This particular patient suffered from extreme toxicity after
a normal 5-FU treatment.
We acknowledge that the major drawback of our approach is the fact that it implies a ret-
rospective evaluation of DPD activity status. Unfortunately, good alternatives are lacking
at this moment.
Mattison et al. developed a simple, however expensive, uracil breath test for DPD pheno-
typing, based on the release of 13CO2 from 2-13C uracil in the presence of intact DPD [26].
Expired air was collected 5-90 min after oral ingestion of 6 mg/kg 2-13C uracil. Partially
deficient DPD breath profiles were well differentiated from normal profiles. An oral
challenge with uracil, prior to chemotherapy, with subsequent measurement of the uracil
clearance in plasma, might be an alternative approach for DPD phenotyping. Therefore,
we are currently testing the applicability of our method for uracil detection. More research
Chapter 3
64
HPLC-UV analysis of 5-fluorouracil
65
is needed to explore, optimize and validate this approach.
The current method has further proven its suitability and stability in a phase II pharma-
cokinetic study of a new investigational cytotoxic agent tested in combination with 5-FU
and folinic acid.
Chapter 3
66
HPLC-UV analysis of 5-fluorouracil
67
References
1. Grem JL. 5-Fluorouracil: forty-plus and still ticking. A review of its preclinical and clinical develop-
ment. Invest New Drugs 2000;18:299-313.
2. Lokich J. Infusional 5-FU: Historical evolution, rationale, end clinical experience. Oncology
1998;12:19-22.
3. Pinedo HM, Peters GFJ. Fluorouracil: Biochemistry and Pharmacology. J Clin Oncol 1988;6:1653-
1664.
4. Heggie GD, Sommadossi JP, Cross DS, et al. Clinical pharmacokinetics of 5-fluorouracil and its
main metabolites in plasma, urine and bile. Cancer Res 1987;47:2203-2206.
5. Young AM, Daryanani S, Kerr DJ. Can pharmacokinetic monitoring improve clinical use of fluoro-
uracil. Clin Pharmacokinet 1999;36:391-398.
6. Lennard L. Therapeutic drug monitoring of antimetabolic cytotoxic drugs. Br J Clin Pharmacol
1999;47:131-143.
7. Bocci G, Danesi R, Di Paolo A, et al. Comparative pharmacokinetic analysis of 5-Fluorouracil and its
major metabolite 5-fluoro-5,6-dihydrouracil after conventional and reduced test dose in cancer
patients. Clin Cancer Res 2000;6:3032-3037.
8. Van Kuilenburg AB, Haasjes J, Richel DJ, et al. Clinical implications of dihydropyrimidine dehydro-
genase (DPD) deficiency in patients with severe 5-fluorouracil-associated toxicity: identification
of new mutations in the DPD gene. Clin Cancer Res 2000;6:4705-12
9. Collie-Duguid ES, Etienne MC, Milano G, et al. Known variant DPYD alleles do not explain DPD
deficiency in cancer patients. Pharmacogenetics 2000;10:217-23
10. Milano G, Etienne MC. Individualizing therapy with 5-fluorouracil related to dihydropyrimidine
dehydrogenase: theory and limits. Ther Drug Monit 1996;18:335-340.
11. Maring JG, van Kuilenburg AB, Haasjes J, et al. Recuced 5-FU clearance in a patient with low DPD
activity due to heterozygosity for a mutant allele of the DPYD gene. Br J Cancer 2002;86:1028-
33
12. Fleming A, Milano G, Thyss A, et al. Correlation between dihydropyrimidine dehydrogenase ac-
tivity in peripheral mononuclear cells and systemic clearance of fluorouracil in cancer patients.
Cancer Res 1992;52:2899-2902.
13. Di Paolo A, Danesi R, Falcone A, et al. Relationship between 5-fluorouracil disposition, toxicity and
dihydropyrimidine dehydrogenase activity in cancer patients. Ann Oncol 2001;12:1301-1306.
14. Di Paolo A, Ibrahim T, Danesi R, et al. Relationship between plasma concentrations of 5-fluoroura-
cil and 5-fluoro-5,6-dihydrouracil and toxicity of 5-fluorouracil infusions in cancer patients. Ther
Drug Monit 2002;24: 588-593.
15. Santini J, Milano G, Thyss A, et al. 5-FU therapeutic monitoring with dose adjustment leads to an
inproved therapeutic index in head and neck cancer. Br J Cancer 1989;59:287-290.
16. Milano G, Etienne MC, Renee N, et al. Relationship between fluorouracil systemic exposure and
tumor response and patient survival. J Clin Oncol 1994;12:1291-1295.
17. Ackland SP, Garg MB, Dunstan RH. Simultaneous determination of DHFU and 5-fluorouracil in
Chapter 3
66
HPLC-UV analysis of 5-fluorouracil
67
plasma by high-performance liquid chromatography. Anal Biochem 1997;246:79-85.
18. Déporte-Féty A, Picot M, Amiand M, et al. High-performance liquid chromatography assay with
ultraviolet detection for quantification of dihydrofluorouracil in human lymphocytes: applica-
tion to measurment of dihydropyrimidine dehydrogenase activity. J Chromatogr B 2001;762:
203-209.
19. Del Nozal MJ, Bernal JL, Pampliega A, et al. Determination of the concentrations of 5-fluorouracil
and its metabolites in rabbit plasma and tissues by high-performance liquid chromatography. J
Chromatogr B 1994;656:397-405.
20. De Bruijn EA, Driessen O, van den Bosch N, et al. A gas chromatographic assay for the determina-
tion of 5,6-dihydrofluorouracil and 5-fluorouracil in human plasma. J Chromatogr B 1983;278:
283-289.
21. Casale F, Canaparo R, Muntoni E, et al. Simultaneous HPLC determination of 5-fluorouracil and its
metabolites in plasma of cancer patients. Biomed Chromatogr 2002;16:446-452.
22. Shah VP, Midha KK, Dighe S, et al. Analytical methods validation: bioavailability, bioequivalence,
and pharmacokinetic studies. J Pharm Sci 1992;81:309-312.
23. Loos WJ, de Bruijn P, van Zuylen L, et al. Determination of 5-fluorouracil in microvolumes of hu-
man plasma by solvent extraction and high-performance liquid chromatography. J Chromatogr
B Biomed Sci Appl. 1999;735:293-297.
24. Van den Bosch N, Driessen O, Van der Velde EA, et al. The stability of 5,6-dihydrofluorouracil in
plasma and the consequences for its analysis. Ther Drug Mon 1987;9:443-447
25. Maring JG, Piersma H, Van Dalen A, et al. Extensive hepatic replacement due to liver metastases
has no effect on 5-fluorouracil pharmacokinetics. Cancer Chemother Pharmacol 2003;51:167-
173
26. Mattison LK, Ezzeldin H, Carpenter M, et al. Rapid identification of dihydropyrimidine dehydroge-
nase deficiency by using a novel 2-13C-uracil breath test. Clin Cancer Res 2004;10:2652-2658
Extensive hepatic replacement due to liver metastases has no effect on 5-fluorouracil pharmacokinetics
Jan Gerard Maring1, Henk Piersma2, Albert van Dalen3, Harry J.M. Groen4, Donald R.A.
Uges5, Elisabeth G.E. De Vries6
1Department of Pharmacy, Diaconessen Hospital Meppel and Bethesda Hospital
Hoogeveen; 2Department of Internal Medicine, Martini Hospital Groningen; 3Department of Radiology, Diaconessen Hospital Meppel; Departments of 4Pulmonary
Diseases, 5Pharmacy and 6Medical Oncology, University Hospital Groningen, The Nether-
lands
Cancer Chemother Pharmacol 2003;51:167-173
Chapter 4.1
70
Influence of liver metastases on 5-fluorouracil pharmacokinetics
71
Erosion at work. Zabriskie point. Death Valley USA 1995.
Chapter 4.1
70
Influence of liver metastases on 5-fluorouracil pharmacokinetics
71
Abstract
Aim The influence of liver metastases on the pharmacokinetics of 5-fluorouracil (5-FU)
and its metabolite 5,6-dihydrofluorouracil (DHFU) was studied in patients with liver me-
tastases from gastrointestinal cancer and compared with a control group of patients with
non-metastatic gastrointestinal cancer.
Methods Patients were assigned to two different groups based on the presence of liver
metastases. The percentage of hepatic replacement was determined with CT and ultra-
sonography and classified as <25 %, 25-50 or > 50% from the total liver volume. Chemo-
therapy consisted of leucovorin 20 mg/m2/day plus 5-FU 425 mg/m2/day, both during 5
days. Blood sampling was carried out on the first day of the first chemotherapy cycle. 5-FU
and DHFU were quantified by HPLC in plasma. A four compartment parent drug - metabo-
lite model with non-linear Michaelis-Menten elimination from the central compartment
of the parent drug (5-FU) was applied to describe 5-FU and DHFU pharmacokinetics.
Results No effect of liver metastases on 5-FU clearance was observed between the two
groups. The effect of 18 covariables on pharmacokinetic parameters was also studied in
univariate correlation analyses. Body surface area was positively correlated with the dis-
tribution volume of 5-FU in the central compartment and with Vmax
(r = 0.65 and r = 0.54
respectively).
Conclusions There is no need for dose adjustment of 5-FU as standard procedure in
patients with liver metastases and mild to moderate elevations in liver function tests.
Introduction
Fluorouracil (5-FU) is widely used in chemotherapeutic regimens for the treatment
of breast-, colorectal- and head and neck cancer. The cytotoxic mechanism of 5-FU is
complex, requiring intracellular bioconversion of 5-FU into cytotoxic nucleotides. Inhibi-
tion of thymidylate synthase by the metabolite 5-fluoro-2’-deoxyuridine-5’-monophos-
phate (FdUMP) is thought to be the main mechanism of cytotoxicity [1]. The cytotoxicity
is caused by only a small part of the administered 5-FU dose, as the majority of 5-FU is
rapidly metabolised into inactive metabolites (see figure 1). The initial and rate-limiting
enzyme in the catabolism of 5-FU is dihydropyrimidine dehydrogenase (DPD), catalysing
a reduction of 5-FU into 5,6-dihydrofluorouracil (DHFU). Subsequently DHFU is degraded
into fluoro-β-ureidopropionic acid (FUPA) and fluoro-β-alanine (FBAL) [2]. Several groups
have suggested a major role of DPD in the regulation of 5-FU metabolism and thus in the
amount of 5-FU available for cytotoxicity [3-7]. DPD is present in many tissues, but the
highest activity is found in the liver and, since liver blood flow is relatively high, this organ
is considered as major site for 5-FU degradation [2,8]. In the last decades the role of liver
metastases and liver function impairment on 5-FU pharmacokinetics has been subject to
Chapter 4.1
72
Influence of liver metastases on 5-fluorouracil pharmacokinetics
73
debate.
The effects of liver dysfunction on the pharmacokinetics of drugs are generally difficult to
predict. Liver dysfunction is usually diagnosed on the basis of liver function tests, but for
most drugs the correlation between test values and drug metabolism is only weak. Liver
dysfunction due to liver metastases is an even more complicated issue. Liver metastases
displace healthy liver tissue and this may directly affect the liver metabolic capacity due
to tissue loss, but also indirectly due to tissue damage caused by cholestasis as a result of
compression of surrounding structures including bileducts. Furthermore, liver dysfunc-
tion may affect plasma volume, serum albumin, drug protein binding, and hepatic blood
flow, all of which can influence pharmacokinetic parameters in complex ways.
In the last decade, several groups have studied the effects of liver metastases on 5-FU
clearance, in particular during continuous infusion. In an early small study, a reduction of
clearance of continuously infused 5-FU was reported in four patients with gastrointesti-
nal carcinoma and hepatic metastases [9]. Contrary to this, others found no correlation
between drug clearance and hepatic function tests in a larger study with 187 patients
����
���������� ���������
���� �����������������������
���� �����
���� ��������������������� ��������
���� ����
���
Figure 1 Metabolism of 5-FU. 5-Fluoro-2’-deoxyuridine-5’-monophosphate (FdUMP) is the cytotoxic product resulting from a multi-step 5-FU activation route . FdUMP inhibits the enzyme thymidylate synthase (TS), which leads to intracellular accumulation of deoxy-uridine-monophospate (dUMP) and depletion of deoxy-thymidine-monophospate (dTMP). This causes arrest of DNA synthesis. The initial and rate-limiting enzyme in the catabolism of 5-FU is dihydropyrimidine dehydrogenase (DPD), catalys-ing the reduction of 5-FU into 5,6-dihydrofluorouracil (DHFU). Subsequently, DHFU is degraded into fluoro-β-ureidopropionic acid (FUPA) and fluoro-β-alanine (FBAL).
Chapter 4.1
72
Influence of liver metastases on 5-fluorouracil pharmacokinetics
73
receiving 5-FU as continuous infusion [10]. More recently, Etienne et al. studied several co-
variables affecting 5-FU clearance during continuous infusion in 104 patients with various
cancers [11]. They found no effect of liver metastases in a subgroup of seven patients,
but did not further specify the involvement of concurrent liver dysfunction. Although
these studies suggest that liver metastases do not affect 5-FU clearance during continu-
ous infusion, it is important to realise that the pharmacokinetic behaviour of 5-FU after
bolus injection or short time infusion differs from that during continuous infusion. After
rapid infusion, 5-FU displays non-linear pharmacokinetic behaviour [12-15], probably due
to saturation of the DPD enzyme at higher plasma levels, although the exact mechanism
is still unclear [16]. Thus, data on 5-FU clearance obtained during continuous infusion do
not necessarily predict the situation after bolus injection. So far, however, only few reports
have been published regarding the effects of liver metastases and/or liver dysfunction on
the pharmacokinetics of bolus injected 5-FU [12,17,18].
Christophidis et al. studied the bioavailability of 5-FU after oral and intravenous drug ad-
ministration in 12 patients with liver metastases, and concluded that the bioavailability
was not related to liver function test abnormalities or metastatic deposits [12]. Nowa-
kowska-Dulawa also found no effect of liver metastases on 5-FU clearance in 20 patients
with colorectal cancer (compared to 8 controls) [17]. Unfortunately, in both studies patient
characteristics and liver function test results were not further specified. More recently,
Terret et al. studied the dose and time dependencies of 5-FU pharmacokinetics in 21
patients and also included some liver function parameters in their analysis [18]. Their data
suggest that 5-FU clearance might increase with the volume of hepatic replacement.
Since in most studies information regarding the extent of liver metastatic involvement is
concise or lacking, we decided to design a protocol to study the effects of this parameter
on the pharmacokinetics of 5-FU and DHFU after bolus injection. This study should provide
more insight in potential interactions between liver function and 5-FU pharmacokinetics.
Patients and Methods
Patients
Patients, aged 18 years and older, scheduled to receive adjuvant or palliative 5-FU treatment
for gastrointestinal cancer, and formerly chemotherapy naive, were included. Patients with
anaemia (Hb < 6 mmol/l), known disorders of hemostasis (e.g. haemophilia), severe renal
failure (GFR < 30 ml/min) or a history of alcohol or drug abuse were excluded. Patients
were assigned to two different groups based on the presence of liver metastases, that were
identified and measured with ultrasound and/or CT imaging. Other pre-treatment meas-
urements were body weight, height, blood cell counts, standard liver function tests (ALT,
AST, LDH, ALP, bilirubin) and markers for the liver synthesis function (pseudocholineste-
rase, albumin and antithrombin-III). Chemotherapy consisted of leucovorin 20 mg/m2/day,
Chapter 4.1
74
Influence of liver metastases on 5-fluorouracil pharmacokinetics
75
administered as short time infusion, followed by 5-FU 425 mg/m2/day, administered as
bolus intravenous injection during 2 min. Both drugs were given on 5 consecutive days,
in a 28-day cycle (Mayo regimen). On the day of blood sampling, leucovorin was infused
after the last sample. On the following 4 days, the same 5-FU dose was administered as
short time infusion (10-15 min), after the administration of leucovorin. During the first
chemotherapy cycle, toxicity was scored according to the Common Toxicity Criteria. The
study was approved by the Institutional Medical Ethics Review Board in the participating
hospitals and written informed consent was obtained from all patients.
Quantification of liver metastatic involvement
The diameter of the metastases was measured with standard CT and ultrasound imaging
software. From each lesion the maximum diameter was measured. This diameter was
used to calculate the volume of the metastatic lesions in relation to the total liver volume.
Four levels were defined for semi-quantification of the extent of liver metastatic disease,
according to Hunt et al. [19]. Absence of liver metastases was classified as level 0 (control
group), less than 25 % liver metastatic involvement as level 1, 25-50 % as level 2, and more
than 50% as level 3.
Collection of blood samples
For pharmacokinetic sampling, a canule was placed intravenously in the arm of the
patient contralateral to the side of drug administration. Blood samples of 5 ml were
collected in heparinised tubes just before, and 2, 5, 10, 20, 30, 45, 60, 80, 100, 120, 150 and
180 min after 5-FU injection. Collected samples were immediately placed on ice and sub-
sequently centrifuged at 2,500 g for 10 min at 4°C and stored at –80 °C till analysis. The
plasma samples were analysed for 5-FU and DHFU concentrations by high-performance
liquid chromatography (HPLC).
Chemicals
5-FU and chlorouracil were obtained from Sigma Chemical Co (Zwijndrecht, the
Netherlands). 5,6-dihydro-5-fluorouracil was kindly provided by Roche Laboratories
(Basel, Switzerland). Human heparinised plasma was obtained from the Red Cross Blood
Bank (Groningen, the Netherlands). All other chemicals were of analytical grade.
Reversed phase HPLC analysis
5-FU and DHFU concentrations were measured by HPLC analysis using a modification of
the method described by Ackland et al. [20]. Briefly, 100 µl chlorouracil internal standard
solution (80 mg/l in water) was added to 1 ml plasma sample, and this mixture was
vortexed and subsequently deproteinated with 50 µl of a 50% (w/v) trichloracetic acid
solution. After centrifugation at 8,000 g for 2 min the supernatant was transferred into a
20 ml centrifuge tube and neutralised with 1 ml 1 M sodium acetate solution. Then 5 ml
Chapter 4.1
74
Influence of liver metastases on 5-fluorouracil pharmacokinetics
75
ethylacetate was added and the mixture was vortexed during 10 min. After separation of
the organic and aqueous layers by centrifugation at 5,000 g for 5 min, the ethylacetate
layer was transferred into a 10 ml tube and evaporated under a stream of nitrogen at 25 °C.
The residue was dissolved in 100 µl ultrapure water and 20 µl was injected. 5-FU and DHFU
standards ranging from 0.5 to 20 mg/l were prepared in human plasma. The chromato-
graphic system consisted of a Waters 616 pump equipped with a Waters 717+ autosam-
pler. The separation of 5-FU and DHFU was accomplished by gradient elution at ambient
temperature on a Phenomenex Prodigy ODS 3 column (I.D. 250 x 4.6 mm, 5µm) equipped
with a guard column (30 x 4.6 mm) of the same material (both purchased from Bester,
Amstelveen, The Netherlands). Mobile phase A consisted of 1.5 mM K3PO
4 and 1% (v/v)
methanol in water (pH=6.0) and mobile phase B of 1.5 mM K3PO
4 and 5% (v/v) methanol
in water (pH=6.0). The gradient was programmed as follows: 100% A during 2 min; 100%
A → 100% B in 0.5 min; 100% B during 7 min; 100% B → 100% A in 0.5 min; 100% A during
10 min. Drug detection was performed using a Waters 996 Photo Diode Array UV detector
interfaced with a Millenium 2010 Chromatography Manager Workstation. Spectra were
acquired in the 201-300 nm range. 5-FU was monitored at 266 nm and DHFU at 205 nm.
The internal standard chlorouracil was monitored at both wavelengths. The limit of quan-
tification in plasma was 0.1 mg/l for both 5-FU and DHFU.
Pharmacokinetic analysis
The pharmacokinetic analyses were performed in the ADAPT II Maximum Likelihood
Parameter Estimation program (version 4.0; University of Southern California, Los Angeles,
Ca). The pharmacokinetic data of the first 15 patients were tested in 8 different parent drug-
metabolite pharmacokinetic models, characterised by linear or non-linear (Michaelis-Menten)
parent drug (5-FU) elimination from a central compartment and distribution of 5-FU and me-
tabolite (DHFU) over one or two compartments. Variance for the observations was assumed to
be proportional to the measured values and set at 10%. In each model the patient’s data were
fitted individually and for each data set the Akaike Information Criterion (AIC) was calculated
[21]. The model with the lowest summarised AIC value was selected as the better one. The
area under the curve (AUC 0→3h
) of 5-FU and DHFU was calculated using the trapezoidal
rule. The total clearance of 5-FU was calculated by dividing the administered dose by the
AUC.
Statistical analysis
Patient data were analysed as two groups, based on the presence of liver metastases.
Clinical chemistry and pharmacokinetic data in both groups were compared with a two
sided Student’s t-test. In case of unequal variances as indicated by the Kolmogorov-
Smirnov test, the log transformed data were used, or data were tested with the non-para-
metric Mann-Whitney U-test. The study was powered (>80%) to detect a 25% difference in
population means, assuming a standard deviation in pharmacokinetic parameters of 35%.
Chapter 4.1
76
Influence of liver metastases on 5-fluorouracil pharmacokinetics
77
Correlations between clinical chemistry, demographic and pharmacokinetic data were
tested by Spearman correlation analysis. Statistical significance was at p<0.05. Analyses
were performed with the SYSTAT 7.0 statistical program (SPSS inc. 1997).
Results
Patients
Patients in this study were treated in the Martini Hospital Groningen, the Bethesda
Hospital Hoogeveen or the Diaconessen Hospital Meppel. Between December 1997 and
January 2001, 18 patients were included in the control group and 16 in the liver metas-
tases group. In one patient belonging to the control group, largely reduced clearance of
5-FU was observed. DNA sequence analysis of the gene encoding DPD revealed that this
patient was heterozygous for a G→A point mutation in the DPYD gene. The resulting
protein from the mutated allele is inactive and total DPD activity in this patient was
low. Data on this patient were published elsewhere [22]. The statistical analyses were
performed both with and without inclusion of this patient in the control group. The liver
metastatic involvement of 9 patients in the metastases group was classified as level 1, that
of 4 patients as level 2 and that of 3 patients as level 3. An overview of the patient char-
acteristics is represented in table 1. An overview of treatment related toxicity, observed
during the first cycle, is shown in table 2.
Pharmacokinetics
The mean pharmacokinetic curves of 5-FU and DHFU as measured in both treatment
groups are represented in figure 2. The model, selected for calculating 5-FU and DHFU phar-
macokinetics of the patients in this study, is a four-compartment parent drug-metabolite
model with Michaelis-Menten elimination from the first towards the third compartment
(see figure 3). The model is described by four differential equations:
�� ��� ��� ���
� ��� �� ���������
�
��
��� ��� �
�
�����
��
������� ����
��
����
�� �� ��� ����
� ��� ���� ���������
�
��
��
�
����
�
������� ����
��
����
Chapter 4.1
76
Influence of liver metastases on 5-fluorouracil pharmacokinetics
77
live
r m
etas
tase
sco
ntr
ols
Su
bg
rou
ps
on
per
cen
tag
e o
f li
ver
met
asta
tic
invo
lvem
ent
< 2
5%
25
-50
%>
50
%
par
amet
er(n
orm
al r
ang
e)n
=1
6n
=1
8(n
=9)
(n=
4)(n
=3)
gen
der
M/F
9/7
13/5
4/5
4/0
1/2
age
(yr)
45-
78
(64)
4
5-80
(66)
57-
78(6
4) 4
5-76
(64)
47-
70(6
4)
wei
gh
t(k
g)
60-
94(7
8)
56-
85(7
3) 6
3-90
(78)
60-
94(7
9) 7
5-79
(76)
S-cr
eati
nin
e(4
0-10
0 µm
mo
l/l)
53
-131
(77)
62-1
84(7
7)
53-
131
(75)
71-
94(8
8) 6
1-81
(71)
AST
(<48
U/l
)
12-2
01(4
2) §
1
3-24
(20)
12-
60(3
4) §
26
-137
(59)
§
89-2
01(1
11) §
ALT
(<42
U/l
)
8-
234
(56)
§
5-
44(3
1)
8-58
(37)
§
38-2
02(7
4) §
50
-234
(66)
§
LDH
(200
-500
U/l
)
234-
2662
(5
54) §
17
3-39
6(2
72)
2
34-1
035
(449
) §
348-
1165
(689
) §
839-
2662
(235
7) §
ALP
(<12
5 U
/l)
65-1
221
(146
) §
54
-108
(79)
6
5-16
3(1
07) §
121
-266
(1
81) §
34
4-12
21
(454
) §
Bili
rub
in to
tal
(<17
µm
mo
l/l)
3-29
3(1
3)
5-
14(9
)
3-1
3(1
1)
8-59
(13)
31
-293
(40)
§
alb
um
in(3
5-55
g/l
) 2
4-39
(36)
2
5-43
(36)
31-
39(3
7) 3
6-38
(37)
24-
30(2
6) §
Ach
E-as
e(5
.4-1
3.2
x103 U
/l)
1.2
-8.3
(4.4
)
1.9-
6.5
(3.9
) 3
.0-8
.3(4
.9) §
1.2
-6.3
(3.7
) 1
.5-2
.8(2
.1)
AT-3
(80-
120
%)
5
2-13
7(9
2)
82
-126
(96)
83
-137
(96)
81
-100
(90)
52
-119
(57)
§ Sta
tistic
ally
diff
eren
t fro
m co
ntro
ls at
p<0
.05
(Man
n W
hitn
ey U
test
)
Tabl
e 1
Patie
nt C
hara
cter
istic
s
Data
are
pre
sent
ed a
s ran
ge. T
he m
edia
n va
lue
is pl
aced
bet
wee
n br
acke
ts.
Chapter 4.1
78
Influence of liver metastases on 5-fluorouracil pharmacokinetics
79
The compartments 1 and 2 represent the central and peripheral compartment for 5-FU
(parent drug) pharmacokinetics, compartments 3 and 4 are the central and peripheral
compartment for DHFU (metabolite) pharmacokinetics. The X values indicate the amount
of drug in each compartment respectively. Data are imported in the model as plasma drug
concentrations, measured in compartment 1 (5-FU) and compartment 3 (DHFU) respec-
tively. The volume of compartment 1 and 3 is calculated by dividing the drug amount
by drug concentration. The k-values represent linear distribution- and elimination rate
constants, and the Vmax
and Km
values represent Michaelis-Menten constants for non-linear
elimination from the first compartment. The Km
value was kept constant during fitting of
patient data. To determine the best fitting value, this parameter was varied between 0.5
and 15 mg/l. Km
=5 mg/l was selected as most optimal value, based upon the lowest sum-
marised AIC. Rinf
represents the infusion rate of 5-FU in mg/h. No differences existed in
model parameters between the 2 treatment groups and no correlations were measured
between individual model parameters and patient characteristics. Therefore, the calcu-
lated model parameters are listed in table 3 as mean values obtained from all 33 patients
in this study. The interindividual variation in 5-FU clearance was considerable, resulting in
metastases (n=15) no metastases (n=18)
CTC grade I II III IV I II III IV
gastrointestinal
nausea 6 0 0 0 5 0 0 0
vomiting 3 0 0 0 2 0 0 0
diarrhea 1 0 0 0 4 2 0 0
mucositis 3 4 0 0 2 3 0 0
Flu-like symptoms
fever 1 1 0 0 1 0 1 0
malaise 1 1 0 0 6 1 0
Others
dermatological 1 0 0 0 2 0 0 0
eyes 1 0 0 0 2 0 0 0
Toxicity of any kindb 10 (66%) 13 (72%)
aThe figures represent the number of patients suffering from a particular type of toxicity (graded ac-cording to the Common Toxicity Criteria version 2.0) bTotal number of patients suffering from toxicity of any kind at any grade.
Table 2 Overview of side effects during the first cyclea.
Chapter 4.1
78
Influence of liver metastases on 5-fluorouracil pharmacokinetics
79
� ���
����
��������
�� � � �� � �
����� �����
�� ��
����
����
����
���
�
��
���
� �� ��� ��� ���
���� �����
���
�
���� ����������
���� ��������
���� ����������
���� ��������
Figure 2 Pharmacokinetics of 5-FU. Shown are 5-FU ( ) and DHFU ( ) plasma levels observed in control patients (n=18) and 5-FU ( ) and DHFU ( ) plasma levels observed in patients with liver metastases (n=16). All values are depicted as mean ± SD.
Figure 3 Four compartiment parent drug - metabolite pharmacokinetic model describing 5-FU and DHFU pharmacokinetics.
Chapter 4.1
80
Influence of liver metastases on 5-fluorouracil pharmacokinetics
81
5-FU AUCs ranging from the lowest to the highest value over a factor 3 (not including the
patient with DPD deficiency).
Correlation between patient covariables and pharmacokinetic parameters
We identified 18 patient covariables that were each tested in a univariate Spearman cor-
relation analysis. Tested covariables were sex, age, height, weight, body surface area (BSA),
lean body mass (LBM), creatinine, urea, level of liver metastatic involvement, AST, ALT, ALP,
LDH, bilirubin, albumin, AT-III, pseudocholinesterase and 5-FU dose. Positive correlations
were found between the BSA and the Vmax
and V1 values, regardless the level of liver meta-
static involvement (r = 0.65 and r = 0.54 respectively)
Discussion
The persistent uncertainty regarding the effects of liver metastases and liver dysfunction
on the pharmacokinetics of bolus injected 5-FU- made us to design the current study. We
decided to target the study on the extent of liver metastatic involvement and also decided
to include a detailed characterisation of the liver function in the study design.
We eventually included 34 patients from which 16 had liver metastases. We choose to
classify the extent of liver metastatic involvement in these patients as categorical rather
than continuous variable, according to Hunt et al.[19], since accurate measurement of the
percentage hepatic replacement is difficult to perform. More subtle differences between
patients cannot be detected in this approach, but this was not considered disadvanta-
Model parameter mean (SD)
Vmax (h-1) 1472 (356)
V1 (l) 15.5 (5.3)
K12 (h-1) 7.73 (4.13)
K21 (h-1) 6.24 (2.77)
V3 (l) 97 (42)
K34 (h-1) 6.18 (12.83)
K43 (h-1) 4.91 (7.38)
K30 (h-1) 1.80 (1.71)
AUC 5-FU (mg.h/l) 10.1 (3.7)
Cl 5-FU (ml/min) 1485 (537)
AUC DHFU (mg.h/l) 5.6 (2.0)
Table 3 Pharmacokinetic parameters
Chapter 4.1
80
Influence of liver metastases on 5-fluorouracil pharmacokinetics
81
geous, since small differences will probably be clinically irrelevant.
All patients received treatment according to the Mayo Clinics scheme. The 5-FU dose was
administered as short-time infusion (5-10 min), according to common practice in the
participating hospitals, but on the day of blood sampling, 5-FU was given as 2 min bolus
injection to warrant precise and standardised drug administration. The short half-life of
5-FU necessitated this standardisation, since uncertainty in this parameter can hamper
pharmacokinetic calculations.
To describe the non-linear pharmacokinetics, we applied a relatively complex model
with Michaelis-Menten elimination from the central compartment, based on the model
proposed by Collins et al [13]. Our model was selected on the basis of ‘best fit’ (objectified
by the Akaike Information Criterion) from a series of 8 different variants on the Collins
model. The final model that we used is almost identical to the model proposed by Terret et
al. [18] in their analysis of 5-FU pharmacokinetics. We also included the metabolite DHFU
in our model, but the additional value of this seemed limited, since large 95% confidence
intervals were found around the calculated K34
, K43
and K30
values.
The consequences of non-linear Michaelis-Menten pharmacokinetics are most profound
at plasma levels exceeding the Km
value. In the case of 5-FU, such plasma levels are
reached after bolus injection but not during continuous infusion. A reduction of liver DPD
capacity, due to liver metastases and/or liver dysfunction, might result in lower Vmax
values
and, thus, in a lower 5-FU clearance immediately after bolus injection. Our results do not
confirm this, as patients in both treatment groups displayed similar pharmacokinetics.
No significant correlations were found between pharmacokinetic parameters, including
overall 5-FU clearance, and liver function parameters.
The fact that most patients with liver metastases had mild to moderate liver dysfunction
might explain our observations. However, in three patients with extensive (level 3) meta-
static disease, attended by cholestase as indicated by high bilirubin and ALP levels, 5-FU
clearance also was unchanged. These patients further displayed high transaminase levels
(indicating cell damage) and low albumin and AT-III levels (indicating loss of function).
This observation suggests that the influence of extensive liver metastatic disease,
including liver damage, on 5-FU pharmacokinetics is at leas not dramatic. Recently, Terret
et al. performed a NONMEM analysis to identify covariables that affect 5-FU model pa-
rameters and they observed that their Vmax
values tended to increase with the volume of
liver metastatic involvement [18]. In our study this correlation was only weak (r = 0.21, see
figure 4) and at least clinically irrelevant. These results suggest that the metabolism of 5-
FU in metastatic tumour tissue at least equals that in healthy liver tissue. Extensive 5-FU
uptake in metastatic tissue indeed has been demonstrated during 18F-fluorouracil labelled
positron emission tomography in patients with liver metastases from colorectal cancer
[23]. Although the DPD activity in liver metastases from colon cancer seems to be lower
than in adjacent normal liver tissue [24], hepatic arterial blood flow is generally increased
in liver metastatic disease [19,25]. Since the elimination rate of drugs with a very large
Chapter 4.1
82
Influence of liver metastases on 5-fluorouracil pharmacokinetics
83
extraction ratio is strongly depending on the hepatic blood flow, an increase of liver blood
flow in metastatic disease might compensate for a reduced DPD activity in parts of the
liver replaced by metastases.
More or less expected on the basis of the almost identical pharmacokinetic profiles,
treatment related toxicity was comparable in both treatment groups. The incidence of
diarrhoea and malaise was somewhat higher in the control group, but this is probably
accidental. One patient in the control group experienced excessive toxicity as a result of
decreased 5-FU clearance due to DPD deficiency. A full description of the pharmacoki-
netics of 5-FU in this patient was published elsewhere [22]. Interestingly, we found that
irrespective of metastatic status 5-FU clearance was significantly lower in patients experi-
encing mucositis (1696 ± 640 vs. 1209 ± 290 ml/min, p<0.05, see figure 5). Such a trend was
not observed for nausea. This finding might be a coincidence, but it might also be possible
that late toxic effects such as mucositis are more related to pharmacokinetics than direct
toxic effects such as nausea. It has been shown that the extent of salivary excretion is a
predictor for the development of mucositis and salivary excretion is generally higher in
patients with low drug clearance [26].
Based on current data we conclude that there is no need for dose adjustment of 5-FU in
patients with liver metastases and mild to moderate elevations in liver function tests. Both
the extent of liver metastatic involvement and liver function parameters were included
�
���
����
����
����
����
� � � �
����� �� ������� �����������
����
Figure 4 Correlation between level of hepatic replacement and calculated Vmax (h-1) value.
Chapter 4.1
82
Influence of liver metastases on 5-fluorouracil pharmacokinetics
83
as parameters in this study to this allowed a more comprehensive evaluation of liver
metastatic disease on 5-FU pharmacokinetics. We believe that there is no reason to expect
increased 5-FU toxicity in patients with liver metastases due to a reduced 5-FU clearance.
Therefore we do not recommend 5-FU dose reduction as standard procedure in these
patients.
Acknowledgement
We would like to thank Roche Basel for providing dihydrofluorouracil chemical standard, Dr.
Hans Proost (Department of Pharmacokinetics and Drug Delivery, University Groningen,
NL) for his advice on pharmacokinetic modelling, Barbara Bong and Dr. Robert de Jong
���������
�
���
����
����
����
����
����
����
����
���
���
�����
�
������
�
���
����
����
����
����
����
����
����
���
���
�����
�
����� �
����� �
����� ���
����� ���
Figure 5 Correlation between 5-FU clearance (ml/min) and the occurrence of mucositis (upper panel) and nausea (lower panel).
Chapter 4.1
84
Influence of liver metastases on 5-fluorouracil pharmacokinetics
85
(Martini Hospital Groningen, NL), Henk de Korte (Diaconessen Hospital Meppel, NL) and
Janny Haasjes (Bethesda Hospital Hoogeveen, NL) for patient inclusions, the departments
of radiology of the participating hospitals for help on calculations regarding the extent of
liver metastatic involvement, and last but not least all nurses of the oncology wards of the
participating hospitals for their assistance during blood sampling.
Chapter 4.1
84
Influence of liver metastases on 5-fluorouracil pharmacokinetics
85
References
1. Pinedo HM, Peters GF. Fluorouracil: biochemistry and pharmacology. J Clin Oncol 1988;6:1653-
1664
2. Heggie GD, Sommadosi JP, Cross DS, Huster WJ, Diasio RB. Clinical pharmacokinetics of 5-fluoro-
uracil and its metabolites in plasma, urine and bile. Cancer Res 1987;47:2203-2206
3. Chazal M, Etienne MC, Renee N, Bourgeon A, Richelme H, Milano G. Link between dihydropy-
rimidine dehydrogenase activity in peripheral blood mononuclear cells and liver. Clin Cancer Res
1996;2: 506-510
4. Etienne MC, Lagrange JL, Dassonville O, Fleming R, Thyss A, Renee N, Schneider M, Demard F,
Milano G. Population study of dihydropyrimidine dehydrogenase in cancer patients. J Clin Oncol
1994;12:2248-2253
5. Fleming RA, Milano G, Thyss A, Etienne MC, Renee N, Schneider M, Demard F. Correlation between
dihydropyrimidine dehydrogenase activity in peripheral mononuclear cells and systemic clear-
ance of fluorouracil in cancer patients. Cancer Res 1992;52: 2899-2902
6. Harris BE, Song R, Soong SJ, Diasio RB. Relationship between dihydropyrimidine dehydrogenase
activity and plasma 5-fluorouracil levels with evidence for circadian variation of enzyme activity
and plasma drug levels in cancer patients receiving 5-fluorouracil by protracted continuous infu-
sion. Cancer Res 1991;50:197-201
7. Lu Z, Zhang R, Diasio RB. Population characteristics of hepatic dihydropyrimidine dehydrogenase
activity, a key metabolic enzyme in 5-fluorouracil chemotherapy. Clin Pharmacol Ther 1995;58:
512-522
8. Ho DH, Townsend L, Luna MA, Bodey GP. Distribution and inhibition of dihydrouracil dehydroge-
nase activities in human tissues using 5-fluorouracil as substrate. Anticancer Res 1986;6:781-784
9. Floyd RA, Hornbeck CL, Byfield JE, Griffiths JC, Frankel SS. Clearance of continuously infused 5-flu-
orouracil in adults having lung or gastrointestinal carcinoma with or without hepatic metastases.
Drug Intell Clin Pharm 1982;16: 665-667
10. Fleming RA, Milano GA, Etienne MC, Renee N, Thyss A, Schneider M, Demard F. No effect of dose,
hepatic function, or nutritional status on 5-FU clearance following continuous (5-day) 5FU infu-
sion. Br J Cancer 1992;6: 668-672
11. Etienne MC, Chatelut E, Pivot X, Lavit M, Pujol A, Canal P, Milano G. Co-variables influencing 5-fluo-
rouracil clearance during continuous venous infusion. A NONMEM analysis. Eur J Cancer 1998;34:
92-97
12. Christophidis N, Vajda FJE, Lucas I, Drummer O, Moon WJ, Louis WJ. Fluorouracil therapy in pa-
tients with carcinoma in the large bowel: a pharmacokinetic comparison of various rates and
routes of administration. Clin Pharmacokinet 1978;3:330-336
13. Collins JM, Dedrick RL, King FG, Speyer JL, Myers CE. Nonlinear pharmacokinetic models for 5-flu-
orouracil in man: intravenous and intraperitoneal routes. Clin Pharmacol Ther 1980;28:235-246
14. McDermot BJ, van den Berg HW, Murphy RF.Nonlinear pharmacokinetics for the elimination of
5-fluorouracil after intravenous administration in cancer patients. Cancer Chemother Pharmacol
Chapter 4.1
86
1982;9:173-178
15. Van Groeningen CJ, Pinedo HM, Heddes J, Kok RM, De Jong AP, Wattel E, Peters GJ, Lankelma J.
Pharmacokinetics of 5-fluorouracil assessed with a sensitive mass spectrometric method in pa-
tients on a dose escalation schedule. Cancer Res 1988;48:6956-6961
16. Gamelin E, Boisdron-Celle M. Dose monitoring of 5-fluorouracil in patients with colorectal or
head and neck cancer - status of the art. Crit Rev Oncol Hematol 1999;30: 71-79
17. Nowakowska-Dulawa E. Circadian rhythm of 5-fluorouracil pharmacokinetics and tolerance.
Chronobiologica 1990;17:27-35
18. Terret C, Erdociain E, Guimbaud R, Boisdron-Celle M, McLeod HL, Fety-Deporte R, Lafond T, Game-
lin E, Bugat R, Canal P, Chatelut E. Dose and time dependencies of 5-fluorouracil pharmacokinet-
ics. Clin Pharmacol Ther 2000;68:270-279
19. Hunt TM, Flowerdew ADS, Britten AJ, Fleming JS, Karran SJ, Taylor I. An association between
parameters of liver blood flow and percentage hepatic replacement with tumour. Br J Cancer
1989;59:410-414
20. Ackland SP, Garg MB, Dunstan RH. Simultaneous determination of dihydrofluorouracil and 5-
fluorouracil in plasma by high-performance liquid chromatography. Anal Biochem 1997;246:
79-85
21. Bourne DWA. Evaluation of program output. In: Bourne DWA (ed) Mathematical modelling of
pharmacokinetic data. Technomic publishing Co inc. 1995 Lancaster Basel p.107-109
22. Maring JG, Van Kuilenburg ABP, Piersma H, Groen HJM, Uges, DRA, De Vries EGE. Reduced 5-FU
clearance in a patient with low DPD activity due to heterozygosity for a mutant allele of the
DPYD gene. Br J Cancer 2002;86;1028-1033
23. Moehler M, Dimitrakopoulou-Strauss A, Gutzler F, Raeth U, Strauss LG, Stremmel W.18F-labeled
fluorouracil positron emission tomography and the prognoses of colorectal carcinoma patients
with metastases to the liver treated with 5-fluorouracil. Cancer 1998;83:245-253
24. Johnston SJ, Ridge SA, Cassidy J, McLeod HL. Regulation of dihydropyrimidine dehydrogenase in
colorectal cancer. Clin Cancer Res 1999;5:2566-2570
25. Leen E, Goldberg JA, Robertson J, Angerson WJ, Sutherland GR, Cooke TG, McArdle CS. Early de-
tection of occult colorectal hepatic metastases using duplex colour Doppler sonography. Br J
Surg 1993; 80:1249-1251
26. Joulia JM, Pinguet F, Ychou M, Duffour J, Astra C, Bresolle F. Plasma and salivary pharmacokinetics
of 5-fluorouracil (5-FU) in patients with metastatic colorectal cancer receiving 5-FU bolus plus
continuous infusion with high-dose folinic acid. Eur J Cancer 1999;35:296-301
Reduced 5-FU clearance in a patient with low DPD activity due to heterozygosity for a mutant allele of the DPYD gene
Jan Gerard Maring1, André B.P. van Kuilenburg2, Janet Haasjes2, Henk Piersma3, Harry J.M.
Groen4, Donald R.A. Uges5, Albert H. van Gennip2, Elisabeth G.E. de Vries6
1Department of Pharmacy, Diaconessen Hospital Meppel and Bethesda Hospital
Hoogeveen; 2Department of Clinical Chemistry, Academic Medical Center Amsterdam; 3Department of Internal Medicine, Martini Hospital Groningen; Departments of 4Pulmonary Diseases, 5Pharmacy and 6Medical Oncology, University Hospital Groningen,
The Netherlands
Br J Cancer 2002;86;1028-1033
Chapter 4.2
88
Influence of DPD deficiency on 5-fluorouracil pharmacokinetics
89
One out of billions. Lago di Garda. Italy 2000.
Chapter 4.2
88
Influence of DPD deficiency on 5-fluorouracil pharmacokinetics
89
Abstract
Aim 5-FU pharmacokinetics, DPD-activity and DNA sequence analysis were compared
between a patient with extreme 5-FU induced toxicity and six control patients with
normal 5-FU related symptoms.
Methods Patients were treated for colorectal cancer and received chemotherapy consist-
ing of folinic acid 20 mg/m2 plus 5-FU 425 mg/m2 . Blood sampling was carried out on day
1 of the first cycle.
Results The 5-FU AUC in the index patient was 24.1 mg.h/l compared to 9.8 ± 3.6 (range
5.4-15.3) mg.h/l in control patients. The 5-FU clearance was 520 ml/min versus 1293 ± 302
(range 980-1780) ml/min in controls. The activity of DPD in mononuclear cells was lower
in the index patient (5.5 nmol/mg/h) compared to the 6 controls (10.3 ± 1.6, range 8.0-
11.7 nmol/mg/h). Sequence analysis of the DPD gene revealed that the index patient was
heterozygous for a IVS14+1G>A point mutation.
Conclusions Our results indicate that the inactivation of one DPYD allele can result in a
strong reduction in 5-FU clearance, causing severe 5-FU induced toxicity.
Introduction
Fluorouracil (5-FU) is widely used in chemotherapeutic regimens for the treatment
of breast-, colorectal- and head- and neck cancer. The cytotoxic mechanism of 5-FU is
complex, requiring intracellular bioconversion of 5-FU into cytotoxic nucleotides (see
figure 1). Inhibition of thymidylate synthase by the metabolite 5-fluoro-2’-deoxyuridine-
5’-monophosphate is thought to be the main mechanism of cytotoxicity [1]. The cytotox-
icity is caused by only a small part of the administered 5-FU dose, as the majority of 5-FU is
rapidly metabolised into inactive metabolites. The initial and rate-limiting enzyme in the
catabolism of 5-FU is dihydropyrimidine dehydrogenase (DPD), catalysing the reduction
of 5-FU into 5,6-dihydrofluorouracil (DHFU). Several groups have suggested a major role
of DPD in the regulation of 5-FU metabolism and thus in the amount of 5-FU available for
cytotoxicity [2-5]. Indeed, in patients with DPD enzyme deficiency, 5-FU chemotherapy
is associated with severe, life-threatening toxicity [6]. Moreover, a markedly prolonged
elimination half-life of 5-FU has been observed in a patient with complete deficiency
of DPD enzyme activity [7]. Several mutations in the dihydropyrimidine dehydrogenase
gene (DPYD), which encodes for the DPD enzyme have recently been identified [6,8].
Furthermore, the frequency of DPD deficiency has been estimated to be as high as 2-3%
[5,9,10]. To date, a direct correlation between DPD gene mutation and decreased 5-FU
clearance has only been suggested but never been proven. In this study, we provide the
first detailed analysis of 5-FU pharmacokinetics in a patient with low DPD-activity due to
heterozygosity for a mutant allele of the gene encoding DPD.
Chapter 4.2
90
Influence of DPD deficiency on 5-fluorouracil pharmacokinetics
91
Methods
Chemicals
5-FU was obtained from Sigma Chemical Co. (Zwijndrecht, the Netherlands). 5,6-dihydro-
5-fluorouracil was kindly provided by Roche Laboratories (Basel, Switzerland). AmpliTaq
Taq polymerase and BigDye-Terminator-Cycle-Sequencing-Ready-Reaction kit were
supplied by Perkin Elmer (San Jose, CA, USA). A Quaquik Gel Extraction kit was obtained
from Qiagen (Hilden, Germany). Human heparinised plasma was obtained from the Red
Cross Blood Bank (Groningen, the Netherlands). [4-14C ]Thymine (1.85-2.22 GBq/mmol) was
obtained from Moravek Biochemicals (CA, USA) and Lymphoprep (spec.gravity 1.077 g/ml,
280 mOsm) was from Nycomed Pharma AS (Oslo, Norway). Leucosep tubes were supplied
by Greiner (Frickenhausen, Germany). All other chemicals were of analytical grade.
Patient and controls
All patients were treated for colorectal cancer and participated in a protocol that had
been designed to study 5-FU and DHFU pharmacokinetics. The protocol was approved
����
���������� ���������
���� �����������������������
���� �����
���� ��������������������� ��������
���� ����
���
Figure 1 Metabolism of 5-FU. 5-Fluoro-2’-deoxyuridine-5’-monophosphate (FdUMP) is the cytotoxic product resulting from a multi-step 5-FU activation route . FdUMP inhibits the enzyme thymidylate synthase (TS), which leads to intracellular accumulation of deoxy-uridine-monophospate (dUTP) and depletion of deoxy-thymidine-monophospate (dTMP). This causes arrest of DNA synthesis. The initial and rate-limiting enzyme in the catabolism of 5-FU is dihydropyrimidine dehydrogenase (DPD), catalys-ing the reduction of 5-FU into 5,6-dihydrofluorouracil (DHFU). Subsequently, DHFU is degraded into fluoro-β-ureidopropionic acid (FUPA) and fluoro-β-alanine (FBAL).
Chapter 4.2
90
Influence of DPD deficiency on 5-fluorouracil pharmacokinetics
91
by the Medical Ethics Review Committee of the Martini Hospital Groningen and written
informed consent was obtained from all patients. All patients who entered this protocol
were chemotherapy naive. Chemotherapy consisted of folinic acid 20 mg/m2 combined
with 5-FU 425 mg/m2 , both on 5 successive days, in a 28-day cycle. Blood sampling was
carried out on the first day of the first chemotherapy cycle immediately following the 5-FU
dose, administered as bolus intravenous injection over 2 min. Folinic acid was infused after
the end of blood sampling. On the following 4 days, the same 5-FU dose was administered
as short time infusion, after folinic acid administration.
One patient experienced severe toxicity during the first chemotherapy cycle and,
therefore, a screening on DPD deficiency was initiated. Data from seventeen patients who
participated in the same study protocol were analysed for reference pharmacokinetics.
Six patients, who showed no signs of severe toxicity, were randomly selected for reference
DPYD genotyping and DPD enzyme activity. These patients served as controls.
Collection of blood samples
For pharmacokinetic sampling, a canule was placed in the arm of the patient contralateral
from drug administration. Blood samples (5 ml) were collected in heparinised tubes just
before, and 2, 5, 10, 20, 30, 45, 60, 80, 100, 120, 150 and 180 min postinjection. Collected
samples were immediately placed on ice and subsequently centrifuged at 2,500 g for 10
min. The plasma samples were analysed for 5-FU and DHFU concentrations by high-per-
formance liquid chromatography (HPLC) on the day of collection.
Blood samples for DPD analysis were collected 5 to 23 months after blood sampling for
5-FU pharmacokinetics, which corresponds to intervals ranging from 2 to 17 months after
the last 5-FU dose. None of the patients received chemotherapy at that moment.
Reversed phase HPLC analysis
5-FU and DHFU concentrations were measured by HPLC analysis using a modification of
the method described by Ackland et al [11]. Briefly, 100 µl chlorouracil internal standard
solution (80 mg/l in water) was added to 1 ml plasma sample, and this mixture was
vortexed and subsequently deproteinated with 50 µl of a 50% (w/v) trichloracetic acid
solution. After centrifugation at 8,000 g for 2 min the supernatant was transferred into a
20 ml centrifuge tube and neutralised with 1 ml 1M sodium acetate solution. Then 5 ml
ethylacetate was added and the mixture was vortexed during 10 min. After separation of
the organic and aqueous layers by centrifugation at 5,000 g for 5 min, the ethylacetate
layer was transferred into a 10 ml tube and evaporated under a stream of nitrogen at 25
°C. The residue was dissolved in 100 µl ultrapure water and 20 µl was injected. 5-FU and
DHFU standards ranging from 0.5 to 20 mg/l were prepared in human plasma.
The chromatographic system consisted of a Waters 616 pump equipped with a Waters
717+ autosampler. The separation of 5-FU and DHFU was accomplished by gradient
elution at ambient temperature on a Phenomenex Prodigy ODS 3 column (I.D. 250x4.6
Chapter 4.2
92
Influence of DPD deficiency on 5-fluorouracil pharmacokinetics
93
mm, 5µm) equipped with a guard column (30x4.6 mm) of the same material. Mobile phase
A consisted of 1.5 mM K3PO
4 and 1% (v/v) methanol (pH=6.0) and mobile phase B of 1.5
mM K3PO
4 and 5% methanol (pH=6.0).
The gradient was programmed as follows: 100% A during 2 min; 100% A → 100% B in 0.5
min; 100% B during 7 min; 100% B → 100% A in 0.5 min; 100% A during 10 min. Detection
was performed using a Waters 996 Photo Diode Array UV detector interfaced with a
Millenium 2010 Chromatography Manager Workstation. Spectra were acquired in the 201-
300 nm range. 5-FU was monitored at 266 nm and DHFU at 205 nm. The internal standard
chlorouracil was monitored at both wavelengths.
Pharmacokinetic analysis
The pharmacokinetic analyses were performed in the ADAPT II computer program (version
4.0; USC Los Angeles). The pharmacokinetic data of both the index patient and seventeen
reference patients (among which the six controls) were tested in 8 different models. In each
model the patient’s data were fitted individually and for each data set the Akaike Information
Criterion (AIC) was calculated. The model with the lowest summarised AIC value was selected
as the better one (data not shown). The model used for calculating 5-FU pharmacokinetics is a
two-compartment model with Michaelis-Menten elimination from the first compartment
and is described by two differential equations:
�� ��� ��� ���
� ��� �� ���������
�
��
��� ��� �
�
�����
��
������� ����
��
����
X1
and X2
indicate the amount of drug in each compartment, respectively. The k-values
represent linear distribution- and elimination rate constants, and the Vmax
and Km
values
represent Michaelis-Menten constants for non-linear elimination from the first compartment.
Rinf
represents the infusion rate of 5-FU.
The area under the curve of 5-FU and DHFU was calculated using the trapezoid rule. The
average systemic clearance of 5-FU was calculated by dividing the administered dose by the
area under the curve (AUC).
Determination of dihydropyrimidine dehydrogenase activity
To investigate whether the 5-FU toxicity might have been caused by a partial deficiency of
DPD, we determined the activity of DPD in peripheral blood mononuclear (PBM) cells.
Therefore PBM cells were isolated from 15 ml EDTA anticoagulated blood and the activity
of DPD was determined according previously decribed methods [12]. In brief, the sample
was incubated in a reaction mixture containing 35mM potassium phosphate pH 7.4, 1mM
dithiothreitol, 2.5mM magnesium chloride, 250µM NADPH and 25 µM [4-14C] thymine.
Chapter 4.2
92
Influence of DPD deficiency on 5-fluorouracil pharmacokinetics
93
After an appropriate incubation time, the reaction catalysed by DPD was terminated by
adding 10 % (v/v) perchloric acid. The reaction mixture was centrifuged at 11,000 g for 5
min to remove protein. The separation of radiolabelled thymine and the reaction products
was performed by reversed phase HPLC. Protein concentrations were determined with a
copper-reduction method using bicinchoninic acid, as decribed by Smith et al. [13].
PCR amplification of coding exons
The DNA from the index and control patients was isolated from PBM cells as previously
described [14]. PCR amplification of exon 14 and flanking intronic regions was carried out
according to Van Kuilenburg et al. [6]. PCR products were separated on 1% agarose gels,
visualised with ethidium bromide and purified using a Qiaquick Gel Extraction kit and
used for direct sequencing.
Sequence analysis
Sequence analysis was carried out on a Applied Biosystems model 377 automated DNA
sequencer using Dye-Terminator method for the DPD cDNA and genomic fragments.
Statistical analysis
Each value, measured in the index patient, was compared to the mean ± 2 SD range of the
corresponding parameter in the control group . Values outside this range were considered
abnormal (p<0.05). We did not match our control patients for age and gender.
Results
Clinical evaluation
Patient characteristics from the index and control patients, as measured before 5-FU ad-
ministration on the first day of the first chemotherapy cycle, are listed in table 1. The index
patient is a 60-year-old white female who received adjuvant chemotherapy for Dukes C
colon carcinoma. She was known with a chronic moderate renal function impairment as
a result of a double sided nephrolithotomy at age 40. The first two injections with a total
dose of 800 mg 5-FU/day were tolerated well by the patient without complications. On the
third day of chemotherapy she experienced nausea and cold shivers. The nausea was suc-
cessfully treated with metoclopramide. The cold shivers remained on days 4 and 5. Twelve
days after administration of the first 5-FU injection, leukopenia (1.5x109 leukocytes/l) and
thrombocytopenia (26x109 platelets/l) developed along with nausea, diarrhoea, stomati-
tis, fever and hair loss. The next day leukocytes and platelets decreased to 0.5x109/l and
12x109/l (both nadir values respectively). During this period the patient developed leuko-
penic fever (40 °C) for which antibiotics were administered. Until day 20 the leucocytes
and platelets remained low (1x109/l and 13x109/l respectively). During the subsequent
Chapter 4.2
94
Influence of DPD deficiency on 5-fluorouracil pharmacokinetics
95
���
�
��
���
� ��� � ��� � ��� � ���
���� ���
����
����
��
����� �������
����� ������� ��������� ����
�������� �����
Figure 2 Pharmacokinetics of 5-FU. Shown are 5-FU plasma levels observed in a patient with a IVS14+1G→A mutation in the DPYD gene ( ) and the 5-FU plasma levels resulting from simulation of a normal renal function in the same patient. 5-FU plasma levels from control patients are depicted as mean ± SD ( ; n=6).
Index patient Controls (n=6)
mean ± 2 SD
Gender M/F F 4/2
Age (yr) 60 64 ± 12
Weight (kg) 73 77 ± 12
Serum creatinine (µmmol/L) 184 § 81 ± 30
Aspartate aminotransferase (U/L) 23 18 ± 8
Alanine aminotransferase (U/L) 41 29 ± 26
LDH (U/L) 379 302 ± 152
Alkaline phosphatase (U/L) 95 72 ± 24
Bilirubin total (µmmol/L) 7 10 ± 6
Albumin (g/L) 32 37 ± 8
§ outside 95% control range, p<0.05
Table 1 Patient Characteristics
Chapter 4.2
94
Influence of DPD deficiency on 5-fluorouracil pharmacokinetics
95
week the clinical picture and hematological parameters gradually improved and normal-
ised. On day 34 the patient was discharged from the hospital.
The toxicity observed in the six control patients was limited to mild nausea (n=4), vomiting
(n=2) and CTC grade 1 stomatitis (n=1).
Pharmacokinetic analysis
The clearance of 5-FU was considerable slower in the index patient than in the six control
patients. In all control patients the plasma level at t=90 min was below 0.1 mg/l, whereas
in the index patient the plasma level was still 3.8 mg/l at this time point (see figure 2).
The AUC in the patient suffering from toxicity was 24.1 mg.h/l compared to 15.3 mg.h/l
as highest AUC value in control patients. We calculated an average systemic clearance of
only 520 ml/min versus 980-1780 ml/min in controls. The Vmax value, calculated by phar-
macokinetic modelling was 548 mg/h, while the Vmax values of control patients ranged
from 984 to 1772 mg/h (see table 2). The pharmacokinetic data of the six control patients
did statistically not differ from data of the reference group. The effect of the impaired
renal function of the index patient on 5-FU clearance was studied by pharmacokinetic
modelling.
The excretion of 5-FU in urine was measured in five patients of the reference group
(including two control patients) and kurine
was estimated 0.5 ± 0.08 h-1. This kurine
value, in-
dividually normalised on calculated GFR, was used during subsequent modelling of other
patient data. A normal renal function was simulated in the index patient by replacing the
GFR related kurine
by kurine
=0.6. Renal function impairment appeared to have only a slight
effect on 5-FU clearance. In the index patient, we estimated an additional 18% increase of
Index patient Index patient
kurine
=0.6
simulated data
Controls
(n=6)
Controls
Kurine
=0
simulated data
Dose (mg/m2) 447 431 ± 64
AUC 5-FU (mg.h/L) 24.1 § 20.4 § 10.0 ± 6.6 § 11.8 ± 8.6 §
Cl 5-FU (mL/min) 553 § 637 § 1493 ± 840 § 1306 ± 886
Vmax (1/h) 548 § 1329 ± 680 §
V1 /kg (L) 0.25 0.23 ± 0.06
K12 (1/h) 9.0 5.1 ± 7.6
K21 (1/h) 7.5 5.2 ± 6.6
§ data of index patient outside 95% control range, p<0.05
Table 2 Overview of pharmacokinetic parameters. Data are presented as single observation or as mean ± 2 SD
Chapter 4.2
96
Influence of DPD deficiency on 5-fluorouracil pharmacokinetics
97
the AUC due to the renal insufficiency upon a 108% higher AUC due to partial DPD defi-
ciency. Simulation of anuria in the control group (Kurine
= 0), revealed a 16 ± 4% increase of
the 5-FU AUC. In the reference group, the estimated increase was 15 ± 5 %.
Activity of DPD in PBM cells
The activity of DPD in PBM cells was lower in the patient experiencing severe toxicity (5.5
nmol/mg/h) compared to the 6 control patients (8.0-11.7 nmol/mg/h; mean 9.6).
Genomic sequence analysis
Sequence analysis of the DPD gene showed that the patient was heterozygous for a G→A
point mutation in the invariant GT splice donor site (IVS14+1G>A), leading to the skipping
of exon 14 directly upstream of the mutated splice donor site during DPD pre-mRNA
splicing. Sequence analysis of the DPD gene of the six control patients revealed no gene
mutations.
Discussion
5-FU remains the major drug in the treatment of advanced colorectal cancer. DPD is the
key metabolic enzyme in 5-FU degradation and since more than 80% of the dose is meta-
bolised by this enzyme, DPD activity is one of the main factors determining drug exposure
[2-5]. It is generally accepted that DPD activity in the liver is responsible for the majority of
5-FU catabolism [15,16], but PBM cells are often used as a surrogate for liver DPD activity,
since these cells are better accessible [2-5]. Several groups have suggested that markedly
diminished DPD activity in PBM cells is strongly related to the risk of developing severe
5-FU toxicity due to reduced 5-FU clearance [4-6]. Although total DPD deficiency is rare in
adults, about 2-3% of the population has a low PBM-DPD enzyme level and, thus, is at risk
to develop severe toxicity when treated with 5-FU [5,9,10]. In only few reports however,
the effect of DPD-deficiency on 5-FU clearance has been objectively quantified. Diasio
et al. administered a test dose of 25 mg/m2 5-FU to a patient with non-detectable DPD-
activity in PBM cells and found a very low 5-FU clearance rate [7]. This patient was probably
homozygous for a mutant DPD allele, although the genetic cause was never elucidated.
Stephan et al. reported severe toxicity in a female patient after treatment comprising
folinic acid 500 mg/m2 as 2 h intravenous infusion plus 125 mg orally followed by 5-FU
2 g/m2 as a 24 h continuous infusion [17]. They found a 5-FU plasma level of 0.3 mg/l on
day 15 after administration, which implies a dramatic overexposure to 5-FU. This patient
could not have been homozygous deficient because the DPD activity in lymphocytes was
within the normal range. The role of PBM-DPD activity as an indicator for 5-FU clearance
is, however, questionable. Lu et al. found a correlation between PBM-DPD activity and
DPD activity measured in the liver [9], but others reported a weak, non-significant rela-
Chapter 4.2
96
Influence of DPD deficiency on 5-fluorouracil pharmacokinetics
97
tionship [10]. Both Harris et al. and Fleming et al. initially reported a correlation between
PBM-DPD activity and 5-FU clearance but re-examination of this relationship in a larger
set of patients revealed a markedly weakened correlation [2,3,5]. These data indicate that
PBM-DPD activity is not a strong and reliable indicator of 5-FU clearance. To some extent,
the variability in DPD activity might have been caused by the composition of the isolated
PBM cells [12]. Another important factor is the timing of cell sampling in relation to 5-FU
administration, since McLeod et al. showed that 5-FU is able to inhibit DPD-activity [18].
In this paper, we report a combined pharmacokinetic and genetic analysis of the DPD
gene and demonstrate that a single G→A point mutation in the invariant splice donor site
IVS14+1 of the DPD gene has profound impact on the clearance of 5-FU. We also found a
lower PBM-DPD activity in the index patient compared to 6 controls. The DPD activity was
comparable to the activity observed in obligate heterozygotes (5.5 ± 2.1 nmol/mg/h, n=8)
in previous work, but the measured value also fits within the range for normal controls
(10.0 ± 3.4 nmol/mg/h, range 3.4-18 nmol/mg/h, n=22) [6]. This might indicate that not
only obligate heterozygotes, but also low normal homozygotes are at risk for developing
severe toxicity when treated with 5-FU. It is however as yet unclear whether the pharma-
cokinetic profile of 5-FU is identical in both groups. Unfortunately, we did not measure
DPD activity and 5-FU pharmacokinetics on the same day. DPD activity was measured at
least two months after completing chemotherapy and might have been changed since
the first chemotherapy cycle as a result of chemotherapy itself or disease state. Although
5-FU has a direct inhibitory effect on DPD activity, as was shown by McLeod et al., we
believe that it is not likely that this effect will continue until two months after the last
dose [18]. Furthermore, it has been shown that DPD activity is lower in (breast-) cancer
patients compared to healthy persons, suggesting an effect of disease state [19]. We tried
to minimise this effect by matching index patient and controls for this variable (all Dukes
C, with no signs of disease progression at time of blood sampling for DPD). Finally, timing
of blood sampling is an important parameter in relation to DPD activity, since the activity
of DPD exhibits a circadian pattern, with lowest activity around 1 p.m. [2]. All our patients
received chemotherapy between 10 a.m. and 3 p.m. and blood samples for DPD analysis
were collected between 11 a.m. and 2 p.m. to minimise the effect of circadian variation.
Thus, unless unfortunate late DPD sample collection, we believe our results to be repre-
sentative for DPD activity during pharmacokinetic sampling.
The structural organization of the DPD gene has recently been described. It is 150 kb
in length and consists of 23 exons ranging in size from 69 to 1404 bp [20]. The G→A
mutation changes an invariant GT splice donor site into AT which leads to skipping of a
165 bp exon immediately upstream of the mutated spice donor site during the splicing of
DPD pre-mRNA. As a consequence, a 165 bp fragment encoding the amino acid residues
581-635 of the primary sequence of the DPD protein is lacking in the mature DPD mRNA,
which results in an enzyme without catalytic activity [14,21]. Analysis of the prevalence of
the various mutations among cancer patients with partial DPD deficiency showed that the
Chapter 4.2
98
Influence of DPD deficiency on 5-fluorouracil pharmacokinetics
99
G→A mutation in the invariant splice donor site is the most common one (43%) [6].
We believe that in our patient the IVS14+1G>A mutation explains the dramatic reduction
in 5-FU clearance compared to controls. This is in line with the observation that at least
80% of the 5-FU dose is catabolised by DPD. Although our patient had a moderately
impaired renal function, we analysed that the effect of renal function on 5-FU clearance is
only limited. This was expected, as only about 10% of the 5-FU dose is excreted in urine.
It is important, however, to realise that in patients with reduced DPD capacity, the con-
tribution of renal excretion to total clearance is relatively increased. As a consequence,
the impact of renal insufficiency on the AUC is larger in DPD deficient than in DPD pro-
ficient patients. Thus, in the index patient, the impaired renal function might have been
contributed to development of more severe toxicity, additionally to that caused by DPD
deficiency.
Development of rapid assays to detect mutations in the DPYD gene makes it possible to
carry out a genetic screening prior to the start of chemotherapy containing 5-FU. However
it is important to identify those mutations that result in a defect DPD protein.
So far, 19 molecular defects in the DPYD gene such as point mutations and deletions due
to exon skipping have been reported, but not all mutations result in a DPD enzyme de-
ficiency [6]. Incomplete correlation between DPD phenotype and genotype is clinically
important and suggests that DPD polymorphisms are likely to be complex [8].
Our results indicate that low DPD activity, due to the inactivation of one DPYD allele
results in a strong reduction in 5-FU clearance, measured on day 1 of chemotherapy. In-
hibition of the yet reduced DPD activity by 5-FU itself during subsequent days may lead
to further reduction of 5-FU clearance and this may further add to the development of
severe toxicity. In order to identify those mutations that result in reduced 5-FU clearance,
monitoring of 5-FU plasma levels using a limited sampling strategy can be helpful in
patient selection. This requires, however, rapid plasma level analysis, because results from
the first 5-FU infusion must be available before the second dose is administered. Unfor-
tunately, no rapid 5-FU (immuno-)assay is available yet, and therefore in most hospitals
therapeutic drug monitoring of 5-FU is probably not feasible.
Alternatively, the use of DPD inhibitors such as eniluracil in combination with a reduced
5-FU dose might eliminate the problem of DPD-related variable clearance of 5-FU. Clinical
trials are in progress to evaluate such combinations as an alternative for standard 5-FU
therapy.
Acknowledgements
We thank Dr. J.H. Proost (Department of Pharmacokinetics and Drug Delivery, University
Groningen) for advice on pharmacokinetic modelling. We thank Roche Basel for providing
dihydrofluorouracil chemical standard.
Chapter 4.2
98
Influence of DPD deficiency on 5-fluorouracil pharmacokinetics
99
References
1. Pinedo HM and Peters GF. Fluorouracil: biochemistry and pharmacology. J Clin Oncol 1988;6:
1653-1664
2. Harris BE, Song R, Soong SJ and Diasio RB. Relationship between dihydropyrimidine dehydroge-
nase activity and plasma 5-fluorouracil levels with evidence for circadian variation of enzyme
activity and plasma drug levels in cancer patients receiving 5-fluorouracil by protracted continu-
ous infusion. Cancer Res 1990;50:197-201
3. Fleming RA, Milano G, Thyss A, Etienne MC, Renee N, Schneider M and Demard F. Correlation be-
tween dihydropyrimidine dehydrogenase activity in peripheral mononuclear cells and systemic
clearance of fluorouracil in cancer patients. Cancer Res 1992;52:2899-2902
4. Lu Z, Zhang R and Diasio RB. Dihydropyrimine dehydrogenase activity in human peripheral
blood mononuclear cells and liver: population characteristics, newly identified patients, and
clinical implication in 5-fluorouracil chemotherapy. Cancer Res 1993;53: 5433-5438
5. Etienne MC, Lagrange JL, Dassonville O, Fleming R, Thyss A, Renee N, Schneider M, Demard F and
Milano G. Population study of dihydropyrimidine dehydrogenase in cancer patients. J Clin Oncol
1994;12: 2248-2253
6. Van Kuilenburg ABP, Haasjes J, Richel DJ, Zoetekouw L, Van Lenthe H, Waterham HR, De Abreu RA,
Maring JG, Vreken P and Van Gennip AH. Clinical implications of dihydropyrimidine dehydroge-
nase (DPD) deficiency in patients with severe 5-fluorouracil associated toxicity. Identification of
new mutations in the DPD gene. Clin Cancer Res 2000;6:4705-4712
7. Diasio RB, Beavers TL and Carpenter JT. Familial deficiency of dihydropyrimine dehydrogenase.
Biochemical basis for familial pyrimidinemia and severe 5-fluorouracil induced toxicity. J Clin
Invest 1988;81:47-51
8. Collie-Duguid ES, Etienne MC, Milano G and McLeod HL. Known variant DPYD alleles do not ex-
plain DPD deficiency in cancer patients. Pharmacogenetics 2000;10:217-223
9. Lu Z, Zhang R and Diasio RB. Population characteristics of hepatic dihydropyrimidine dehydro-
genase activity, a key metabolic enzyme in 5-fluorouracil chemotherapy. Clin Pharmacol Ther
1995;58:512-522
10. Chazal M, Etienne MC, Renee N, Bourgeon A, Richelme H, Milano G Link between dihydropy-
rimidine dehydrogenase activity in peripheral blood mononuclear cells and liver. Clin Cancer Res
1996;2:506-510
11. Ackland SP, Garg MB, Dunstan RH. Simultaneous determination of dihydrofluorouracil and 5-fluo-
rouracil in plasma by high-performance liquid chromatography. Anal Biochem 1997; 246:79-85
12. Van Kuilenburg ABP, Van Lenthe H, Tromp A, Veldman PC, Van Gennip AH. Pitfalls in the diagnosis
of patients with partial dihydropyrimidine dehydrogenase deficiency. Clin Chem 2000:46:9-17.
13. Smith PK, Krohn RI, Hermanson GT, Mallia AK, Gartner FH, Provenzano MD, Fujimoto EK, Goeke NM,
Olson BJ, Klenk DC. Measurement of protein using bicinchoninic acid. Anal Biochem 1985;150:76-
85
14. Van Kuilenburg ABP, Vreken P, Beex LV, Meinsma R, Van Lenthe H, De Abreu RA and Van Gennip
Chapter 4.2
100
AH. Heterozygosity for a point mutation in an invariant splice donor site of dihydropyrimine de-
hydrogenase and severe 5-fluorouracil related toxicity. Eur J Cancer 1997;33:2258-2264
15. Fleming RA, Milano GA, Etienne MC, Renee N, Thyss A, Schneider M, Demard F. No effect of dose,
hepatic function, or nutrional status on 5-FU clearance following continuous (5-day) 5-FU infu-
sion. Br J Cancer 1992;66:668-672
16. Ho DH, Townsend L, Luna M and Bodey GP. Distribution and inhibition of dihydrouracil dehy-
drogenase activities in human tissues using 5-fluorouracil as substrate. Anticancer Res 1986;6:
781-784
17. Stephan F, Etienne MC, Wallays C, Milano G and Clergue F. Depressed hepatic dihydropyrimidine
dehydrogenase activity and fluorouracil related toxicities. Am J Med 1995;99:685-688
18. McLeod HL, Sludden J, Hardy SC, Lock RE, Hawksworth GM and Cassidy J. Autoregulation of 5-
fluorouracil metabolism. Eur J Cancer 1998;34:623-1627
19. Lu Z, Zhang R, Carpenter JT and Diasio RB. Decreased dihydropyrimine dehydrogenase activity in
a population of patients with breast cancer: implication for 5-fluorouracil-based chemotherapy.
Clin Cancer Res 1998;4:325-329
20. Johnson MR, Wang K, Tillmanns S, Albin N and Diasio RB. Structural organization of the human
dihydropyrimidine dehydrogenase gene. Cancer Res 1997;57:1660-1663
21. Wei X, McLeod HL, McMurrough J, Gonzalez FJ and Fernandez-Salguero P. Molecular basis of
the human dihydropyrimidine dehydrogenase deficiency and 5-fluorouracil toxicity. J Clin Invest
1996;98:610-615
Dihydropyrimidine dehydrogenase phenotyping in human volunteers and a DPD deficient patient by assessing uracil pharmacokinetics after an oral uracil test dose. A preliminary report
Jan Gerard Maring1, Barbara N. Theeuwes-Oonk1 , André B.P. van Kuilenburg2, Donald R.A.
Uges3, Elisabeth G.E. de Vries4, Geke A.P. Hospers4
1Department of Pharmacy, Diaconessen Hospital Meppel and Bethesda Hospital
Hoogeveen; 2Department of Clinical Chemistry, Academic Medical Center Amsterdam;
Departments of 3Pharmacy and 4Medical Oncology, University Hospital Groningen, The
Netherlands
Chapter 5
102
DPD phenotyping with an oral uracil test dose
103
Health Prevention. NY City. USA 1995.
Chapter 5
102
DPD phenotyping with an oral uracil test dose
103
Abstract
Aim Objective To develop an oral Uracil Challenge Test for dihydropyrimidine dehydroge-
nase (DPD) phenotyping in patients scheduled to receive 5-fluorouracil (5-FU).
Methods The pharmacokinetics of uracil and its metabolite 5,6-dihydrouracil (DHU) were
studied after oral administration of an uracil challenge dose in 12 human volunteers and
1 patient with DPD deficiency. All subjects ingested 500 mg/m2 uracil as an oral solution
on an empty stomach. Blood sampling was carried out during 4 h after oral intake. Plasma
uracil and DHU levels were quantified by high performance liquid chromatography. DPD
activity in peripheral blood mononuclear (PBM) cells was measured by the conversion rate
of radiolabeled thymine. The DPD deficiency in the patient was proven by DNA sequenc-
ing of the dihydropyrimidine dehydrogenase gene (DPYD).
Results All volunteers (6 male and 6 female, age 27-53) had DPD activities within normal
range (mean ± SD; 7.0 ± 1.3 nmol/mg/h). The DPD activity in the patient (female, age 72)
was reduced (2.1 nmol/mg/h) due to heterozygosity for missense mutation D949V in
exon 22 and I543V polymorphism in exon 13 of the DPYD gene. All subjects had normal
liver and renal function parameters. Uracil plasma concentrations at 1 and 2 h were 17.20
and 6.94 mg/L in the patient and increased (P<0.05) compared to concentrations (mean
± 2SD) of respectively 8.07 ± 4.78 and 1.74 ± 3.16 mg/L in the volunteers. The AUC was
30.77 mg.h/L in the patient and higher compared to mean 15.72 ± 10.08 mg.h/L in the
volunteers.
Conclusions The clearance of uracil was reduced in the DPD deficient patient. Plasma
levels at 1 and 2 h were discriminating between normal and DPD deficient. The oral Uracil
Challenge Test needs to be further investigated in a larger number of previously charac-
terized, DPD deficient patients to determine its use in pre-chemotherapy DPD-phenotyp-
ing for early detection of DPD deficiency.
Introduction
Fluorouracil (5-FU) is widely used in chemotherapeutic regimens for the treatment of
breast-, colorectal- and head and neck cancer. The cytotoxic mechanism of 5-FU is complex,
requiring intracellular bioconversion of 5-FU into cytotoxic nucleotides. The cytotoxicity,
however, is caused by only a small part of the administered 5-FU dose, as the majority
of 5-FU is rapidly metabolized into inactive metabolites [1]. The initial and rate-limiting
enzyme in the catabolism of 5-FU is dihydropyrimidine dehydrogenase (DPD), catalyzing
a reduction of 5-FU into 5,6-dihydrofluorouracil (DHFU). Unfortunately, in patients with
DPD enzyme deficiency, 5-FU chemotherapy is associated with severe, life-threatening
toxicity [2]. A markedly prolonged elimination half-life of 5-FU has been observed in
patients with partial and complete deficiency of DPD enzyme activity [3,4]. The frequency
Chapter 5
104
DPD phenotyping with an oral uracil test dose
105
of DPD deficiency has been estimated to be as high as 1-2% [5,6]. So far, more than 31
mutations in the DPYD gene have been described. The most common mutation is the
IVS14+1G→A splice site mutation, comprising around 40% of all detected mutations in
patients experiencing excessive 5-FU toxicity [7].
Several methods have been proposed for detection of DPD deficiency [7]. High-through-
put DNA sequencing procedures have been developed, but only about 60% of patients
with a deficient phenotype appear to have a molecular basis for their reduced DPD
activity [2, 8-10]. Thus, measuring the DPD activity in pheripheral blood mononuclear cells
is currently considered as “the reference method”, but less suitable for screening of large
sample volumes on a routine basis [7]. Furthermore, the analysis of the uracil/dihydrouracil
ratio in plasma has been suggested as a diagnostic tool, but the sensitivity of this test
remains to be established [11]. Monitoring of 5-FU plasma levels using a limited sampling
strategy may be helpful in early detection of DPD deficiency, but requires rapid analysis
immediately after the first 5-FU administration and is therefore not feasible [4]. Thus, a
cheap, fast, and easy screening method for DPD deficiency is not yet available.
Uracil and 5-FU are chemically almost alike and both substances are substrates for
DPD. Uracil is an endogenous pyrimidine involved in RNA synthesis and, accordingly, an
excellent candidate for DPD phenotyping. Uracil is part of the commercial preparation
UFT®, which contains the 5-FU prodrug tegafur combined with uracil in a molar propor-
tion of 1: 4. Its role in UFT® is to diminish 5-FU catabolism by DPD. To our knowledge a
detailed description of uracil pharmacokinetics has never been published before.
The current preliminary pharmacokinetic study was performed with the aim to develop
an oral Uracil Challenge Test for DPD phenotyping in patients scheduled to receive 5-FU.
The study was performed in human volunteers to assess uracil pharmacokinetics after
oral ingestion. These values were compared to the pharmacokinetic data of uracil in a DPD
deficient patient.
Materials and Methods
Study subjects
Healty human volunteers, aged 18 years and older, and a patient with previously diagnosed
DPD deficiency were asked to participate. Creatinine, ALAT and gamma-GT levels had to
be below 1.5 times the upper limit of normal (ULN), which corresponded to <150 µmol/L
creatinine, < 73 U/L ALT and < 75 U/L gamma GT. Volunteers were not allowed to take any
medication in the week preceding the experiment (an exception was made for oral con-
traceptives). All subjects had to abstain food during the entire experiment. Uracil (purity
>99.9%; Sigma Chemicals Co, Zwijndrecht, The Netherlands) was administered as an oral
solution in a dose of 500 mg/m2 and ingested on an empty stomach (last food intake > 8
h earlier) between 9.00 and 10.00 am. This standardization was introduced to diminish the
Chapter 5
104
DPD phenotyping with an oral uracil test dose
105
influence of circadian fluctuations in DPD activity on uracil pharmacokinetics. The study
was approved by the Medical Ethics Review Boards of the Diaconessen Hospital Meppel
and the University Hospital Groningen and written informed consent was obtained from
all subjects.
Collection of blood samples
For pharmacokinetic sampling, a canule was placed intravenously in one arm of the
subject. Blood samples of 5 mL were collected in EDTA containing tubes just before, and
15, 30, 45, 60, 80, 100, 120, 150, 180, and 220 min after uracil ingestion. Collected samples
were immediately placed on ice and subsequently centrifuged at 2,500 g for 10 min at
4 °C and stored at –20 °C analysis. The plasma samples were analyzed for uracil and DHU
concentrations by high-performance liquid chromatography (HPLC) within 1 week after
sample collection.
Reversed phase HPLC analysis
Uracil and DHU concentrations were measured by HPLC analysis using a modification of
the method described by Ackland et al. [12]. In a plastic Eppendorf microfuge cup 200 µL
of plasma sample was mixed with 100 µL chlorouracil (Sigma Chemical Co, Zwijndrecht,
The Netherlands) solution (80 mg/L) as internal standard. Then 200 µL of acetonitril was
added, followed by vortex mixing. At 11,000 g the samples were centrifuged for 5 min. The
supernatant was transferred into a glass centrifuge tube and 1.5 mL of a 0.1 M phosphate
buffer pH 5.5 was added. After vortex mixing 5 mL ethyl acetate was added and the
samples were mixed for 15 min in a rotary mixer. The samples were then centrifuged at
3,000 g for 5 min. The organic upper layer was transferred into a conical tube and evapo-
rated to dryness under a gentle stream of nitrogen at ambient temperature. The samples
were reconstituted in 100 µL mobile phase and transferred into a glass insert for auto-
sampler vials. 50 µL of sample was injected into the chromatographic system. Calibration
samples were prepared by spiking human heparinized plasma (Red Cross Blood Bank,
Groningen, the Netherlands) with appropriate amounts of
uracil and 5,6-dihydrouracil (Sigma Chemical Co, Zwijndrecht, the Netherlands).
The chromatographic system consisted of a Waters 616 pump equipped with a Waters
717+ autosampler. The separations were performed on an Atlantis dC18 (5 µm, 4.6 x 250
mm) column (Waters, Etten-Leur, the Netherlands), equipped with a Phenomenex C18
(5 µm, 4.0 x 3.0 mm) Security Guard column (Bester, Amstelveen, The Netherlands). The
column was used at ambient temperature. The mobile phase consisted of 990 mL 1.5 mM
phosphate buffer (pH 5.8) mixed with 10 mL of methanol. The flow during the analysis
was 0.8 mL/min. Drug detection was performed using a Waters 996 Photo Diode Array
UV detector interfaced with a Millenium 2010 Chromatography Manager Workstation.
Spectra were acquired in the 201-300 nm range. Uracil was monitored at 266 nm and DHU
at 205 nm. The internal standard chlorouracil was monitored at both wavelengths. The
Chapter 5
106
DPD phenotyping with an oral uracil test dose
107
limit of quantification in plasma was 0.04 mg/L for both uracil and DHU.
Pharmacokinetic analysis
The pharmacokinetic analyses were performed in both the MW\Pharm (version 3.5, Mediware,
Groningen, The Netherlands) and ADAPT II (version 4.0; University of Southern California, Los
Angeles, CA) packages. Variance for the observations was assumed to be proportional to the
measured values and set at 10%. The area under the curve (AUC 0→220min
) of uracil and DHU
were calculated using the trapezoidal rule. The terminal elimination half-life of DHU was
determined by non-compartimental analysis in MW\Pharm.
Determination of dihydropyrimidine dehydrogenase activity
The activity of DPD was determined in peripheral blood mononuclear (PBM) cells.
PBM cells were isolated from 15 mL EDTA anticoagulated blood and the activity of DPD
was determined according previously described methods [13]. In brief, the sample was
incubated in a reaction mixture containing 35 mM potassium phosphate pH 7.4, 1 mM di-
thiothreitol, 2.5 mM magnesium chloride, 250 µM NADPH and 25 µM [4-14C] thymine. After
an appropriate incubation time, the reaction catalyzed by DPD was terminated by adding
10 % (v/v) perchloric acid. The reaction mixture was centrifuged at 11,000 g for 5 min to
remove protein. The separation of radiolabeled thymine and the reaction products was
performed by reversed phase HPLC.
Statistical analysis
Subject data were analyzed for descriptive statistics in the SYSTAT 7.0 statistical program
(SPSS inc. 1997). Each value, measured in the DPD deficient patient, was compared to the
mean ± 2 S.D. range of the corresponding parameters in the volunteers control group.
Values outside this range, which comprises 95% of all individuals in a normal distribution,
were considered abnormal (p<0.05).
Results
Patients
Between March 2003 and February 2004, 12 volunteers and 1 DPD deficient patient were
included. All volunteers (6 male and 6 female, age 27-53) had DPD activities within normal
range (mean±SD; 7.0±1.3 nmol/mg/h). The DPD activity in the patient (female, age 72) was
reduced (2.1 nmol/mg/h) due to heterozygosity for missense mutation D949V in exon 22
and I543V polymorphism in exon 13 of the DPYD gene. All subjects had normal liver and
renal function parameters. An overview of patient and volunteers characteristics is repre-
sented in table 1.
Chapter 5
106
DPD phenotyping with an oral uracil test dose
107
Pharmacokinetics
The mean pharmacokinetic curves of uracil and DHU are represented in figure 1. The
model, used for calculating uracil and DHU pharmacokinetics was similar to the model that
was previously described for 5-FU pharmacokinetics [14]. A three compartiment model was
applied with absorption from a peripheral (gut) compartiment after bolus administration and
subsequent distribution over a central and deep peripheral compartiment. Michaelis-Menten
elimination was modelled from the central compartiment. The calculated model parameters
Volunteers (n=12) Patient
Age 39 ± 9 72
Sex (male/female) 6/6 female
Weight (kg) 74 ± 10 77
Height (cm) 178 ± 9 170
Body surface area (m2) 1.91 ± 0.16 1.88
PBMC DPD (nmol/mg/h) 7.0 ± 1.3 2.1
Serum-creatinine (µmol/L) 82 ± 12 106
Serum-ALT (U/L) 20 ± 8 23
Serum-gamma-GT (U/L) 16 ± 6 21
Values are depicted as mean ± SD
Tabel 1 Characteristics of human volunteers and the DPD deficient patient, participating in the study.
Figure 1 Mean (± s.d) concentration-time profiles of uracil and DHU in human volunteers (n=12) and the individual concentration-time curves of uracil and DHU in a patient with DPD deficiency after oral intake of 500 mg/m2 uracil solution.
�
�
�
�
�
��
��
��
��
��
��
� �� ��� ��� ��� ���
���� �����
����
�����
����
����
��
���������� ������
���������� ���
������� ������
������� ���
Chapter 5
108
DPD phenotyping with an oral uracil test dose
109
are listed in table 2. The interindividual variation in uracil clearance was considerable,
resulting in uracil AUCs ranging from the lowest to the highest value over a factor 4.
However, despite this variation, the uracil AUC of the DPD deficient patient was still larger
than the mean plus two times the standard deviation AUC value of the reference popula-
tion.
Discussion
This preliminary study shows that low DPD activity, due to a mutation in the DPYD gene,
results in an increased uracil plasma AUC after oral intake of uracil. Current data suggest
that further development of a Uracil Challenge Test is at least warranted. We applied an
uracil dose of 500 mg/m2. Enzyme saturation is a prerequisite for adequate discrimina-
tion between normal and deficient subjects. A comparable dose of 672 mg/m2 uracil is
employed for DPD enzyme saturation in the commercial preparation UFT (in combination
with 300 mg/m2 of the 5-FU analogue tegafur) for treatment of colorectal cancer [15]. Our
uracil dose is also in the range of commonly applied 5-FU bolus doses of 400-600 mg/m2
in the treatment of colorectal and breast cancer [16-19].
The uracil pharmacokinetics was described in a three compartiment Michaelis-Menten
model. Michaelis-Menten pharmacokinetics is characterized by first-order elimination at
low substrate concentrations, and gradually transforms into zero-order elimination when
substrate concentrations rise above levels causing enzyme saturation. This pattern is
distinct in the concentration-time plasma curve of the DPD deficient patient compared to
the mean curve of the volunteers in figure 1. During the first 2 h, the uracil plasma levels
in the DPD deficient patient rise above 2 SD from the mean in volunteers, due to reduced
elimination. After 2 h, plasma levels appear to drop below the enzyme saturation level,
since the terminal elimination half-lifes are almost equal in both groups. As a result, uracil
Volunteers (n=12) Patient
C uracil t=1 h
(mg/L) 8.07 ± 4.78 17.20#
C uracil t=2 h
(mg/L) 1.74 ± 3.16 6.94#
Ratio C uracil/DHU t=1 h
4.44 ± 5.98 8.56
Ratio C uracil/DHU t=2 h
0.69 ± 1.56 2.31#
AUC uracil 0→220 min
(mg.h/L) 15.72 ± 10.08 30.77#
Vmax
(1/h) 815 ± 370 472
T1/2 elimination
(h) 0.42 ± 0.32 0.50
The values are depicted as mean ± 2. SD # outside 95% confidence interval, P<0.05
Table 2. Pharmacokinetic parameters of uracil and DHU in volunteers and the DPD deficient patient.
Chapter 5
108
DPD phenotyping with an oral uracil test dose
109
plasma levels at 1 and 2 h are most discriminating between normal and deficient, whereas
later levels are not. Fortunately, early discriminating time points favor the applicability of
a Uracil Challenge Test in clinical practice.
Based on the pharmacokinetic parameters, derived from the Michaelis-Menten model, we
also analyzed whether the sensitivity of the test should improve when higher uracil doses
are administered. Simulations showed that a higher uracil dose might indeed increase
the sensitivity, however also results in a prolonged absorption phase and therefore indi-
rectly leads to a shift in optimal sampling times to later moments. Recently, Mattisson et
al. developed a simple, uracil breath test for DPD phenotyping, based on the release of 13CO
2 from 2-13C uracil in the presence of intact DPD [20]. Expired air was collected 5-90
min after oral ingestion of 6 mg/kg 2-13C uracil. Partially deficient DPD breath profiles were
well differentiated from normal profiles. This approach is very interesting. Unfortunately
2-13C uracil is a very expensive compound, making costs a major drawback for routine
implementation of this test. The price of commercially available 2-13C uracil is about 1 US$
per mg, which implies that a routine test in a 70 kg adult costs at least 420 US$. Addition-
ally, IR spectroscopic breath analyzers are not generally available in most hospitals. The
analysis of a single plasma sample by HPLC after ingestion of normal uracil may be more
cost-efficient, as the price of 1000 mg uracil is only about 1US$. HPLC equipment is also
quite common in most hospitals for therapeutic drug monitoring purposes.
The reduced DPD activity in the patient appeared to be due to heterozygosity for missense
mutation D949V in exon 22 and I543V polymorphism in exon 13 of the DPYD gene. Both
mutations have been observed previously in partially DPD deficient patients and were
both related to increased 5-FU toxicity [2,7,21].
The current method has to be tested in a larger panel of DPD deficient patients, including
deficiencies due to different kinds of gene mutations, to establish the predictive value of
our test.
We conclude that preliminary results of the oral Uracil Challenge Test are very interesting,
but that more research is needed to establish the full potential of this cheap and easy
test.
Chapter 5
110
DPD phenotyping with an oral uracil test dose
111
References
1. Pinedo HM, Peters GFJ. Fluorouracil: biochemistry and pharmacology. J Clin Oncol 1988;6:1653-
1664.
2. Van Kuilenburg AB, Haasjes J, Richel DJ, Zoetekouw L, Van Lenthe H, Waterham HR, et al. Clinical
implications of dihydropyrimidine dehydrogenase (DPD) deficiency in patients with severe 5-
fluorouracil-associated toxicity: identification of new mutations in the DPD gene. Clin Cancer Res
2000;6:4705-4712
3. Diasio RB, Beavers TL, Carpenter JT. Familial deficiency of dihydropyrimidine dehydrogenase. Bio-
chemical basis for familial pyrimidinemia and severe 5-fluorouracil-induced toxicity. J Clin Invest
1988;81:47-51
4. Maring JG, van Kuilenburg ABP, Haasjes J, Piersma H, Groen HJM, Uges DRA, et al. Reduced 5-FU
clearance in a patient with low DPD activity due to heterozygosity for a mutant allele of the
DPYD gene. Br J Cancer 2002;86:1028-103
5. Lu Z, Zhang R, Diasio RB. Dihydropyrimidine dehydrogenase activity in human peripheral blood
mononuclear cells and liver: population characteristics, newly identified deficient patients, and
clinical implication in 5-fluorouracil chemotherapy. Cancer Res 1993;53:5433-5438
6. Etienne MC, Lagrange JL, Dassonville O, Fleming R, Thyss A, Renee N, et al. Population study of
dihydropyrimidine dehydrogenase in cancer patients. J Clin Oncol 1994;12:2248-53
7. Van Kuilenburg ABP. Dihydropyrimidine dehydrogenase and the efficacy and toxicity of 5-fluoro-
uracil. Eur J Cancer 2004;40:939-950
8. Ezzeldin H, Okamoto Y, Johnson MR, Diasio RB. A high-throughput denaturing high-performance
liquid chromatography method for the identification of variant alleles associated with dihydro-
pyrimidine dehydrogenase deficiency. Anal Biochem 2002;306:63-73
9. Fisscher J, Schwab M, Eichelbaum M, Zanger UM. Mutational analysis of the human dihydropy-
rimidine dehydrogenase gene by denaturing high-performance liquid chromatography. Genet
Test 2003;7:97-105
10. Gross E, Seck K, Neubauer S, et al. High throughput genotyping by DHPLC of the dihydropyrimi-
dine dehydrogenase gene implicated in (fluoro)pyrimidine catabolism. Int J Oncol 2003;22:325-
33
11. Gamelin E, Boisdron-Celle M, Guerin-Meyer V, et al. Correlation between uracil and dihydrouracil
plasma ratio, fluorouracil (5-FU) pharmacokinetic parameters, and tolerance in patients with ad-
vanced colorectal cancer: a potential interest for predicting 5-FU toxicity and determining the
optimal 5-FU dosage. J Clin Oncol 1999;17:1105-1110
12. Ackland SP, Garg MB, Dunstan RH. Simultaneous determination of dihydrofluorouracil and 5-
fluorouracil in plasma by high-performance liquid chromatography. Anal Biochem 1997;246:
79-85
13. Van Kuilenburg APB, Van Lenthe H, Tromp A, Veldman PC, Van Gennip AH. Pitfalls in the diagnosis
of patients with partial dihydropyrimidine dehydrogenase deficiency. Clin Chem 2000;46:9-17
14. Maring JG, Piersma H, Van Dalen A, Groen HJM, Uges DRA, De Vries EGE. Extensive hepatic re-
Chapter 5
110
DPD phenotyping with an oral uracil test dose
111
placement due to liver metastases has no effect on 5-flourouracil pharmacokinetics. Cancer
Chemother Pharmacol 2003;51:167-173
15. Hoff PM, Pazdur R. UFT plus oral leucovorin: a new oral treatment for colorectal cancer. Oncologist
1998;3:155-164
16. O’Connell MJ. A phase III trial of 5-fluorouracil and leucovorin in the treatment of advanced
colorectal cancer. A Mayo Clinic/North Central Cancer Treatment Group study. Cancer 1989;63:
1026-1030
17. Rothenberg ML, Oza AM, Bigelow RH, Berlin JD, Marshall JL, Ramanathan RK, et al. Superiority of
oxaliplatin and fluorouracil-leucovorin compared with either therapy alone in patients with pro-
gressive colorectal cancer after irinotecan and fluorouracil-leucovorin: interim results of a phase
III trial. J Clin Oncol 2003;21:2059-2069
18. Stewart DJ, Evans WK, Shepard FA, Wilson KS, Pritchard KI, Trudeau MF, et al. Cyclophosphamide
and fluorouracil combined with mitoxantrone versus doxorubicin for breast cancer:superiority
of doxorubicin. J Clin Oncol 1997;15:1897-1905
19. Amadori D, Nanni O, Marangolo M, Pacini P, Ravaioli A, Rossi A, et al. Disease-free survival advan-
tage of adjuvant cyclophosphamide, methotrexate, and fluorouracil in patients with node-nega-
tive, rapidly proliferating breast cancer: a randomized multicenter study. J Clin Oncol 2000;18:
3125-3134
20. Mattison LK, Ezzeldin H, Carpenter M, Modak A, Johnson MR, Diasio RB. Rapid identification of
dihydropyrimidine dehydrogenase deficiency by using a novel 2-13C-uracil breath test. Clin
Cancer Res 2004;10:2652-2658
21. Van Kuilenburg AB, De Abreu RA, van Gennip AH. Pharmacogenetic and clinical aspects of dihy-
dropyrimidine dehydrogenase deficiency. Ann Clin Biochem 2003;40:41-45
Focus on gemcitabine
Selective targeting of homologous DNA recombi-nation repair by Gemcitabine.
Floris M. Wachters1, John W.G. van Putten1, Jan Gerard Maring2, Malgorzata Z. Zdzienicka3,
Harry J.M. Groen1, Harm H. Kampinga4
1Department of Pulmonary Diseases, University Hospital Groningen; 2Department of
Pharmacy, Diaconessenhuis Meppel and Bethesda Hospital Hoogeveen; 3Department
of Toxicogenetics, Leiden University Medical Center and Ludwik Rydygier University of
Medical Sciences, Bydgoszcz, Poland, 4Department of Radiation and Stress Cell Biology,
University of Groningen, The Netherlands
Int J Radiat Oncol Biol Phys 2003;57:553-562
Chapter 6
116
Selective targeting of HR-DNA repair by gemcitabine
117
Radiation Imaging. Westerbork. The Netherlands 1996.
Chapter 6
116
Selective targeting of HR-DNA repair by gemcitabine
117
Abstract
Aim Gemcitabine (2’,2’-difluoro-2’-deoxycytidine, dFdC) is a potent radiosensitizer. The
mechanism of dFdC-mediated radiosensitization is yet poorly understood. We recently
excluded inhibition of DNA double-strand break (DSB) repair by nonhomologous end-
joining (NHEJ) as a means of radiosensitization. In the current study, we addressed the
possibility that dFdC might affect homologous recombination (HR)-mediated DSB repair
or base excision repair (BER).
Methods dFdC-mediated radiosensitization in cell lines deficient in BER and in HR was
compared to that in their BER-proficient and HR-proficient parental counterparts. Sensiti-
zation to mitomycine C (MMC) was also investigated in cell lines deficient and proficient in
HR. Additionally, the effect of dFdC on Rad51 foci formation after irradiation was studied.
Results dFdC did induce radiosensitization in BER-deficient cells; however, the respective
mutant cells deficient in HR did not show dFdC-mediated radiosensitization. In HR-pro-
ficient, but not in HR-deficient cells dFdC also induced substantial enhancement of the
cytotoxic effect of MMC. Finally, we found that dFdC interferes with Rad51 foci formation
after irradiation.
Conclusion dFdC causes radiosensitization by specific interference with HR.
Introduction
Gemcitabine (2’,2’-difluoro-2’-deoxycytidine, dFdC) is a deoxycytidine analogue with anti-
tumor activity in different tumor types. It is also one of the more effective drugs to sensitize
cells to radiation, an effect that has been demonstrated in vitro under non-cytotoxic
conditions for human tumor cell lines [1, 2] and in vivo in tumor-bearing mice [3, 4]. The
interaction of dFdC and radiation has not been elucidated yet. It has been shown that
dFdC enhances radiation-induced chromosomal aberrations [5], which suggests that it
interferes with the repair of radiation-induced DNA damage, particularly the repair of DNA
double-strand breaks (DSBs). Nonhomologous end-joining (NHEJ) is the most prominent
cellular DNA repair pathway of radiation-induced DNA DSBs in mammals [6]. In recent
experiments, however we have shown that the NHEJ pathway is not the target for dFdC-
mediated radiosensitization because a radiosensitizing effect of dFdC is also observed in
cells lacking the functional parts of the NHEJ pathway e.g., the DNA-dependent protein
kinase catalytic subunit (DNA-PKcs) or Ku80 [7]. It has been suggested that a decline in
deoxyadenosine triphosphate is crucial in the induction of radiosensitization by dFdC [1,
8]. If correct, this would be consistent with the noninvolvement of a short-patch repair
pathway like NHEJ. Rather long-patch repair pathways such as nucleotide excision repair
or homologous recombination (HR) may be involved in dFdC-induced radiosensitization.
Indeed, data suggest that dFdC can interfere with nucleotide excision repair [9]. However,
Chapter 6
118
Selective targeting of HR-DNA repair by gemcitabine
119
because nucleotide excision repair plays no (major) role in the repair of ionizing radiation-
induced DNA damage, the most likely pathway remaining as a target for dFdC-mediated
radiosensitization would be HR.
However, whereas HR plays a major role in DNA DSB repair in yeast, its role in higher eu-
karyotes is less clear. The irs1 and irs1SF hamster cell lines deficient in HR due to mutations
in respectively the Rad51 homologues XRCC2 (X-ray repair cross complementing group
2) and XRCC3 show increased radiosensitivity [10-18]. Also in Drosophila melanogaster,
HR-deficiency (Rad54 homolog DmRad54) leads to increased radiosensitivity. In a HR
and NHEJ double mutant (DmRad54 and DmKu70) a strong synergistic increase in radio-
sensitivity is observed compared to both single mutants [19]. Adult mice deficient in HR,
however, do not show hypersensitivity to ionizing radiation, and the impact of HR-defi-
ciency only becomes apparent in a NHEJ-deficient background [20, 21]. Radiosensitivity
testing of embryonic stem cells from HR-deficient mice reveals moderate sensitivity [21].
So, although NHEJ may be the dominant pathway to repair radiation-induced DSB in
higher eukaryotes, HR does play a role under certain conditions.
From these data, a picture emerges that HR plays only a minor role in the repair of DSBs
in maturated, differentiated cells. In undifferentiated cells or cells in culture, however, HR
may contribute to DSB repair and hence to cellular radiosensitivity and herein it could be a
target for dFdC-mediated radiosensitization. An alternative target could be base excision
repair (BER). This repair pathway is also crucial for the repair of DNA damage induced by
ionizing radiation [22, 23] and BER-mutants like the XRCC1 mutant Chinese hamster ovary
cell line EM-C11 show an increased sensitivity to radiation and mitomycin C (MMC) [24,
25]. However, BER is thought to be a short patch repair pathway and can be expected to
be insensitive to a dFdC-mediated drop in nucleotide level. Hence, it seems an unlikely
target for dFdC-mediated radiosensitization; however, this has not been established ex-
perimentally.
In the current study, we therefore tested the possibility that dFdC-mediated radiosensi-
tization may be due to interference of dFdC with the BER or HR pathway, using BER- and
HR-deficient cell lines and assessment of radiation-induced Rad51 foci formation.
Methods and Materials
Cell culturing procedures
The rodent cell lines were grown as monolayers at 5% CO2 in a humidified 37 °C incubator
in plastic flasks (Nunc, Roskilde, Denmark). The Chinese hamster cell lines CHO-9 (parental
cell line of EM-C11), AA8 (parental cell line of irs1SF), irs1 (XRCC2-deficient mutant) and
irs1SF (XRCC3-deficient mutant) were grown on Ham’s F12 medium (Gibco, Paisley, UK).
The EM-C11 cell line (XRCC1-deficient mutant) was grown on Ham’s F10 medium (Gibco,
Paisley, UK). The V79 cell line (parental cell line of irs1) was maintained in Dulbecco’s modi-
Chapter 6
118
Selective targeting of HR-DNA repair by gemcitabine
119
fication of Eagle’s medium (Gibco, Paisley, UK). All media were supplemented with 10%
bovine calf serum (Gibco, Paisley, UK). Media of CHO-9, EM-C11, AA8, irs1 and irs1SF cells
were also supplemented with penicillin and streptomycin. All our standard laboratory
chemicals were purchased from Sigma (St Louis, MO) or Merck (Darmstadt, Germany).
Treatment of cells
Exponentially growing cells were incubated with 0.5 and 5 µM Gemcitabine (dFdC; Eli
Lilly, Nieuwegein, the Netherlands) for 4 h. We choose such short incubation time to avoid
major effects on cell cycle distributions. By DNA flow cytometric analysis we previously
found no significant alterations in cell cycle distribution of CHO-K1 and xrs5+huKu80
cells after 4 h incubation with dFdC [7]. Shewach and Lawrence found that the effect of
gemcitabine on the viability of HT-29 cell was highly dependent on the length of incuba-
tion [8]. Minimizing the cytotoxic effect of dFdC was another argument for choosing a
short incubation period. After dFdC-treatment cells were trypsinized, and diluted in fresh
complete medium to a density of 106 cells/mL. Cells were irradiated, using a 137Cs γ-ray
machine (IBL 637; CIS Biointernational, Gif-sur-Yvette, France) at a dose rate of 0.9 Gy/min.
The dosimetry was performed with an ionization chamber (Philips 37489/19; Eindhoven,
the Netherlands) calibrated with a 90Sr source (Philips 2011/00).
For experiments with dFdC and mitomycin C (MMC; Christiaens, Breda, the Netherlands)
cells were first incubated with 5 µM dFdC for 4 h. After centrifugation of the medium (5
min, 1000 rpm) the cell pellet was added to the cell culture flask. Thereafter cells were
incubated with MMC in different concentrations for 1 h. Cells were subsequently tryp-
sinized and the removed medium was centrifuged (5 min, 1000 rpm). The remaining cell
pellet was added to the trypsinized cells. Cell suspensions were diluted in fresh complete
medium to a density of 106 cells/mL.
To study the effects of hyperthermia, growing cells were trypsinized and diluted with
fresh complete medium to a density of 106 cells/mL. Thereafter cells were exposed to
hyperthermia (43 oC) in precision waterbaths (± 0.1°C) for 30 min immediately followed
by irradiation.
Cell survival
Cell survival was assessed with clonogenic assay by plating 100 µl of an appropriately
diluted sample to triplicate plastic Petri dishes (Nunc, Roskilde, Denmark), containing 5 mL
of growth medium. After 6-8 days of incubation, colonies (containing >50 cells) were fixed
with 70% ethanol and stained with 0.5% crystal violet.
dFdCTP determination by high-performance liquid chromatography (HPLC). For determi-
nation of 2’,2’-difluoro-2’-deoxycytidine triphosphate (dFdCTP) concentrations, exponen-
tially growing cells were incubated with 5 µM dFdC for 4 h. After trypsinization cells were
twice washed with phosphate-buffered saline (PBS; Gibco, Paisley, UK), centrifuged and
Chapter 6
120
Selective targeting of HR-DNA repair by gemcitabine
121
resuspended in 100 µl water, 50 µl of 50% trichloroacetic acid, and 50 µl of 1 µM internal
standard solution of inosine-5’-triphosphate. Cells were chilled on ice for 20 min and cen-
trifuged for 3 min at 10,000 g and 500 µl of freshly prepared trioctylamine and 1,1,2-trichlo-
rotrifluoroethane (1:4) was added. After centrifugation for 2 min at 10,000 g, the cellular
dFdCTP concentrations in the supernatant were determined by anion-exchange HPLC
analysis (Waters, Milford, MA) using a Partisphere SAX anion exchange column (internal
diameter 125 x 4.6 mm, particle size 5 µm; Whatman, Maidstone, UK). A linear gradient was
running from 100% buffer A (5 mM NH4H
2PO
4, pH 2.80) to 100% buffer B (0.5 M NH
4H
2PO
4
and 0.25 M KCl, pH 3.00) in 40 min with a flow of 2 mL/min. Re-equilibration to 100%
buffer A was achieved in 20 min. Calibration was performed with 2-20 µM dFdCTP (Eli Lilly,
Nieuwegein, the Netherlands). Detection was performed using a model 996 photograph-
diode array detector (Waters, Milford, MA) at 266 nm. Cellular dFdCTP concentrations were
calculated using the ratio peak-area dFdCTP versus peak-area internal standard.
Rad51 foci formation
Cells grown on coverslips were incubated with 5 µM dFdC for 4 h at 37 oC. To induce DNA
DSBs, cells were exposed to a dose of 10 Gy. Because Raderschall et al. found a dose-
dependent relation of Rad51 foci formation between 0.5 – 10 Gy [26], we used 10 Gy to
induce Rad51 foci in a high percentage of cells. At different time intervals after irradiation
cells were fixed using 3.7% formaldehyde solution and washed with 0.2% Triton-X100,
glycine-PBS (50 mM glycine in PBS) and PBG (0.5% bovine serum albumin and 0.1%
glycine in PBS). Subsequently, cells were incubated with a rabbit polyclonal antibody
against Rad51 (H-92; Santa Cruz Biotechnology) at a concentration of 4 µg/mL for 2 h
and with fluorescein isothiocyanate (FITC)-conjugated swine anti-rabbit immunoglobu-
lins (Dako, Glostrup, Denmark) at a concentration of 24 µg/mL for 1 h. After washing with
0.1% Tween-20 and incubation with 2 µg/mL 4’,6-diamidino-2-phenylindole (DAPI) for 10
min, samples were analyzed with a laser scanning confocal microscope (Leica microsys-
tems, Rijswijk, the Netherlands). For analysis, 6 to 10 slices made through cell nuclei were
compressed into one overlay projection. When two or more foci were observed, cells were
scored as positive.
Results
Radiosensitization by dFdC in cells proficient and deficient in BER
The XRCC1 mutant EM-C11 is partially defective in the ligation step of BER [25]. Consis-
tent with other experiments [24] we found this cell line to be hyperradiosensitive (Fig
1A). Like its parental CHO-9 cell line, also the EM-C11 cells could be clearly radiosensitized
when pretreated with dFdC (Fig. 1, C and D). However, it should be mentioned that the
magnitude of the enhancement was somewhat less in the EM-C11 cells compared to the
Chapter 6
120
Selective targeting of HR-DNA repair by gemcitabine
121
CHO-9 cells. This may be explained, though, by the fact that the EM-C11 cells also appeared
less sensitive to the direct toxic action of dFdC (figure 1B). In any case, our data suggest
that full BER-proficiency is not a prerequisite for radiosensitization by dFdC.
���
�
��
���
� � � �
����
����
���
��������� ���� ����
���
�
��
���
� � � �
����
����
���
�����������
�����������
�����
������������ ������� ������
�
�
�
�
��������� ���� ����
�����������������
����������������������
������������ ������� ������
������������ �� ����� �� ����
�����
���
�
��
���
� � � �
����
����
���
���� ����
���
�
��
���
� � � �
����
����
���
��������� ���� ����
������������ ������� ������
������������ ������� ������
������������ �� ����� �� ����
������
Figure 1 Comparison of the effect of dFdC on radiosensitivity of the parental CHO-9 cell line and the BER-deficient cell line EM-C11. Cells (106/mL) were exposed to radiation with or without a 4-h preincubation with either 0.5 or 5 µM dFdC. Cell survival was assessed with clonogenic assay. Each point represents mean and standard error of three experiments. A Comparison of radiosensitivity of the parental CHO-9 ( ) cell line, and the EM-C11 ( ) cell line (mutated for the XRCC1 gene and therefore deficient in BER). B Cytotoxic effect of 0.5 and 5 µM dFdC on the CHO-9 ( ) and EM-C11 ( ) cell lines. C, D Effect of preincubation without ( ) or with either 0.5 ( ) or 5 µM ( ) dFdC on radiosensitivity of the BER-proficient CHO-9 C cell line or on the BER-deficient EM-C11 D cell line.
Chapter 6
122
Selective targeting of HR-DNA repair by gemcitabine
123
� �
��
� �
���
������������ ������� ������
������������ ������� ������
������������ ������� ������
����
������������ ������� ������
������������ ������� ������
������������ ������� ������
������
����������������
����������������
����������������
���� ����
����������������
����������������
����������������
������������ ������� ������
������������ ������� ������
������������ ������� ������
������������ ������� ������
������������ ������� ������
������������ ������� ������
������������ ������� ������
������������ ������� ������
������������ ������� ������
���
���
�
��
���
� � � �
����
����
���
��������� ���� ����
���
�
��
���
� � � �
����
����
���
���
�
��
���
� � � �
����
����
���
��������� ���� ����
���
�
��
���
� � � �
����
����
���
��������� ���� ����
���
�
��
���
� � � �
����
����
���
��������� ���� ����
���
�
��
���
� � � �
����
����
���
��������� ���� ����
Figure 2 see next page for legenda
Chapter 6
122
Selective targeting of HR-DNA repair by gemcitabine
123
Radiosensitization by dFdC in cells proficient and deficient in HR
Irs1 and irs1SF cell lines are mutated for, respectively, the Rad51 homologues XRCC2
and XRCC3 and therefore deficient in HR, which explains their increased radiosensitivity
compared to the wild-type parental cell lines V79 and AA8 [11-18] (Fig. 2A). The cytotoxic
effect of dFdC (no irradiation) was similar in all cell lines (Fig. 2B). However, whereas V79
and AA8 cells showed clear-cut radiosensitization when pretreated with 0.5 or 5 µM dFdC
for 4 h (Figs. 2C and 2E), dFdC cause no radiosensitization in either HR-deficient cell line
(Figs. 2D and 2F). To exclude the possibility that the HR-deficient cell lines were affected
in metabolizing dFdC, cellular levels of dFdCTP, the major intracellular metabolite of
dFdC [27], were determined. HR-proficient (V79 and AA8) as well as HR-deficient (irs1
and irs1SF) cell lines were both able to phosphorylate dFdC to dFdCTP (Table 1). Only
irs1 showed a decreased dFdCTP level compared to the other three cell lines tested. Still,
a substantial amount of dFdCTP was found in irs1, yet dFdC-mediated radiosensitization
was completely absent in these cells. Moreover, dFdCTP concentrations in irs1SF cells
were comparable with dFdCTP concentrations in HR-proficient cell lines, and also in this
cell line no radiosensitization was observed. Therefore, defects in drug accumulation and
metabolism are not expected to be responsible for the absence of radiosensitization by
dFdC in HR-deficient cells. In fact, the absence of dFdC-mediated radiosensitization in two
independent HR-deficient cell lines clearly shows that HR may exert its radiosensitizing
effect through interference with the process of HR.
Figure 2 (opposite page) Effect of dFdC on radiosensitivity of the parental V79 and AA8 cell lines and their HR-deficient counterparts (irs1 and irs1SF). Cells (106/mL) were exposed to radiation with or with-out a 4-h preincubation with either 0.5 or 5 µM dFdC. Cell survival was assessed with clonogenic assay. Each point represents mean and standard error of four experiments. A Comparison of radiosensitivity of the V79 ( ) and AA8 ( ) cell lines, and the irs1 ( ) and irs1SF ( ) cell lines (respectively mutated for the XRCC2 and XRCC3 genes and therefore deficient in HR). B Plotted are the cytotoxic effect before irradiation (represented by percentage survival) and the concentration of dFdC for the V79 ( ), AA8 ( ), irs1 ( ) and irs1SF ( ) cell lines. C-F Effect of preincubation without ( ) or with either 0.5 ( ) or 5 µM ( ) dFdC on radiosensitivity of the HR-proficient V79 C and AA8 E cell lines or on the HR-deficient irs1 D and irs1SF F cell lines.
Cell lines dFdCTP p†
V79 2.37 ± 0.30
Irs1 1.46 ± 0.03 0.050
AA8 2.60 ± 0.31
Irs1SF 2.44 ± 0.46 0.513
*dFdCTP concentration per 106 cells in µM. Data are the mean (± SE) of at least 3 individual experiments. (HR = homologous recombination). †Differences between HR-proficient and HR-deficient cell lines were tested by the Mann-Whitney test (two sided).
Table 1 DFdCTP concentrations in cell lines proficient and deficient in HR*
Chapter 6
124
Selective targeting of HR-DNA repair by gemcitabine
125
����������������
����������������
����������������
�
� �
�
���
�������������
�������������
���������� �� ����
����
��� ������
���������������������������� �� ����
�������������
�������������
���������� �� ����
�������������
�������������
���������� �� ����
���
�
��
���
� �� ��
����
����
���
��� ������������� ����
� �� �� ������
���
�
��
���
� �� ��
����
����
���
��� ������������� ����
� �� �� ������
�
���
�
��
���
� ��� ���
����
����
���
��� ������������� ����
��� ��� �����
���
�
��
���
� ��� ���
����
����
���
��� ������������� ����
��� ��� �����
���
�
��
���
� �� ��
����
����
���
��� ������������� ����
� �� �� ������
Figure 3 see next page for legenda
Chapter 6
124
Selective targeting of HR-DNA repair by gemcitabine
125
MMC-sensitization by dFdC in cells proficient and deficient in HR
To further substantiate that HR interferes with the process of HR, we next investigated
whether dFdC can cause sensitization to MMC in a manner depending on HR proficiency.
MMC introduces DNA DSBs by interstrand cross-links in DNA. Repair of MMC-induced
interstrand cross-links is especially dependent on HR [28]. This is also illustrated by the
extreme sensitivity to MMC of the HR-deficient irs1 and irs1SF cells (Fig. 3A) [12, 29]. In V79
and AA8 cells, dFdC before treatment with MMC induced significant sensitization to MMC
(Figs. 3B and 3D). In contrast, irs1 and irs1SF cells did not show sensitization to MMC when
pretreated with dFdC (Figs. 3C and 3E). These data further support our suggestion that the
HR pathway is targeted by dFdC.
HR-deficient cells can be radiosensitized by hyperthermia
In order to demonstrate that HR-deficient cells are not in general unable to respond to
radiosensitizers, we pretreated cells with hyperthermia, a potent radiosensitizer, likely
through effects on BER [30]. V79 and AA8 cells as well as irs1 and irs1SF cells were equally
sensitized when exposed to hyperthermia (43 oC) prior to irradiation (Fig. 4). These data
demonstrate that irs1 and irs1SF cells can be radiosensitized by means other than dFdC,
via effects on repair pathways other than HR. They also support the idea that HR is not a
target for heat-induced radiosensitization in accordance with earlier suggestions [30].
Rad51 foci formation after irradiation and dFdC
Next, we tested the effect of dFdC on the radiation-induced formation of Rad51 foci which
are thought to represent sites of HR [31, 32]. In nontreated, cultured mammalian cells, the
Rad51 protein is detected by immunofluorescent antibodies in a small number of discrete
foci in the nucleoplasm of a small fraction of cells [26, 33]. After DNA damage the number
of foci as well as the percentage of cells with focally concentrated Rad51 protein increases
in a time- and dose-dependent manner, suggesting activation of HR [26]. In experiments
by Haaf et al. [33] the highest number of nuclei showing Rad51 foci and the strongest im-
munofluorescence was observed starting from 3 h after irradiation with doses above 3 Gy.
In this study an obvious relation between irradiation-dose and foci formation was found
6 h after irradiation [33].
We found that untreated V79 cells showed a normal pattern of small Rad51 foci scattered
Figure 3 (opposite page) Effect of dFdC on sensitivity to MMC of the parental V79 and AA8 cell lines as compared with cell lines deficient in HR (irs1 and irs1SF). Cells (106/mL) were exposed to graded doses of MMC with ( ) or without ( ) a 4-h preincubation with 5 µM dFdC. Cell survival was assessed with clonogenic assay. Each point represents mean and standard error of three experiments. A Com-parison of the MMC-sensitivity of V79 ( ) and AA8 ( ) cell lines, and the irs1 ( ) and irs1SF ( ) cell lines (respectively mutated for the XRCC2 and XRCC3 genes and therefore deficient in HR). B-E Effect of dFdC on sensitivity to MMC of the HR-proficient V79 B and AA8 D cell lines or on the HR-deficient irs1 C and irs1SF E cell lines.
Chapter 6
126
Selective targeting of HR-DNA repair by gemcitabine
127
in the nucleus (Fig. 5A). In 14% of these cells foci were observed. Positively scored cells
(two or more foci per cell) generally contained less then 5 foci per cell. Irradiation (10 Gy)
induced formation of multiple small Rad51 foci within 3 h after irradiation in about 70%
of the cells (Fig. 5B), which subsequently condensed into large and bulky conglomerates
in about 67% of the cells (observed 6 h after irradiation). About 16% of the cells contained
only small foci 6 h after irradiation (Fig. 5C). These data are consistent with other reports
on Rad51 foci formation [26, 29]. Incubation with dFdC alone induced an increase in
Rad51 foci positive cells (small foci in about 51% of the cells) compared to untreated cells
A
C
B
D
�� ���� ��
����
��� ������
�� ���� ��
�� ���� ��
�� ���� ��
���
�
��
���
� � � �
����������
�
��������� ���� ����
���
�
��
���
� � � �
����������
�
��������� ���� ����
���
�
��
���
� � � �
����������
�
��������� ���� ����
���
�
��
���
� � � �
����������
�
��������� ���� ����
Figure 4 Effect of hyperthermia on radiosensitivity of the parental V79 and AA8 cell lines as compared with cell lines deficient in HR (irs1 and irs1SF). Cells (106/mL) were exposed to radiation with ( ) or with-out ( ) prior treatment with hyperthermia (30 min, 43oC). Cell survival was assessed with clonogenic assay. Each point represents mean and standard error of three experiments. In all cell lines radiosensiti-vity is increased by hyperthermia.
Chapter 6
126
Selective targeting of HR-DNA repair by gemcitabine
127
(Fig. 5D). At 3 h after irradiation small foci were observed in about 59% of V79 cells pre-
treated with 5 µM dFdC (Fig. 5E). However, at 6 h after irradiation reduced maturation into
large foci was observed in dFdC-pretreated cells, whereas 59% of these cells contained
a multitude of small foci and only 10% contained large and bulky conglomerates (Fig.
5F). These data indicate that dFdC indeed affects the HR and support our data that dFdC
causes radiosensitization by targeting the pathway.
Rad51 foci formation was also assessed in the XRCC2 deficient, irs1 cells. Consistent with
experiments of O’Regan et al. [29], we found little foci formation both before and after irra-
diation in these cells consistent with their HR deficiency and consistent with the absence
of an effect of dFdC on the radiosensitivity of these cells (data not shown).
Figure 5 Effect of dFdC on radiation-induced Rad51 foci formation. V79 cells were incubated with or without 5 µM dFdC for 4 h prior to either immediate fixation or irradiation (10 Gy) followed by fixation after a 3-h or 6-h incubation period. Subsequently cells were successively incubated with a rabbit polyclonal antibody against Rad51, FITC-conjugated swine anti-rabbit immunoglobulins and DAPI. Shown are overlay projections of the FITC- and DAPI-signal made by a confocal laser microscope. The pictures represent a typical pattern of Rad51 foci in the nuclei of V79 cells. A Immunofluorescent visualization of Rad51 foci formation in nuclei of control cells. B) Rad51 foci formation in cells fixated 3 h after irradiation. C Rad51 foci formation in cells fixated 6 h after irradiation. D Rad51 foci formation after a 4 h incubation period with dFdC. E Rad51 foci formation in cells after a 4-h pre-incubation with dFdC, followed by irradiation and 3 h time of repair before fixation. F Rad51 foci formation in cells after a 4-h pre-incubation with dFdC, followed by irradiation and 6 h time of repair before fixation.
Chapter 6
128
Selective targeting of HR-DNA repair by gemcitabine
129
Discussion
Our data reveal that sensitization to radiation and MMC by dFdC did not occur in cells
mutated in the XRCC2 and XRCC3 genes, associated with a defective DNA DSB repair by
HR [11]. This implicates that a functional HR pathway is essential to cause dFdC-mediated
radiosensitization. This is supported by the observation that dFdC interferes with the
formation of Rad51 foci in HR-proficient cells, strongly indicating that HR is a target for
dFdC-mediated sensitization to ionizing radiation. In contrast, it was found that BER pro-
ficiency is not required for dFdC-mediated radiosensitization, because cells defective in
XRCC1 could be radiosensitized by the drug. One must realize though that BER consists of
several parallel, partially overlapping and likely redundant pathways [34]. Hence, it cannot
be totally ruled out that other non-XRCC1 dependent pathways are not affected by dFdC.
If relevant to the radiosensitizing effect of dFdC, however, this should also have caused
sensitization in the HR-deficient cells, which was not the case. Moreover, this would also
not be consistent with the cell cycle specificity of the dFdC radiosensitization effect (see
also below).
Previously, we already excluded NHEJ as being a target for dFdC, because the radiosen-
sitizing effect of dFdC was also observed in cells lacking either functional DNA-PKcs or
Ku80 [7]. In fact, the extent of dFdC-mediated radiosensitization was even larger in the
NHEJ-deficient mutants. This is quite intriguing given the fact that the relative impact of
HR-deficiency on radiosensitivity is larger when NHEJ is also defective as demonstrated
by Essers et al. [21]. In the latter studies mRad54-/- HR-deficient adult mice were only
hypersensitive to ionizing radiation in a NHEJ-deficient background. In other words, the
relative importance of HR in radiosensitivity is greater when the cells lack functional NHEJ.
Therefore, our previous findings that dFdC-effects on radiosensitivity are larger in NHEJ-
deficient cells further substantiate our hypothesis that dFdC targets HR. Lastly, support for
this hypothesis also comes from data from Latz et al. [35] showing that the extent of dFdC-
induced radiosensitization is higher in late S phase than in G1 and early S phase. Studies
with the Rad54-/-/Ku70-/- double knockout from the chicken B-cell line DT40 revealed that,
whereas NHEJ is more important for repairing radiation-induced DNA-DSBs during G1 and
early S phase, HR is preferentially used in late S and G2 phases of the cell cycle [36]. Based
on all these observations we conclude that the target for radiosensitization induced by
dFdC is HR.
It is yet unclear which step in the pathway of HR is inhibited. Our data on Rad51 foci
suggest that dFdC induces inhibition of maturation into larger foci. In fact, at 6 h after
irradiation we see more, albeit smaller foci in cells treated with dFdC. One possible expla-
nation for this observation is that dFdC interferes with the DNA polymerization step in
HR, thereby halting the process. However, this has yet to be established experimentally,
for example, by live-recording experiments using green fluorescent protein tagged Rad51
expressing cells [37].
Chapter 6
128
Selective targeting of HR-DNA repair by gemcitabine
129
The specificity of dFdC to target HR, but not BER or NHEJ [7] may be of important clinical
relevance. As was demonstrated by Essers et al. [21], HR-deficient mice are hypersensitive
to ionizing radiation at the embryonic but not at the adult stage. Thus, whereas a defect
in HR may affect the radiosensitivity of undifferentiated embryonic stem cells [20] and
cultured cell lines [10-18, 36], its impact on the radiosensitivity of differentiated adult
cells in vivo might be limited or even absent. One could therefore speculate that the ra-
diosensitizing effect of dFdC in patients might be less in normal healthy tissue and more
restricted to (undifferentiated) tumor cells, making it a tumor-selective radiosensitizer.
Our data therefore support further trials to evaluate the clinical usefulness of dFdC in
combination with radiation.
Acknowledgements
We thank P.A. Jeggo (University of Sussex, Brighton, UK) for providing the AA8 and irs1 cell
lines, B. Kanon (University of Groningen, the Netherlands) for his help with the survival
experiments, and J.M. Maurer (University of Groningen, the Netherlands) for the determi-
nation of dFdCTP by HPLC.
Chapter 6
130
Selective targeting of HR-DNA repair by gemcitabine
131
References
1. Shewach DS, Hahn TM, Chang E, et al. Metabolism of 2’,2’-difluoro-2’-deoxycytidine and radiation
sensitization of human colon carcinoma cells. Cancer Res 1994;54:3218-3223.
2. Lawrence TS, Chang EY, Hahn TM, et al. Radiosensitization of pancreatic cancer cells by 2’,2’-
difluoro-2’-deoxycytidine. Int J Radiat Oncol Biol Phys 1996;34:867-872.
3. Joschko MA, Webster LK, Groves J, et al. Enhancement of radiation-induced regrowth delay by
gemcitabine in a human tumor xenograft model. Radiat Oncol Investig 1997;5:62-71.
4. Milas L, Fujii T, Hunter N, et al. Enhancement of tumor radioresponse in vivo by gemcitabine. Can-
cer Res 1999;59:107-114.
5. Gregoire V, Hittelman WN, Rosier JF, et al. Chemo-radiotherapy: radiosensitizing nucleoside ana-
logues (review). Oncol Rep 1999;6:949-957.
6. Zdzienicka MZ. Molecular processes and radiosensitivity. Strahlenther Onkol 1997;173:457-461.
7. Van Putten JWG, Groen HJM, Smid K, et al. End-joining deficiency and radiosensitization induced
by gemcitabine. Cancer Res 2001;61:1585-1591.
8. Shewach DS, Lawrence TS. Radiosensitization of human tumor cells by gemcitabine in vitro.
Semin Oncol 1995;22:68-71.
9. Yang LY, Li L, Jiang H, et al. Expression of ERCC1 antisense RNA abrogates gemicitabine-mediated
cytotoxic synergism with cisplatin in human colon tumor cells defective in mismatch repair but
proficient in nucleotide excision repair. Clin Cancer Res 2000;6:773-781.
10. Asaad NA, Zeng ZC, Guan J, et al. Homologous recombination as a potential target for caffeine
radiosensitization in mammalian cells: reduced caffeine radiosensitization in XRCC2 and XRCC3
mutants. Oncogene 2000;19:5788-5800.
11. Cui X, Brenneman M, Meyne J, et al. The XRCC2 and XRCC3 repair genes are required for chromo-
some stability in mammalian cells. Mutat Res 1999;434:75-88.
12. Liu N, Lamerdin JE, Tebbs RS, et al. XRCC2 and XRCC3, new human Rad51-family members, pro-
mote chromosome stability and protect against DNA cross-links and other damages. Mol Cell
1998;1:783-793.
13. Jones NJ, Cox R, Thacker J. Isolation and cross-sensitivity of X-ray-sensitive mutants of V79-4 ham-
ster cells. Mutat Res 1987;183:279-286.
14. Cartwright R, Tambini CE, Simpson PJ, et al. The XRCC2 DNA repair gene from human and mouse
encodes a novel member of the recA/RAD51 family. Nucleic Acids Res 1998;26:3084-3089.
15. Tambini CE, George AM, Rommens JM, et al. The XRCC2 DNA repair gene: Identification of a posi-
tional candidate. Genomics 1997;41:84-92.
16. Johnson RD, Liu N, Jasin M. Mammalian XRCC2 promotes the repair of DNA double-strand breaks
by homologous recombination. Nature 1999;401:397-399.
17. Fuller LF, Painter RB. A Chinese hamster ovary cell line hypersensitive to ionizing radiation and
deficient in repair replication. Mutat Res 1988;193:109-121.
18. Pierce AJ, Johnson RD, Thompson LH, et al. XRCC3 promotes homology-directed repair of DNA
damage in mammalian cells. Genes Dev 1999;13:2633-2638.
Chapter 6
130
Selective targeting of HR-DNA repair by gemcitabine
131
19. Kooistra R, Pastink A, Zonneveld JB, et al. The Drosophila melanogaster DmRAD54 gene plays a
crucial role in double-strand break repair after P-element excision and acts synergistically with
Ku70 in the repair of X-ray damage. Mol Cell Biol 1999;19:6269-6275.
20. Essers J, Hendriks RW, Swagemakers SM, et al. Disruption of mouse RAD54 reduces ionizing radia-
tion resistance and homologous recombination. Cell 1997;89:195-204.
21. Essers J, Van Steeg H, De Wit J, et al. Homologous and non-homologous recombination differen-
tially affect DNA damage repair in mice. EMBO J 2000;19:1703-1710.
22. Wallace SS. DNA damages processed by base excision repair: biological consequences. Int J Ra-
diat Biol 1994;66:579-589.
23. Wallace SS. Enzymatic processing of radiation-induced free radical damage in DNA. Radiat Res
1998;150:S60 -S79.
24. Zdzienicka MZ, Van der Schans GP, Natarajan AT, et al. A Chinese hamster ovary cell mutant
(EM-C11) with sensitivity to simple alkylating agents and a very high level of sister chromatid
exchanges. Mutagenesis 1992;7:265-269.
25. Cappelli E, Taylor R, Cevasco M, et al. Involvement of XRCC1 and DNA ligase III gene products in
DNA base excision repair. J Biol Chem 1997;272:23970-23975.
26. Raderschall E, Golub EI, Haaf T. Nuclear foci of mammalian recombination proteins are located at
single-stranded DNA regions formed after DNA damage. Proc Natl Acad Sci USA 1999;96:1921-
1926.
27. Heinemann V, Hertel LW, Grindey GB, et al. Comparison of the cellular pharmacokinetics and tox-
icity of 2’,2’-difluorodeoxycytidine and 1-beta-D-arabinofuranosylcytosine. Cancer Res 1988;48:
4024-4031.
28. De Silva IU, McHugh PJ, Clingen PH, et al. Defining the roles of nucleotide excision repair and
recombination in the repair of DNA interstrand cross-links in mammalian cells. Mol Cell Biol
2000;20:7980-7990.
29. O’Regan P, Wilson C, Townsend S, et al. XRCC2 is a nuclear RAD51-like protein required for dam-
age-dependent RAD51 focus formation without the need for ATP binding. J Biol Chem 2001;276:
22148-22153.
30. Kampinga HH, Dikomey E. Hyperthermic radiosensitization: mode of action and clinical rel-
evance. Int J Radiat Biol 2001;77:399-408.
31. Tashiro S, Walter J, Shinohara A, et al. Rad51 accumulation at sites of DNA damage and in postrep-
licative chromatin. J Cell Biol 2000;150:283-291.
32. Wang ZM, Chen ZP, Xu ZY, et al. In vitro evidence for homologous recombinational repair in resis-
tance to melphalan. J Natl Cancer Inst 2001;93:1473-1478.
33. Haaf T, Golub EI, Reddy G, et al. Nuclear foci of mammalian Rad51 recombination protein in so-
matic cells after DNA damage and its localization in synaptonemal complexes. Proc Natl Acad Sci
USA 1995;92:2298-2302.
34. Hoeijmakers JH. Genome maintenance mechanisms for preventing cancer. Nature 2001;411:
366-374.
35. Latz D, Fleckenstein K, Eble M, et al. Radiosensitizing potential of gemcitabine (2’,2’-difluoro-2’-
deoxycytidine) within the cell cycle in vitro. Int J Radiat Oncol Biol Phys 1998;41:875-882.
Chapter 6
132
36. Takata M, Sasaki MS, Sonoda E, et al. Homologous recombination and non-homologous end-join-
ing pathways of DNA double-strand break repair have overlapping roles in the maintenance of
chromosomal integrity in vertebrate cells. EMBO J 1998;17:5497-5508.
37. Essers J, Houtsmuller AB, Van Veelen L, et al. Nuclear dynamics of RAD52 group homologous
recombination proteins in response to DNA damage. EMBO J 2002;21:2030-2037.
Determination of epirubicin and its metabolite epirubicinol in saliva and plasma by HPLC
Wilma I.W. Dodde1, Jan Gerard Maring2, Gert Hendriks3, Floris M. Wachters4, Harry J.M.
Groen4, Elisabeth G.E. de Vries5, Donald R.A. Uges3
1University Centre for Pharmacy, Groningen; 2Department of Pharmacy, Diacones-
sen Hospital Meppel and Bethesda Hospital Hoogeveen; Departments of 3Pharmacy, 4Pulmonary Diseases and 5Medical Oncology, University Hospital Groningen,
The Netherlands
Ther Drug Monit 2003;25:433-440
Chapter 7
134
HPLC-UV analysis of epirubicin
135
Waterworks. Venice. Italy 2000.
Chapter 7
134
HPLC-UV analysis of epirubicin
135
Abstract
Aim We present a high-performance liquid chromatography (HPLC) method, suitable for
the analysis of epirubicin and its metabolite epirubicinol in saliva and plasma.
Methods Preparation of saliva and plasma samples was performed by extraction of
analytes with a chloroform : 2-propanol mixture (6:1, v/v) and evaporation of the organic
phase to dryness under vacuum at a temperature of approximately 45 °C. The chromato-
graphic analysis was carried out by reversed-phase isocratic elution of the anthracyclines
with a Chromsep Stainless Steel HPLC column (150 x 4.6 mm I.D.) filled with Nucleosil 100
S C18 material, particle size 5 µm.
Results The detection was accomplished by spectrofluorimetry at excitation and emission
wavelengths of 474 and 551 nm respectively. The anthracyclines eluted within 10 min of
injection and the method appeared to be specific. The method is linear over a concentra-
tion range of 5 – 1000 µg/L for epirubicin and 2 – 400 µg/L for epirubicinol (r > 0.99) in
both saliva and plasma. The recoveries from saliva and plasma of epirubicin, epirubicinol
and the internal standard doxorubicin were 88.9 and 69.0%, 87.6 and 77.3% and 80 and
67.9 % respectively. The lower limit of quantitation was 5 µg/L for epirubicin and 2 µg/L
for epirubicinol. The method proved to be precise and accurate, as the within-day and
between-day coefficients of variation were less than 10 %.
Conclusions Overall results indicate that our method is suitable for the bioanalysis of
epirubicin and epirubicinol in saliva as well as plasma.
Introduction
Anthracyclines are widely used as antitumor agents and are effective against a broad
range of malignancies [1]. The first identified anthracyclines, daunorubicin and doxoru-
bicin, were isolated from pigment producing Streptomyces species in the early 1960s and
remain in widespread clinical use today [2]. Epirubicin is the 4’-epimer of doxorubicin and
has an antitumor spectrum that is similar to doxorubicin, but produces less side effects
[1,3,4]. Clinically epirubicin has shown therapeutic activity in patients with breast cancer,
malignant lymphomas, sarcomas, lung, ovarian and prostate cancer [1,3,5]. Myelosuppres-
sion is the major acute dose-limiting toxicity, while cardiotoxicity is the most important
chronic cumulative dose-limiting toxicity [1,3,6]. Other side effects are nausea, vomiting,
alopecia, diarrhoea, phlebitis and mucositis [1,3]. The relationship between salivary
exposure of cytotoxic drugs and the occurrence of gastrointestinal side effects has so far
given little attention. Salivary excretion has been described for cisplatin [6], carboplatin
[7,8], cytarabin [9], doxorubicin [5,10], fluorouracil [11,12], etoposide [13,14], irinotecan
[15], melphalan [16], methotrexate [17-23], paclitaxel [24] and teniposide [25]. For most of
these agents, huge interindividual differences in saliva/plasma concentration ratios (S/P
Chapter 7
136
HPLC-UV analysis of epirubicin
137
ratio) were found. This is caused by many variables influencing the excretion of drugs into
saliva. The transfer of drugs from blood into saliva depends upon the (physico-)chemical
properties of the compound such as molecular size, lipid solubility, pKa and protein
binding. The primary physiologic factors affecting salivary distribution are salivary pH,
salivary flow rate and existing pathology of the oral cavity [26]. The salivary excretion
of chemotherapeutic agents in relation to gastrointestinal side effects has so far only
been studied for fluorouracil and methotrexate. Excretion of fluorouracil and 7-hydroxy-
methotrexate into saliva were reported to be positively related to the development of
mucositis [12,17,18,20-23].
Although several methods have been published regarding the analysis of anthracyclines
in plasma, as far as we know a validated assay for determination of these compounds in
saliva has never been reported. Celio et al. [4] and Bresolle et al. [10] studied the salivary
excretion of doxorubicin, but did not provide details on the analytical methods in their
reports. In this paper we describe a validated HPLC method for determining epirubicin
and its metabolite epirubicinol in saliva, which is also suitable for analysis of anthracy-
clines in plasma.
Methods
Chemicals
Epirubicin hydrochloride (purity 98.4 %) and epirubicinol hydrochloride (purity 78 %) were
obtained from Pharmacia & Upjohn, Milano, Italy. Doxorubicin hydrochloride (purity 97.9
%) was purchased from Rhône-Poulenc Pharma, Hoevelaken, the Netherlands. All other
chemicals were of standard analytical grade. Borax buffer consisted of 16.4 g/L disodium
tetraborate · 10 H2O in water, adjusted to pH 9 with a 0.1 M hydrochloric acid solution.
High Performance Liquid Chromatography system
The HPLC system consisted of a Spectroflow 400 solvent delivery system (ABI Analytical
Kratos Division, Ramsey NJ, USA), a Waters 717+ autosampler (Waters, Maryland, MA), a
Shimadzu fluorescence detector FR10AXL (Shimadzu, Kyoto, Japan), a computer equipped
with Chrom Perfect 32 (version 3.5) Chromatography data integration system (Justice In-
novations Inc. Palo Alto, CA). The analytical column used for the validation was a Chromsep
Stainless Steel HPLC column (150 x 4.6 mm I.D.) filled with Nucleosil 100 S C18 material,
particle size 5 µm (Chrompack, Middelburg, the Netherlands). The mobile phase consisted
of water : 0.1 M orthophosphoric acid : triethylamine : acetonitril (70 : 3 : 0.07 : 27, v/v).
Before the acetonitril was added the mixture was adjusted to pH 2.8 with 6 M hydrochlo-
ride acid solution. The pump was set at a flow rate of 1.5 mL/min. The excitation wave-
length of the fluorescence detector was set at 474 nm, the emission wavelength was set
at 551 nm. The injection volume was 50 µL.
Chapter 7
136
HPLC-UV analysis of epirubicin
137
Preparation of standards
For each compound, except for doxorubicin (internal standard), two independent stock
solutions were prepared. One was used for the preparation of the calibration samples
and the second for the preparation of the validation samples. The stock solutions of
epirubicin and epirubicinol were prepared by dissolving epirubicin(ol) hydrochloride in
methanol in a 25.0 mL (polypropylene) volumetric flask to obtain a concentration of 200
mg/L epirubicin(ol) free base. Calibration samples were prepared by adding the required
amount of the stock solutions to human saliva or plasma to obtain concentrations of 5, 10,
25, 50, 250, 500, 750 and 1000 µg/L epirubicin and 2, 4, 10, 20, 100, 200, 300 and 400 µg/L
epirubicinol respectively. Validation samples were prepared at low (20 µg/L epirubicin and
8 µg/L epirubicinol), medium (400 µg/L epirubicin and 160 µg/L epirubicinol) and high
(800 µg/L epirubicin and 320 µg/L epirubicinol) concentration levels. The lower limit of
quantitation (LLQ) was prepared at a concentration of 5 µg/L epirubicin and 2 µg/L epi-
rubicinol. The stock solution of doxorubicin was prepared by dissolving doxorubicin hy-
drochloride in methanol in a 25.0 mL (polypropylene) volumetric flask to obtain a concen-
tration of 200 mg/L doxorubicin free base. The working solution of the internal standard
was prepared by diluting 50 µL of the stock solution to 25.0 mL with acetonitril : 3 mM
orthophosphoric acid (20:80, v/v). A concentration of 400 µg/L doxorubicin calculated on
free base was obtained. Validation samples were kept frozen at – 20 °C until analysis.
Sample preparation
The extraction procedure was based on a method previously described by Oosterbaan
et al. [28]. Frozen (- 20 °C) saliva or plasma samples (validation or patient samples) were
thawed and sonificated for 15 min before analysis. An aliquot of 0.5 mL of saliva or plasma
sample was mixed with 100 µL of doxorubicin working solution in a 10 mL polypropylene
tube. To plasma samples additionally 100 µL of a solution of 0.2 M calcium chloride was
added and samples were allowed to stand for 15 min. Subsequently, to both saliva and
plasma samples, 0.5 mL of borax buffer pH 9 was added and the samples were extracted
with 7 mL of extraction solvent (chloroform: 2-propanol mixture 6:1 v/v) by shaking on
a rotary mixer for 20 minutes, at a speed of 40 rpm. After centrifugation at 2800 g for 5
min the upper (aqueous) layer was discarded and the remaining organic phase was trans-
ferred to a clean polypropylene tube. To the extracts from saliva samples, subsequently
100 µL of propyleneglycol (10 %) in ethanol was added. The solvent was evaporated to
dryness in a vacuum evaporator at a temperature of approximately 45 ºC. The residue was
reconstituted in 200 µL of the mobile phase and 50 µL was injected into the chromato-
graphic system.
Extracts from plasma were mixed with 200 µL of 0.1 M phosphoric acid and the sample
was extracted by shaking on the rotary mixer for 20 min, at a speed of 50 rpm. After cen-
trifugation at 2800 g for 5 min 50 µL of the upper aqueous layer was injected into the
chromatographic system.
Chapter 7
138
HPLC-UV analysis of epirubicin
139
Patient samples and blanks
Patient plasma and saliva samples were obtained from a patient who participated in a
randomized multicenter phase III trial comparing gemcitabine in combination with either
cisplatin of epirubicin as first-line treatment in advanced non-small cell lung cancer [27].
The protocol was approved by the Medical Ethics Review Committee of the University
Hospital Groningen and the patient gave written informed consent. Chemotherapy on
the first day of treatment consisted of gemcitabine 1125 mg/m2 as a 30 min infusion im-
mediately followed by epirubicin 100 mg/m2 as bolus injection. Collection of blood and
saliva samples was started immediately after the epirubicin dose and continued until
192 h after bolus injection. The samples were placed on ice immediately after collection.
Subsequently, plasma and untreated saliva samples were kept frozen at – 20 °C until
analysis. Blank saliva samples for method validation were obtained from male and female
volunteers. The ratio of saliva and plasma concentration (S/P ratio) was calculated for the
samples collected at the same time point.
Calibration
For the validation of the method a calibration curve was prepared in the range of 5-1000
ng/mL for epirubicin and 2-400 ng/mL for epirubicinol respectively. The parameters of
the calibration curves were calculated by weighted linear regression and were used to
calculate the epirubicin and epirubicinol concentrations of the validation samples. The
peak height ratios (epirubicin/internal standard and epirubicinol/internal standard) were
taken as the responses for a given sample.
Validation
The method was validated on linearity, accuracy, recovery, freeze-thaw stability, sample
compartment stability and sample dilution. On day one the linearity of the calibration
curves and the stability in the sample compartment were determined. On the days two
to six precision and accuracy, recovery, freeze/thaw stability and dilution of samples were
tested. During validation six blank samples obtained from six different human volunteers
were tested to demonstrate that there were no interfering components. The results of the
tests were evaluated against international used acceptance criteria described by Shah et
al. [29].
Linearity
To evaluate linearity of the calibration curves three calibration curves were prepared and
analysed. The curves were judged linear if the correlation coefficient r was better than 0.99
as calculated by weighted linear regression. The goodness of fit and the lack of fit were
determined by means of ANOVA calculations.
Chapter 7
138
HPLC-UV analysis of epirubicin
139
Accuracy and precision
To assess the accuracy and precision of the method, the samples LLQ, low, medium and
high were analysed three times a day, during five days. The coefficients of variation (CV
%) for the within-day precision and the coefficients of variation for the between-day
precision were estimated by ANOVA. An overall coefficient of variation less than 20 % was
accepted for the LLQ of this method. For the samples with low, medium and high concen-
tration an overall coefficient of variation less than 15 % was accepted [29]. Accuracy was
calculated from the mean of the amount observed and the theoretical concentrations
at a particular level. The method was considered accurate when the deviation from the
theoretical concentration (bias) was less than 20 % at the LLQ level and less than 15 % at
the remaining levels [29].
Recovery
The recoveries of epirubicin, epirubicinol and doxorubicin were determined by comparing
the peak heights of the validation samples low, medium and high with the peak heights
of analysed solutions containing all the compounds of interest at a concentration corre-
sponding with 100 % recovery [29].
Freezing and thawing
To assess freezing and thawing stability samples with a low concentration and samples
with a high concentration were prepared . The same sample was frozen and thawed each
day for five days. After each freeze/thaw cycle the samples were analysed in triplicate. Bias
was calculated in the same way as with precision and accuracy. Samples were considered
stable if bias was below 10 % after five freeze/thaw cycles.
Dilution
Because some samples of clinical patients can have concentrations above the higher limit
of quantitation (HLQ), these samples have to be diluted to obtain concentrations within
the calibration range. In order to validate the dilution of samples the following experiment
was carried out: samples with a concentration of 2.5 mg/L epirubicin and 1 mg/L epiru-
bicinol respectively were diluted 5 times and samples with a concentration of 10 mg/L
epirubicin and 4 mg/L epirubicinol respectively were diluted 20 times to obtain concen-
trations of 500 µg/L epirubicin and 200 µg/L epirubicinol. Blank human saliva was used as
diluting agent. These diluted samples were analysed in triplicate, during five days. Bias was
calculated by ANOVA. Dilution was considered possible if bias was below 10 %.
Stability during storage in sample compartment
Stability during storage in sample compartment was determined by analysing samples
with low and high concentration over a period of 30 h. The calculated response at t = 30 h
was compared to the calculated response at t = 0 h. Samples were judged stable over a
Chapter 7
140
HPLC-UV analysis of epirubicin
141
period of 30 h if the decrease in response was less than 10 %.
Results
Retention times
The retention times of epirubicinol, doxorubicin and epirubicin were 5.60 ± 0.39, 7.52 ±
0.49 and 9.66 ± 0.66 min (all based on n=265) respectively. No interfering peaks were
observed in the chromatograms.
Linearity
The analysis of the detector response as a function of analyte concentration in calibration
standards in the range of 5-1000 µg/L for epirubicin and 2-400 µg/L for epirubicinol gave a
correlation coefficients better than 0.99 for epirubicin and epirubicinol in saliva (figure 1).
In plasma also correlation coefficients better than 0.99 were found for both compounds.
The lack of fit test turned out significant for epirubicin in both saliva and plasma as well
as for epirubicinol in plasma. For epirubicinol in saliva no significant lack of fit was calcu-
lated.
Figure 1 Linear concentration-response curve of epirubicin in saliva.
���
���
���
���
���
����
����
� ��� ��� ��� ��� ����
������������� ������
����
����
Chapter 7
140
HPLC-UV analysis of epirubicin
141
Table 1 Accuracy and precision, freezing and thawing, dilution and recovery of epirubicin in saliva.
Number of samples
n = 15
Nominal conc.
(µg/L)
Measured conc.
(µg/L)
Within-day
CV (%)
Between-
day CV (%)
Bias
Accuracy and precision
LLQ 5 4.38 7.5 5.4 -12.3
Low 20 19.9 2.1 1.5 -0.6
Medium 400 382 2.9 4 -4.6
High 800 774 1.9 3.5 -3.3
Freezing and thawing
Low 20 19.6 6.7 3.7 -2
High 800 777 6 2.3 -3
Dilution
5 times 2500 2461 3.7 3.3 -2
20 times 10000 9470 13.7 1 -5
Table 2 Accuracy and precision, freezing and thawing, dilution and recovery of epirubicinol in saliva.
Number of samples
n = 15
Nominal conc.
(µg/L)
Measured conc.
(µg/L)
Within-day
CV (%)
Between-
day CV (%)
Bias
Accuracy and precision
LLQ (n = 14) 2 2.03 8.5 15.7 1.6
Low 8 7.64 2.8 0.7 -4.6
Medium 160 163 2.6 3.6 1.9
High 320 325 1.8 2.6 1.6
Freezing and thawing
Low 8 7.86 8.7 0.8 -1.7
High 320 327 5.1 0 2
Dilution
5 times 1000 1066 2.6 2.8 7
20 times 4000 4135 7.5 1.7 3
Chapter 7
142
HPLC-UV analysis of epirubicin
143
Table 3 Accuracy and precision, freezing and thawing, dilution and recovery of epirubicin in plasma.
Number of samples
n = 15
Nominal conc.
(µg/L)
Measured conc.
(µg/L)
Within-day
CV (%)
Between-
day CV (%)
Bias
Accuracy and precision
LLQ 5 4.98 23 6.9 -0.4
Low 20 21.4 4.2 3.1 7.2
Medium 400 409 3.2 3.5 2.2
High 800 865 2.0 1.3 8.1
Freezing and thawing
Low 20 22.2 4.7 5.9 10.8
High 800 828 2.4 6.2 4
Dilution
5 times 2500 2597 3.3 1.3 4
20 times 10000 10442 2.9 1.3 4
Table 4 Accuracy and precision, freezing and thawing, dilution and recovery of epirubicinol in plasma.
Number of samples
n = 15
Nominal conc.
(µg/L)
Measured conc.
(µg/L)
Within-day
CV (%)
Between-
day CV (%)
Bias
Accuracy and precision
LLQ 2 2 12.8 19.2 0.0
Low 8 8.3 3.7 3.8 3.7
Medium 160 169 4.2 0.2 5.8
High 800 320 2.9 0.0 5.1
Freezing and thawing
Low 8 8.71 8.6 3.7 8.9
High 320 329 1.9 2.9 3
Dilution
5 times 1000 1028 2.8 0.0 3
20 times 4000 4181 3.1 1.9 5
Chapter 7
142
HPLC-UV analysis of epirubicin
143
Accuracy and precision
In saliva as well as plasma, overall coefficients of variation were below 20 % for LLQ and
below 15 % for low, medium and high concentrations for both epirubicin and epirubicinol
(tables 1-4).
Recovery
In saliva, the mean calculated recoveries of epirubicin for the low, medium and high con-
centrations were 92.6 %, 86.6 % and 87.6 % respectively. For epirubicinol these recoveries
were 85.8 %, 89.1 % and 88.0 %. For doxorubicin a recovery of 80.0 % was found. In plasma,
the mean calculated recoveries of epirubicin for the low, medium and high concentrations
were 75.0 %, 63.8 % and 69.0 %. For epirubicinol these recoveries were 86.2 %, 72.8 % and
73.0 % respectively. For doxorubicin in plasma a recovery of 67.9 % was found.
Freezing and thawing
In saliva, bias was below 10 % for both low and high concentrations of epirubicin and
epirubicinol. In plasma bias was below 10 % for both low and high concentrations of epi-
rubicinol as well as for high concentrations epirubicin, but above 10 % for low epirubicin
concentrations. Detailed results are represented in table 1 and 2 for epirubicin and epiru-
bicinol respectively in saliva and table 3 and 4 for epirubicin and epirubicinol in plasma.
Figure 2 Chromatograms of blank saliva and blank plasma
Chapter 7
144
HPLC-UV analysis of epirubicin
145
Dilution
In saliva as well as plasma, bias was below 10 % for both low and high concentrations.
Detailed results are represented in tables 1-4.
Stability during storage in sample compartment
For epirubicin in saliva the ratio decreased 6.1 % after 30 h for low concentration and 3.1
% for high concentrations. For epirubicinol the ratio decreased 1.1 % after 30 h for low
concentration and 2.4 % for high concentrations.
Figure 3 Chromatogram of saliva from a patient 6 hours after administration of 100 mg/m2 epirubicin. The peak at t = 5.01 min corresponds with epirubicinol 5 µg/L; the peak at t = 6.92 min with doxorubi-cin; the peak at t = 8.84 min with epirubicin 31 µg/L. Scaling is expressed as milliVolt full scale (mV FS). The detector settings were identical to those in figure 2.
���� �����
� � � � �� �� ��
���
�
����
����
����
���� ��
���
Chapter 7
144
HPLC-UV analysis of epirubicin
145
Figure 4 Plasma and saliva curves in a clinical patient after a intravenous dose of 100 mg/m2 epirubicin.
�
��
���
����
�����
� � �� �� �� ��
���� ������
����
����
����
���
����
���������� ������
���������� ������
������������ ������
������������ ������
In plasma the ratio for epirubicin decreased 1.8 % after 30 h for low concentration and
0.2 % for high concentrations. For epirubicinol in plasma these ratios were 3.0 % for low
concentrations and 0.4 % for high concentrations in plasma.
Patient’s saliva.
During validaton six blank samples were tested. None of the samples showed interfering
peaks. An example of a blank saliva sample is given in figure 2.
Figure 3 shows a chromatogram of saliva from a patient, 6 h after a bolusinjection of 100
mg/m2 epirubicin. Figure 4 depicts the saliva and saliva curves in the same patient. The
theoretical S/P ratio of epirubicin was calculated with the following formula:
According to literature, the pKa of epirubicin is 7.7, the fraction unbound in plasma ap-
proximately 0.23, and the fraction unbound in saliva 1.00. Hence, the theoretical S/P ratio
of epirubicin ranges from 0.23 to 3.92 when saliva pH decreases from 7.4 to 6. In the
patient, epirubicin S/P ratios ranging from 0.002 to 2.56 were measured (see table 5). The
lowest values were measured during the distribution phase shortly after bolus injection,
during rapid decline of epirubicin plasma levels.
Chapter 7
146
HPLC-UV analysis of epirubicin
147
Discussion
In this paper we demonstrate that epirubicin and its metabolite epirubicinol can be
measured in saliva over a wide range of concentrations (5-1000 µg/L for epirubicin and 2-
400 µg/L for epirubicinol respectively) with high linearity and precision. This range is wide
enough to cover saliva levels of epirubicin and epirubicinol in clinical practice. In a study
with doxorubicin, Bressolle et al. [10] reported parotid saliva levels ranging from 11.7 to
82.6 µg/L following intravenous doses of 28-72 mg/m2 doxorubicin. Celio et al. [5] found a
range of 11.6 to 36.0 µg/L for doxorubicin in parotid saliva following an intravenous total
dose of 50-90 mg.
Surprisingly, a lack of fit was calculated for the linearity of the epirubicin calibration curve,
despite a high correlation coefficient. We analysed that a very small variance in the tripli-
cates, compared to the deviations of the individual points from the calibration line caused
this lack of fit. Therefore, we considered the outcome of this statistical test in this case as
irrelevant.
We calculated a lower limit of quantification of 5 µg/L for epirubicin and 2 µg/L for epiru-
bicinol in saliva. As far as we know, the lowest limit of quantitation mentioned in literature
for analysis of anthracyclines in saliva by HPLC is 25 µg/L, although analytical results as
low as 11.6 µg/L doxorubicin in saliva have been reported [5,10]. Despite the fact that
epirubicin and doxorubicin are chemically not fully identical, we believe that our method
is at least 2.5-5 times more sensitive than previously reported methods for analysis of
anthracyclines in saliva. As the extraction recovery at low concentrations is only margin-
ally higher than that of doxorubicin (93% vs. 80%) and the relative emission intensities of
epirubicin and doxorubicin during fluorospectroscopy are more or less identical, these
factors do not explain improved sensitivity. Sample size, sample concentration, peak
shape, signal to noise ration, and/or injection volume might be relevant parameters, but
this was not further investigated.
Table 5 Patient data regarding epirubicin concentrations in plasma and saliva, concurrent saliva pH values and calculated S/P ratios.
sample time (h) Cplasma
(µg/L) Csaliva
(µg/L) S/P ratio pHsaliva
1 5199 11 0.002 6.7
1.5 190 56 0.29 5.4
2 92 87 0.95 6.5
3 66 105 1.59 6.6
4.5 54 138 2.56 6.1
6 46 74 1.61 6.0
22 15 25 1.67 5.5
Chapter 7
146
HPLC-UV analysis of epirubicin
147
We measured recoveries of 88.9 %, 87.6 % and 80 % for epirubicin, epirubicinol and
doxorubicin in saliva respectively at intermediate concentration levels. Although these
recoveries are lower than those mentioned by Celio et al. [5] (95%), they appear to be
very reproducible. The extraction procedure according to Oosterbaan et al. [28], which
was initially applied, produced recoveries of only 24%, 57% and 27% for epirubicin, epiru-
bicinol and doxorubicin. Subsequently, several attempts have been made to improve the
recovery from saliva, including solid phase extraction, sequential addition of isopropanol
and chloroform, protein denaturation with acetonitril before extraction, concentration
and pH variations in extraction buffer, variations in CaCl2
concentration and addition of
propylene glycol. The use of propylene glycol produced an acceptable increase in the
recovery of epirubicin and epirubicinol, which could be explained by the prevention of
sublimation or adsorption of the analytes during the evaporation step.
Freezing and thawing of samples, sample dilution, and storage of samples in a auto-
sampler sample compartment were all considered acceptable according to Shah’s criteria
for accuracy and precision [29].
The saliva/plasma (S/P) ratios measured in our patient were in line with theoretical values.
The S/P ratios increased significantly with time after dosing. This is in line with earlier
findings of Bresolle et al. [10] for doxorubicin and doxorubicinol. The largest increase of
S/P ratio occurred during the hours immediately after injection, largely due to rapidly de-
creasing epirubicin plasma levels as a result of extensive drug distribution.
We conclude that the method for determination of anthracyclines in saliva, presented in
this paper, has a lower limit of quantification than previously reported methods and is
applicable over a wide concentration range. With slight modifications, this method can
also be used for determination of anthracyclines in plasma. With concurrent analysis of
anthracyclines in plasma and saliva, the extent of drug excretion into saliva can be studied
and S/P ratios can be calculated.
Acknowledgements
The authors thank Marina Maurer for her efforts in analysing patient samples.
Chapter 7
148
HPLC-UV analysis of epirubicin
149
References
1. Hortobágyi GN. Anthracyclines in the treatment of cancer: an overview. Drugs 1997:54(suppl 4):
1-7.
2. Weiss RB. The anthracyclines: will we ever find a better doxorubicin? Semin Oncol 1992:19:670-
86
3. Plosker GL, Faulds D. Epirubicin A review of its pharmacodynamic and pharmacokinetic proper-
ties, and therapeutic use in cancer chemotherapy. Drugs 1993;45:788-856
4. Lilenbaum RC, Green MR. Novel chemotherapeutic agents in the treatment of non-small cell lung
cancer. J Clin Oncol 1993;11:1391-1402.
5. Celio LA, DiGregorio GJ, Ruch E, Pace J, Piraino AJ. Doxorubicin and 5-fluorouracil plasma concen-
trations and detectability in parotid saliva. Eur J Clin Pharmacol 1983;24:261-266.
6. Allen A, The cardiotoxicity of chemotherapeutic drugs. Semin Oncol 1992:19:529-42.
7. Holding JD, Lindup WE, Roberts NB, et al. Measurement of platinum in saliva of patients treated
with cisplatin. Ann Clin Biochem 1999;36:655-659.
8. Van Warmerdam LJ, van Tellingen O, ten Bokkel Huinink WW, et al. Monitoring carboplatin con-
centrations in saliva: a replacement for plasma ultrafiltrate measurements? Ther Drug Monit
1995;17:465-470.
9. Slevin ML, Johnston A, Woollard RC, et al. Relationship between protein binding and extravas-
cular drug concentrations of a water-soluble drug, cytosine arabinoside. JR Soc Med 1983;76:
365-368.
10. Bresolle F, Jacquet JM, Galtier M, et al. Doxorubicin and doxorubicinol plasma concentrations and
excretion in parotid saliva, Cancer Chemother Pharmacol 1992;30:215-218.
11. Milano G, Thyss A, Santini J, et al. Salivary passage of 5-fluorouracil during continuous infusion.
Cancer Chemother Pharmacol 1989;24:197-199.
12. Joulia JM, Pinguet F, Ychou M, et al. Plasma and salivary pharmacokinetics of 5-fluorouracil (5-FU)
in patients with metastatic colorectal cancer receiving 5-FU bolus plus continuous infusion with
high-dose folinic acid. Eur J Cancer 1999;35:296-301.
13. Holthuis JJ, Postmus PE, Van Oort WJ et al. Pharmacokinetics of high dose etoposide (VP 16-213).
Eur J Cancer Clin Oncol 1986;22:1149-1155.
14. Gouyette A, Deniel A, Pico JL et al. Clinical pharmacology of high-dose etoposide associated with
cisplatin. Pharmacokinetic and metabolic studies. Eur J Cancer Clin Oncol 1987;23:1627-1632.
15. Takahashi T, Fujiwara Y, Sumiyoshi H, et al. Salivary drug monitoring of irinotecan and its active
metabolite in cancer patients. Cancer Chemother Pharmacol 1997;40:449-452.
16. Slavik M, Wu J, Riley C. Salivary excretion of anticancer drugs. Ann NY Acad Sci 1993;694:319-
321.
17. Schroder H, Jensen KB, Brandsborg M. Lack of correlation between methotrexate concentrations
in serum, saliva and sweat after 24 h methotrexate infusions. Br J Clin Pharmacol 1987;24:537-
541.
18. Steele WH, Stuart JF, Whiting B et al. Serum, tear and salivary concentrations of methotrexate in
Chapter 7
148
HPLC-UV analysis of epirubicin
149
man. Br J Clin Pharmacol 1979;7:207-211.
19. Patterson AJ, Ritschel WA, Zellner D, et al. Methotrexate serum and saliva concentrations in pa-
tients. Int J Clin Pharmacol Ther Toxicol 1981;19:381-385.
20. Ishii E, Yamada S, Higuchi S, et al. Oral mucositis and salivary methotrexate concentration in
intermediate-dose methotrexate therapy for children with acute lymphoblastic leukemia. Med
Pediatr Oncol 1989;17:429-432.
21. Oliff A, Bleyer WA, Poplack DG. Methotrexate-induced oral mucositis and salivary methotrexate
concentrations. Cancer Chemother Pharmacol 1979;2:225-226.
22. Albertioni F, Rask C, Schroeder H, et al. Monitoring of methotrexate and 7-hydroxymethotrexate
in saliva from children with acute lymphoblastic leukemia receiving high-dose consolidation
treatment: relation to oral mucositis. Anticancer Drugs 1997;8:119-124.
23. Rask C, Albertioni F, Schroder H, et al. Oral mucositis in children with acute lymphoblastic leuke-
mia after high-dose methotrexate treatment without delayed elimination of methotrexate: rela-
tion to pharmacokinetic parameters of methotrexate. Pediatr Hematol Oncol 1996;13:359-367.
24. Svojanovsky SR, Egodage KL, Wu J, et al. High sensitivity ELISA determination of taxol in various
human biological fluids. J Pharm Biomed Anal 1999;20:549-555.
25. Holthuis JJ, de Vries LG, Postmus PE, et al. Pharmacokinetics of high-dose teniposide. Cancer Treat
Rep 1987;71:599-603.
26. Jusko W, Milsap R. Pharmacokinetic principles of drug distribution in saliva. Ann NY Acad Sci
1993;694:36-47.
27. Wachters FM, Van Putten JWG, Kramer H, et al. Randomized multicenter phase III trial comparing
gemcitabine in combination with cisplatin and epirubicin as first-line treatment in advanced
non-small cell lung cancer. Proc Am Soc Clin Oncol 2002; abstract 1181
28. Oosterbaan MJM, Dirks RJ, Vree TB, et al. Rapid quantitative determination of seven anthracy-
clines and their hydroxy metabolites in body fluids. J Chromatogr 1984;306:323-332.
29. Shah, Midha KK, Dighe S, et al. Analytical methods validation: bioavailability, bioequivalence, and
pharmacokinetic studies. J Pharm Sci 1992;3:309-312.
Gemcitabine and epirubicin plasma concentra-tions and excretion in saliva in non-small cell lung cancer patients.
Jan Gerard Maring1 , Floris M. Wachters2 , Marina Maurer3 , Donald R.A. Uges4, Elisabeth
G.E. de Vries5 , Harry J.M. Groen2
1Department of Pharmacy, Diaconessen Hospital Meppel and Bethesda Hospital
Hoogeveen; 2Department of Pulmonary Diseases, University Hospital Groningen, 3Univer-
sity Centre for Pharmacy, Groningen; Departments of 4Pharmacy and 5Medical Oncology,
University Hospital Groningen, The Netherlands
Submitted
Chapter 8
152
Gemcitabine and epirubicin excretion in saliva
153
Camel Man. Hollywood LA, USA 1998.
Chapter 8
152
Gemcitabine and epirubicin excretion in saliva
153
Abstract
Aim The excretion in saliva of gemcitabine and its metabolite 2’,2’-difluorodeoxyuridine
(dFdU) as well as epirubicin and its metabolite epirubicinol was studied in non-small cell
lung cancer patients, treated with gemcitabine plus epirubicin.
Methods Patients (n=12) were treated with gemcitabine 1125 mg/m2, followed by epi-
rubicin 100 mg/m2. Blood, saliva and oral mucosa cells were collected during 22 h for
analysis of gemcitabine, epirubicin and their metabolites. Gemcitabine, dFdU, epirubicin
and epirubicinol were quantified by High Performance Liquid Chromatography (HPLC).
Results Gemcitabine was rapidly cleared from plasma and undetectable after 3 h in all
patients. Gemcitabine was detectable in saliva only during the first hour after infusion. The
Cmax
in saliva was 0.66 ± 0.61 mg/L and the saliva/plasma ratio (S/P ratio) was 0.038 ± 0.037.
Epirubicin displayed a triexponential plasma concentration-time profile. The concentration in
saliva at t=6 h after administration was 55 ± 27 µg/L and decreased to 28 ± 14 µg/L at t=22
h. The corresponding S/P ratios were 1.28 ± 0.73 and 1.72 ± 1.00. The amount of epirubicin
in mucosal cells ranged from 135-598 ng/106 cells at t=3 h and decreased to 33-196 ng/106
cells at t=22 h.
Conclusion Gemcitabine and epirubicin as well as their main metabolites dFdU and epi-
rubicinol are excreted in detectable amounts in saliva, although their absolute amounts
remain relatively low.
Introduction
Gemcitabine and epirubicin, respectively a pyrimidine antagonist and an anthracycline
analogue, are both extensively used in the treatment of solid tumors. Both agents are
rapidly distributed to tissues and quickly cleared from plasma immediately after intra-
venous administration. The clearance of gemcitabine is primarily determined by its de-
gradation into 2’,2’-difluorodeoxyuridine (dFdU) by the enzyme cytidine deaminase [1].
Epirubicin is cleared by liver metabolism and excretion into bile [2]. The main metabolite
is epirubicinol, which also has cytotoxic activity. The plasma pharmacokinetics of both
drugs have been described previously [3-5]. Hardly any information however is available
with respect to the excretion of gemcitabine and epirubicin into saliva. Previously, the
excretion in saliva of the pyrimidine antagonist cytarabine and that of the anthracycline
analogue doxorubicin have been reported [6-8]. Saliva is secreted by the parotid, sublin-
gual and submaxillary glands, with the parotid and submaxillary glands accounting for
90% of the approximately 1200 mL of saliva that is secreted each day [9]. The blood supply
to the glands is provided by the external carotid artery with the direction of the arterial
flow being countercurrent to the direction of salivary flow within the ductal system. The
excretion of cytotoxic drugs in saliva may be related to the development of side effects
Chapter 8
154
Gemcitabine and epirubicin excretion in saliva
155
such as oral mucositis and diarrhea. The extent of salivary secretion is mainly determined
by the lipofilicity and pKa of the drug, the level of protein binding of the drug in plasma
and the pH of saliva. Drugs are believed to enter saliva predominantly via passive diffusion,
a process that is limited to the un-ionized drug [9].
The aim of the current study was to determine the excretion of gemcitabine and epirubicin
and respectively their main metabolites dFdU and epirubicinol in saliva. In addition, for
these drugs the importance of salivary excretion as a route of elimination was evaluated.
Patients and methods
Patient selection
This study was performed as a site study of a phase III trial of gemcitabine plus epirubicin
versus gemcitabine plus cisplatin in advanced NSCLC patients [10]. Patients had to meet
the inclusion and exclusion criteria of the main study. In short, patients were included
if they had stage IIIB/IV NSCLC. No prior chemotherapy was allowed. An adequate bone
marrow reserve, normal renal and liver function were required. Patients were excluded
if they had active infections, second primary malignancies, uncorrected hypercalcae-
mia or a left ventricular ejection fraction (LVEF) less than 45%. A detailed description of
the inclusion and exclusion criteria was published earlier [10]. The local medical ethics
committee of the hospital approved the protocol. All patients gave informed consent
before study entry. The gemcitabine and dFdU plasma pharmacokinetic data presented
in this study were also used to explore the interaction of gemcitabine and epirubicin in
another trial. The results of this interaction study are shown in chapter 9. The toxicity was
scored before chemotherapy and on days 8, 15 and 21 according to the Common Toxicity
Criteria, version 2.0.
Treatment and sample collection
Gemcitabine (Gemzar®, Lilly, Nieuwegein,The Netherlands) in a dose of 1125 mg/m2 in 250
mL 0.9% NaCl solution was administered as a 30 min infusion on day 1 and day 8. Epiru-
bicin (Farmorubicine®, Pharmacia, Woerden, The Netherlands) in a dose of 100 mg/m2 in
50 mL 0.9% NaCl solution was administered as an intravenous bolus injection over 5 min,
immediately after the end of the gemcitabine infusion, on day 1 of each 21-day cycle. For
pharmacokinetic sampling, a cannula was placed intravenously in the arm of the patient
contralateral to the side of drug administration. Blood samples of 9 mL were collected in
heparinized tubes containing 0.25 mg tetrahydrouridine (THU) in 50 µL water, just before
chemotherapy and at t = 25, 40, 50, 60, 75, 90, 105, 120, 150, 180, 270, 360, 540 and 1320 min
after start of the gemcitabine infusion. Unstimulated whole saliva was collected over 5 min
periods in plastic cups, containing 0.25 mg THU in 50 µL water, just before chemotherapy
and at t = 25, 40, 60, 90, 120, 180, 270, 360, 540 and 1320 min after start of the gemcitabine
Chapter 8
154
Gemcitabine and epirubicin excretion in saliva
155
infusion. The saliva pH was measured with a calibrated pH meter on the day of sample col-
lection. Harvesting of oral mucosa cells was performed before chemotherapy, and 180 min
and 1320 min after start of the gemcitabine infusion by thorough mouth rinsing during a
30 sec period with 5 mL 0.9 % NaCl solution. The cell suspension was collected in plastic
cups, containing 0.25 mg THU in 50 µL water, and subsequently placed on ice. Within 1 h
after collection, the cell suspension was centrifuged during 10 min at 190 g at 4 ºC. The
supernatant was discarded and cells were washed in 10 mL ice cold Phosphate Buffered
Saline, pH=7.40 (PBS) and centrifuged during 10 min at 190 g at 4 ºC. The pellet was resus-
pended in 1 mL ice cold PBS and a 50 µL aliquot of this cell suspension was mixed with 50
µL tryptan blue solution (0.4% in a 8.77 g/L NaCl solution) for microscopic cell counting.
The viability was estimated by measuring the percentage of cells able to exclude tryptan
blue. The remaining suspension was transferred in a microcentrifuge cup and shortly (15
s) centrifuged at 10,000 g The supernatant was discarded and the pellet was kept frozen
at – 80 ºC until further analysis.
HPLC analysis
Epirubicin hydrochloride and epirubicinol hydrochloride were obtained from Pharmacia
& Upjohn (Milano, Italy). Doxorubicin hydrochloride was purchased from Rhône-Poulenc
Pharma (Hoevelaken, the Netherlands). Gemcitabine hydrochloride and dFdU, were
obtained from Lilly Co., (Indianapolis, IN). Tetrahydrouridine was purchased from Calbio-
chem (La Jolla, CA). All other chemicals were of standard analytical grade.
The extraction and analysis of epirubicin and epirubicinol from plasma and saliva was
carried out according to the method previously described by Dodde et al. [11].
The analysis of gemcitabine and dFdU in plasma was carried out as described by Freeman
et al. [12]. For the analysis in saliva, a slight modification on this method was performed as
follows: Individual 200 µL aliquots of plasma or 1 mL aliquots of saliva standards, controls
and subject samples were pipetted into 10 mL glass tubes. For plasma sample concentra-
tions above 10 mg/L, sample volumes from 20 - 100 µL were used and diluted to 200 µL
with THU treated plasma. A 50 µL aliquot of working internal standard solution was added
to each tube. The samples were briefly vortex-mixed. Then 1 mL isopropanol was added
and the samples were vortex-mixed again. After 5 min a 2.5 mL aliquot of ethylacetate was
added and vortex-mixed. The samples were centrifuged at 2,500 g for 10 min. The super-
natant was transferred to a fresh tube and evaporated at 40 ºC under a stream of nitrogen.
The samples were reconstituted with 250 µL of mobile phase.
The extraction of epirubicin and epirubicinol from cells was performed as follows: Frozen
cell pellets were thawed and resuspended in 150 µL ultrapure water using a vortex mixer.
Protein denaturation was carried out by addition of 50 µL trichloroacetic acid solution
50%. The mixture was allowed to stand on ice during 20 min. Subsequently, the suspen-
sion was centrifuged during 2 min at 10,000 g. The supernatant was transferred into a
clean cup and 1 mL of trioctylamine : 1,1,2-trichlorotrifluoroethane (1:5) was added. The
Chapter 8
156
Gemcitabine and epirubicin excretion in saliva
157
Table 1 Patient characteristics
(n=12)
Gender (M/F) 10/2
Age (y) 65 ± 7
Weight (kg) 77 ± 13
Length (cm) 176 ± 4
Body surface area (m2) 1.93 ± 0.15
Serum-Creatinine (µmol/L) 86 ± 15
Mean values are presented ± the standard deviation
Table 2 Toxicity CTC score during the first treatment cycle
Toxicity grade
Grade 0 Grade 1-2 Grade3-4n n n
Hemoglobin 0 10 2
Leucocytes 3 6 3
Neutro-/Granulocytes 5 2 5
Platelets 1 5 6
Nausea 7 5 0
Vomiting 11 1 0
Mucositis 5 7 0
Diarrhea 12 0 0
Table 3 Epirubicin pharmacokinetic parameters
Epirubicin
Dose (mg) 190 ± 15
AUC0→22 h
(µg.h/L) 1880 ± 578
Vdistribution
(L) 1483 ± 565
Cl (L/h) 90 ± 24
Csaliva 6 h
(µg/L) 55 ± 27
S/P ratio 6 h
1.28 ± 0.73
Csaliva 22 h
(µg/L) 28 ± 14
S/P ratio 22 h
1.72 ± 1.00
Epirubicinol
AUC0→22 h
(µg.h/L) 414 ± 164
T 1⁄2 elimination
(h) 16.0 ± 4.1
Mean values ± the standard deviation are presented.
Chapter 8
156
Gemcitabine and epirubicin excretion in saliva
157
mixture was vortexed during 1 min and subsequently centrifuged for 2 min at 10,000 g.
The supernatant was divided over 2 autosampler tubes for HPLC analysis of epirubicin
and epirubicinol. The lower limit of quantitation was 5 µg/L for epirubicin and 2 µg/L for
epirubicinol.
Pharmacokinetic analysis
Pharmacokinetic data were analyzed in Mw\Pharm (version 3.5; MediWare, Groningen, The
Netherlands) using KinFit. For both gemcitabine and epirubicin and their metabolites, the
Area Under the Curve (AUC; trapezoid rule) and elimination half-lifes were calculated by
non-compartiment analysis. Additionallly, the epirubicin and epirubicinol data were also
analyzed in a three compartiment pharmacokinetic model. The saliva/plasma ratios were
calculated by dividing saliva and plasma concentrations at each time point.
Statistical analysis
Subject data were analyzed for descriptive statistics in the SYSTAT 7.0 statistical program
(SPSS inc. 1997). Blood, saliva and mucosal cellular levels and saliva/plasma ratios on
different time points were compared with a paired Student’s t-test. Pairs consisted of data
obtained from the same individual.
Results
Patients
Between November 2000 and September 2002 we included 12 patients.
Patient characteristics are represented in table 1. All patients had normal liver and renal
function parameters. Treatment related toxicity, measured during the first cycle, is repre-
sented in table 2. Nearly all patients experienced hematological toxicity. The main non-
hematological toxicity was grade 1/2 mucositis in 7 out of 12 patients.
Pharmacokinetics
Mean pharmacokinetic curves of gemcitabine and dFdU in saliva are represented in figure 1.
Gemcitabine and dFdU plasma data, also reported in detail in chapter 9, were used for saliva/
plasma ratio (S/P ratio) calculations and for this reason included in figure 1.
Gemcitabine was rapidly cleared from plasma and undetectable after 3 h in all patients. Both
gemcitabine and dFdU data were fitted in a parent drug – metabolite model, comprising one
compartiment for gemcitabine and two compartiments for dFdU pharmacokinetics. Gemci-
tabine was detectable in saliva only during the first hour after infusion. The Cmax
in saliva was
0.66 ± 0.61 mg/L and the S/P ratio was only 0.038 ± 0.037. This was in line with the theoretical
S/P ratio, calculated for gemcitabine.
Mean pharmacokinetic curves of epirubicin and epirubicinol in plasma and saliva are
Chapter 8
158
Gemcitabine and epirubicin excretion in saliva
159
Figure 2 Mean concentration-time profiles of epirubicin and its metabolite epirubicinol in plasma and saliva after a bolus dose of 100 mg/m2 epirubicin. The error bars represent the s.d. values.
Figure 1 Mean concentration-time profiles of gemcitabine and its metabolite dFdU in plasma and saliva after a 30 min infusion of 1125 mg/m2 gemcitabine. Error bars represent the s.d. values.
���
���
����
�����
� � � � �
���� ���
���� ������
���� ������
���� ������
���� ����������
����
����
���
����
�
��
���
����
� � �� �� �� ��
���� ���
���������� ������������������ ���������������� ������������������ ������
����
�����
����
����
��
Chapter 8
158
Gemcitabine and epirubicin excretion in saliva
159
represented in figure 2. Data of epirubicin and epirubicinol were fitted separately in a
three-compartment pharmacokinetic model. Table 3 represents the pharmacokinetic pa-
rameters of both compounds in plasma and saliva, including S/P ratios at t=6 h and t=22 h
after epirubicin administration. Figure 3 displays the S/P ratios at t=6 h (upper panel) and
t=22 h (lower panel) as function of saliva pH. There was no consistent effect of pH on the
S/P ratio. Nearly all S/P ratios of epirubicin exceeded 1, which was above the theoretical
maximum value calculated for epirubicin.
Mucosal cells for quantification of intracellular epirubicin were available from 7 patients.
The amount of epirubicin ranged from 135-598 ng/106 cells at t=3 h and decreased to 33-
196 ng/106 cells at t=22 h (p<0.05, paired t-test; see figure 4).
�
�
�
�
�
� � � �
��
���
�����
�
�
�
�
�
� � � �
��
���
�����
�
�
Figure 3 Saliva-Plasma (S/P) ratios of epirubicin after a bolus dose of 100 mg/m2 epirubicin as a func-tion of saliva pH. Panel A displays values at t = 6 h after epirubicin administration and panel B values at t = 22 h.
Chapter 8
160
Gemcitabine and epirubicin excretion in saliva
161
Discussion
Excretion of gemcitabine in saliva occurred in negligible amounts. Low S/P ratios were
measured and gemcitabine was only detectable in small amounts during the first hour
after infusion. The low S/P ratios were in line with our expectations, since gemcitabine
is a hydrophilic molecule and ionized at physiological pH. Based on the pKa, and fraction
unbound in plasma, for each drug the S/P ratio can be calculated. For weak acidic drugs
the general formula is [13]:
�
�
������
������
�
��
�
�
��
��
�
�
�
��
���
���
Where fp and f
s represent the fractions of unbound drug in plasma and saliva and pH
s and
pHp represent the salivary and plasma pH values.
Gemcitabine has a pKa of 3.6 and is hardly bound to proteins [14]. This results in theoretical
S/P ratios from 0.0006 to 0.13 depending on saliva pH over a range from 4 to 7.4. Low S/P
ratios have also been reported for the pyrimidine antagonist cytarabine [6].
Following the administration of epirubicin, a triexponential disappearance of epirubicin
from plasma was observed with a rapid distribution phase and a prolonged elimina-
tion phase. This pharmacokinetic profile is typical for anthracyclines [5]. The prolonged
elimination is consistent with extensive drug retention within peripheral tissues and
�
���
���
���
���
���
���
���
��� ����
���� ����
�����
����
���
���
��
�����
�
Figure 4 Amounts of epirubicin in oral mucosa cells (n=7) measured at t = 3 h and at t = 22 h after a bolus dose of 100 mg/m2 epirubicin. Values from the same individual are paired with a closed line.
Chapter 8
160
Gemcitabine and epirubicin excretion in saliva
161
gradual release thereafter. Anthracyclines are accumulated within cells against a gradient,
because of the intracellular presence of high affinity receptors such as DNA. Compared to
gemcitabine, much larger S/P ratios were observed for epirubicin, which were in line with
previous findings for doxorubicin [8]. The pKa of epirubicin is 7.7 and the fraction unbound
in plasma 0.8, which results in theoretical S/P ratios ranging from 0.13-1.00 depending on
saliva pH values from 4.0-7.4 [15]. The S/P ratios of epirubicin increased significantly with
time during the 22 h period after dosing, mostly due to decrease of plasma levels. The
absolute amount of epirubicin excreted in saliva remained however low, as saliva concen-
trations never exceeded 220 µg/L. As a result, in patients with a normal saliva production
of 1.2 – 1.5 L per day, the total amount epirubicin excreted over 24 h is only 0.3 mg, which
corresponds to about 0.1-0.15 % of the administered dose. The mean gemcitabine Cmax
in
saliva was about 0.7 mg/L and rapidly dropped to undetectable levels within 2 h. The total
amount excreted in saliva during this period was less then 0.1 mg, which is 0.05 % of the
gemcitabine dose.
These calculations indicate that the gastrointestinal exposure to epirubicin and gemcit-
abine as a result of excretion in saliva is limited. Although more than 50% of all patients in
our study experienced grade 1/2 mucositis, we believe that it is indeed not very likely that
the mucositis is caused by a direct effect of the small amounts of gemcitabine excreted
in saliva during only few hours. On the other hand, we are less sure about the role of epi-
rubicin. After an initial distribution phase, the epirubicin concentrations were generally
higher in saliva than in plasma and epirubicin remained detectable in saliva until at least
22 h after intravenous administration. The prolonged exposure of oral mucosal cells to
both epirubicin in saliva and epirubicin from blood in the extravascular fluid may have
added to the development of mucositis.
We conclude that gemcitabine and epirubicin as well as their main metabolites dFdU
and epirubicinol are excreted in detectable amounts in saliva, although their absolute
amounts remain relatively low.
Chapter 8
162
References
1. Grunewald R, Abbruzzese JL, Tarassoff P, Plunkett W. Saturation of 2’,2’-difluorodeoxycytidine 5’-
triphosphate accumulation by mononuclear cells during a phase I trial of gemcitabine. Cancer
Chemother Pharmacol 1991;27:258-262
2. Young CW, Weenen H. Pharmacology of epirubicin. In: Advances in anthracycline chemotherapy:
epirubicin. Ed. Bonadonna G. Masson Italia Editori. Milano 1984. pp.51-60
3. Abbruzzese JL, Grunewald R, Weeks EA, Gravel D, Adams T, Nowak B, Mineishi S, Tarassoff P, Satter-
lee W, Raber MN, et al. A phase I clinical, plasma, and cellular pharmacology study of gemcitabine.
J Clin Oncol 1991;9:491-498.
4. van Moorsel CJ, Kroep JR, Pinedo HM, Veerman G, Voorn DA, Postmus PE, Vermorken JB, van
Groeningen CJ, van der Vijgh WJ, Peters GJ. Pharmacokinetic schedule finding study of the com-
bination of gemcitabine and cisplatin in patients with solid tumors. Ann Oncol 1999;10:441-448
5. Weenen H, Lankelma J, Penders PG, McVie JG, ten Bokkel Huinink WW, de Planque MM, Pinedo
HM. Pharmacokinetics of 4’-epi-doxorubicin in man. Invest New Drugs 1983;1:59-64
6. Slevin ML, Johnston A, Woollard RC, Piall EM, Lister TA, Turner P. Relationship between protein
binding and extravascular drug concentrations of a water-soluble drug, cytosine arabinoside. J R
Soc Med 1983;76:365-368
7. Celio LA, DiGregorio GJ, Ruch E, Pace J, Piraino AJ. Doxorubicin and 5-fluorouaracil plasma con-
centrations and detectability in parotid saliva. Eur J Clin Pharmacol 1983;24:261-266
8. Bressolle F, Jacquet JM, Galtier M, Jourdan J, Donadio D, Rossi JF. Doxorubicin and doxorubicinol
plasma concentrations and excretion in parotid saliva. Cancer Chemother Pharmacol 1992;30:
215-218.
9. Drobitch RK, Svensson CK. Therapeutic drug monitoring in saliva. An update. Clin Pharmacokinet
1992;23:365-379
10. Wachters FM, Van Putten JW, Kramer H, Erjavec Z, Eppinga P, Strijbos JH, de Leede GP, Boezen HM,
de Vries EG, Groen HJ. First-line gemcitabine with cisplatin or epirubicin in advanced non-small-
cell lung cancer: a phase III trial. Br J Cancer 2003;89:1192-1199
11. Dodde WI, Maring JG, Hendriks G, Wachters FM, Groen HJ, de Vries EG, Uges DR. Determination
of epirubicin and its metabolite epirubicinol in saliva and plasma by HPLC. Ther Drug Monit
2003;25:433-440
12. Freeman KB, Anliker S, Hamilton M, Osborne D, Dhahir PH, Nelson R, Allerheiligen SR. Validated as-
says for the determination of gemcitabine in human plasma and urine using high-performance
liquid chromatography with ultraviolet detection. J Chromatogr B Biomed Appl 1995;665:171-
181
13. Jusko WJ, Milsap RL. Pharmacokinetic principles of drug distribution in saliva. Ann NY Acad Sci
1993;694:36-47
14. Gemzar package insert (Lilly Canada), 12/12/96.
15. Arcamone F, Cassinelli G, Penco S, Vicario GP, Vigevani A. Chemistry of epirubicin. In: Advances
in anthracycline chemotherapy: epirubicin. Ed. Bonadonna G. Masson Italia Editori. Milano 1984.
pp.3-28
Pharmacokinetics and pharmacogenetics of gemcitabine combined with epirubicin or cisplatin in non-small cell lung cancer patients
Jan Gerard Maring1, Floris M. Wachters2 , Monique Slijfer3 , Marina Maurer4, Marieke H.M.
Boezen5, Donald R.A. Uges6, Elisabeth G.E. de Vries5, Harry J.M. Groen2
1Department of Pharmacy, Diaconessen Hospital Meppel and Bethesda Hospital
Hoogeveen; 2Department of Pulmonary Diseases, University Hospital Groningen; 3De-
partment of Pharmacy, Martini Hospital Groningen; 4University Centre for Pharmacy,
Groningen; Departments of 5Medical Oncology and 6Pharmacy, University Hospital
Groningen, The Netherlands
Submitted
Chapter 9
164
Gemcitabine pharmacokinetics and pharmacogenetics
165
Interaction of statues. Paris. France 1998.
Chapter 9
164
Gemcitabine pharmacokinetics and pharmacogenetics
165
Abstract
Aim The pharmacokinetics of gemcitabine and its metabolite 2’,2’-difluorodeoxyuridine
(dFdU) and the influence of a common A79C polymorphism in the cytidine deaminase
gene (CDD) were studied in non-small cell lung cancer patients, treated with gemcitabine
plus epirubicin (EG) or gemcitabine plus cisplatin (GC).
Methods Patients were treated with gemcitabine 1125 mg/m2, followed by epirubicin 100
mg/m2 (EG; n=12) or cisplatin 80 mg/m2 (GC; n=10). Plasma was collected during 3 h after
gemcitabine administration. Gemcitabine and dFdU were quantified by High Perform-
ance Liquid Chromatography (HPLC) with ultraviolet detection. The CDD A79C genotype
was determined with Polymerase Chain Reaction (PCR) and DNA sequencing.
Results Gemcitabine was rapidly cleared from plasma and undetectable after 3 h. The phar-
macokinetics of gemcitabine was the same in the two treatment groups. A plasma Area Under
the Curve (AUC) of 8.3 vs. 7.6 mg.h/L and a half-life of 0.20 vs. 0.16 h were calculated in re-
spectively the EG and GC group. The dFdU half-life was larger in EG compared to GC treated
patients (3.3 vs. 1.2 h; p<0.05). The influence of the CDD A79C genotype was studied in 20
patients. There was a trend towards higher AUC (+16%; p=0.20) and lower clearance values
(-11%; p=0.35) in individuals heterozygous or homozygous for the C-genotype (C/C; A/C;
n=12), compared to homozygotes for the A-genotype (A/A; n=8).
Conclusion The pharmacokinetics of gemcitabine is similar in EG treated compared to
GC treated patients. The influence of a common A79C polymorphism in the CDD gene on
gemcitabine pharmacokinetics is probably only minor.
Introduction
During the last decade, several new chemotherapeutic agents have been evaluated for
their beneficial effect in patients with non-small cell lung cancer (NSCLC). So far, gemci-
tabine plus cisplatin has emerged as one of the standard regimens for the treatment of
advanced NSCLC [1]. Unfortunately, cisplatin can cause nephro-, neuro-, and ototoxicity.
Moreover, cisplatin administration requires pre- and post hydration. Thus, in search for a
better tolerable, easy to administer, non-platinum regimen, the activity of gemcitabine
combined with epirubicin (EG) was studied in our hospital in patients with advanced
NSCLC [2]. Main toxicities of the EG combination, observed during phase I/II trials were
granulocytopenia, thrombocytopenia, febrile neutropenia and mucositis.
Only few reports are available with respect to the pharmacokinetic interaction between
gemcitabine and epirubicin. Perez-Manga et al. studied the pharmacokinetics of gemci-
tabine 800 mg/m2 in the presence of a low dose (25 mg/m2) doxorubicin and found that
the tissue disposition and clearance of both drugs was unchanged [3]. Fogli et al. studied
the pharmacokinetics of 90 mg/m2 epirubicin in the presence of 1000 mg/m2 gemcitab-
Chapter 9
166
Gemcitabine pharmacokinetics and pharmacogenetics
167
ine. They concluded that gemcitabine has no effect on epirubicin pharmacokinetics [4].
However, the effect of epirubicin on the gemcitabine pharmacokinetics was not studied.
The clearance of gemcitabine is primarily determined by its degradation into 2’,2’-di-
fluorodeoxyuridine (dFdU) by the enzyme cytidine deaminase [5]. Cytidine deaminase is
ubiquitous in the human body, catalyzing the hydrolytic deamination of (deoxy-)cytidine
to (deoxy-)uridine. The total enzyme capacity of cytidine deaminase in all organs and
tissues determines the biotransformation rate of gemcitabine into dFdU and thereby in-
directly the duration of exposure to gemcitabine. Interestingly, cloning of human cytidine
deaminase has revealed a A79C polymorphism in exon 1 of the CDD gene correspond-
ing with two protein variants (CDD1 and CDD2) with more than 2-fold difference in vitro
deamination rates [6]. The C genotype corresponds to a Gln carrying enzyme (CDD-1) and
the A genotype to a Lys-carrying variant (CDD-2). The CDD-2 enzyme exerts a 1.3 - 3.3 fold
higher deamination rate of cytarabine than CDD-1 [7]. Thus, apart from a possible interac-
tion with epirubicin, the pharmacokinetics of gemcitabine may be affected by this genetic
polymorphism.
The aim of the current study was to determine the pharmacokinetics of gemcitabine in EG
compared to GC treated NSCLC patients. Information on pharmacokinetic and pharmaco-
dynamic interactions between anti-cancer drugs is essential for optimizing the efficacy-
toxicity ratio of a treatment schedule. Additionally, the effect of the A79C polymorphism in
the cytidine deaminase gene in relation to gemcitabine pharmacokinetics was explored.
Patients and methods
Patient selection
This study was performed as a site study of a phase III trial of gemcitabine plus epiru-
bicin versus gemcitabine plus cisplatin (GC) in advanced NSCLC patients [8]. Patients had
to meet the inclusion and exclusion criteria of the main study. In short, patients were
included if they had stage IIIB/IV NSCLC. No prior chemotherapy was allowed. An adequate
bone marrow reserve, normal renal and liver function were required. The glomerular filtra-
tion rate (GFR) was calculated according to the formula of Cockcroft and Gault [9].
Patients were excluded if they had active infections, second primary malignancies, un-
corrected hypercalcaemia or a left ventricular ejection fraction (LVEF) less than 45%. A
detailed description of the inclusion and exclusion criteria is published elsewhere [8]. The
local medical ethics committee of the hospital approved the protocol. All patients gave
informed consent before study entry.
Chapter 9
166
Gemcitabine pharmacokinetics and pharmacogenetics
167
Treatment and sample collection
Gemcitabine-Epirubicin group
Gemcitabine (Gemzar®, Lilly, Nieuwegein,The Netherlands) in a dose of 1125 mg/m2 in 250
mL 0.9% NaCl solution was administered as a 30 min infusion on day 1 and day 8. Epiru-
bicin (Farmorubicine®, Pharmacia, Woerden, The Netherlands) in a dose of 100 mg/m2 in
50 mL 0.9% NaCl solution was administered as an intravenous bolus injection over 5 min,
immediately after the end of the gemcitabine infusion, on day 1 of each 21-day cycle. For
pharmacokinetic sampling, a cannula was placed intravenously in the arm of the patient
contralateral to the side of drug administration. Blood samples of 9 mL were collected in
heparinized tubes containing 0.25 mg tetrahydrouridine (THU) in 50 µL water, just before
chemotherapy and at t = 25, 40, 50, 60, 75, 90, 105, 120, 150, 180, 270, 360, 540 and 1320 min
after start of the gemcitabine infusion.
Gemcitabine-Cisplatin group
Gemcitabine (Gemzar, Lilly, Nieuwegein, The Netherlands) in a dose of 1125 mg/m2 in 100
mL 0.9% NaCl solution was administered as a 30 min infusion on day 1 and day 8. Cisplatin
in a dose of 80 mg/m2 in 1000 mL 0.9% NaCl solution was administered as a 3 h infusion,
starting 1 h after the end of the gemcitabine infusion, on day 1 of each 21-day cycle.
Blood samples of 9 mL were collected in heparinized tubes containing 0.25 mg tetrahy-
drouridine (THU) in 50 µL water, just before chemotherapy and at t = 25, 40, 50, 60, 75, 90,
105, 120, 150, 180, and 240 min after start of the gemcitabine infusion. Plasma and saliva
samples were kept frozen at - 20 ºC until analysis.
Pharmacokinetic analysis
Gemcitabine hydrochloride, dFdU, 2’,2’-difluorodeoxycytidine monophosphate (dFdCMP),
2’,2’-difluorodeoxycytidine diphosphate (dFdCDP), 2’,2’-difluorodeoxycytidine diphos-
phate (dFdCTP) were obtained from Lilly Co., (Indianapolis, IN). Tetrahydrouridine was
purchased from Calbiochem (La Jolla, CA). All other chemicals were of standard analytical
grade.
The analysis of gemcitabine and dFdU in plasma was carried out as described by Freeman
et al. [10].
Cytidine deaminase genotyping
The CDA exon 1 polymorphism (C/A) at codon position 27 was genotyped by direct se-
quencing, in both directions, of PCR amplified genomic DNA.
First, the CDA region flanking the polymorphic site was amplified using PCR with forward
primer 5’- AGTAGCTTCCCCTTCCAGTAGC and reversed primer 5’-CCTCTTCCTGTACATCTTC-
CTCTG. The 25 µL reactions contained: 2.5 units Taq polymerase (Amersham Biosciences,
Uppsala, Sweden); 0.5 mM dNTP mix (Roche Diagnostics, Mannheim, Germany); 1x PCR
buffer (Roche Diagnostics), 0.05 mM MgCl2; 0.2 µM of each primer; and approximately
Chapter 9
168
Gemcitabine pharmacokinetics and pharmacogenetics
169
50 ng genomic DNA. The amplification was performed on a PTC-225 thermal cycler (MJ
Research, Waltham, MA), using a stepdown protocol. The first 5 cycles were carried out at
94 °C, 65 °C, and 72 °C, each for 30 s. The next 5 cyles at 94 °C, 63 °C, and 72 °C, each for 30 s.
The last 25 cyles at 94 °C, 60 °C, and 72 °C, each for 30 s. Following cycling the PCR products
were purified with the Qiagen Qiaquick PCR purification kit (Westburg b.v, Leusden, the
Netherlands). Subsequently, 100 ng of the purified PCR product was cycle sequenced with
a Dyeterminator kit (US81090, Amersham Biosciences, Roosendaal, the Netherlands) in a
thermal cycler (MJ Research), using 0.05 mM sequencing primer. For the reverse reaction
the same primer was used as in the PCR, but for the forward reaction an internal primer
was used (5’-GGTACCAACATGGCCCAGAAG). After the cycle reaction the sequencing
products were cleaned on a Sephadex plate (Amersham Biosciences) by centrifugation
for 5 min at 910 g. The eluted sample was vacuum dried for 45 min at 65 °C. Finally, 20 µL of
loading solution (Amersham Biosciences) was added to dissolve the sequencing products.
The samples were analyzed on a MegaBACE 1000 capillary sequencer (Amersham Bio-
sciences) by injecting the samples for 45 s at 3 kV, and running them for 5 hours at 4 kV. The
data were processed with Sequence Analyser 3.0 (Amersham Biosciences) and Seqman II
(DNASTAR Inc., Madison, WI).
Pharmacokinetic modelling
Pharmacokinetic data were analyzed in Mw\Pharm (version 3.5; MediWare, Groningen,
The Netherlands) using KinFit. For both gemcitabine and epirubicin and their metabolites,
the AUC (trapezoid rule) and elimination half-lifes were calculated by non-compartmen-
tal analysis. Parent drug-metabolite pharmacokinetic relations were analyzed by multi-
compartiment analysis in the ADAPT II Maximum Likelihood Parameter Estimation program
(version 4.0; University of Southern California, Los Angeles, CA). Variance for the observations
was assumed to be proportional to the measured values and set at 10%. The Akaike Informa-
tion Criterion (AIC) was used for model selection. The model with the lowest summarized AIC
value was selected as the better one.
Statistical analysis
Patient data were analyzed in two groups, based on treatment schedule. Clinical chemistry
and pharmacokinetic data were compared with a two sided Student’s t-test. In case of
unequal variances, as indicated by the Kolmogorov-Smirnov test, data were tested with
the non-parametric Mann-Whitney U-test. The study was powered (>80%) to detect a 30
% difference in population means, assuming a standard deviation in pharmacokinetic
parameters of 30%.
Correlations between clinical chemistry, demographic, pharmacogenetic and pharma-
cokinetic data were tested by Spearman Rank correlation analysis. Statistical significance
was at p<0.05. Analyses were performed with the SYSTAT 7.0 statistical package (SPSS inc.
1997).
Chapter 9
168
Gemcitabine pharmacokinetics and pharmacogenetics
169
Results
Patients
Between November 2000 and September 2002 we included 12 patients in the EG group
and 10 patients in the CG group. Patient characteristics of both groups are represented in
table 1. Mean serum creatinine level in EG treated patients was 86 ± 15 µmol/L (mean ±
s.d) and higher compared to 72 ± 13 µmol/L in GC treated patients. The GFR revealed a
lower rate of 74 ± 17 mL/min in EG compared to 93 ± 21 mL/min in GC treated patients
(p<0.02). No differences were observed in other parameters.
Pharmacokinetics
Mean pharmacokinetic curves of gemcitabine and dFdU in plasma are represented in figure
1 for both treatment groups. Gemcitabine was rapidly cleared from plasma and undetectable
after 3 h in all patients. Both gemcitabine and dFdU data were fitted in a parent drug – meta-
bolite model, comprising one compartiment for gemcitabine and two compartiments for
dFdU pharmacokinetics. The pharmacokinetic data of the two groups is represented in table
2. No differences were measured in the pharmacokinetics of gemcitabine. However, the
half-life of dFdU appeared larger in EG compared to GC treated patients. This also resulted
in a larger AUC of dFdU in the EG group. In a Spearman rank correlation analysis, only a weak
correlation was found between dFdU plasma half-life and serum creatinine (R=0.39) or GFR
(R=0.40) (see figure 2).
Table 1 Patient characteristics in both treatment groups.
EG (n=12) GC (n = 10)
Gender (M/F) 10/2 11/1
Age (y) 63 ± 9 65 ± 7
Weight (kg) 77 ± 13 77 ± 13
Length (cm) 178 ± 11 176 ± 4
Body surface area (m2) 1.95 ± 0.21 1.92 ± 0.15
Serum-Creatinine (µmol/L) 86 ± 15 72 ± 13 #
GFR (mL/min) 74 ± 17 93 ± 21 #
Serum-AST (U/L) 23 ± 4 21 ± 6
Serum-ALT (U/L) 35 ± 7 27 ± 8
Serum-LDH (U/L) 101 ± 52 110 ± 47
Serum-ALP (U/L) 239 ± 88 234 ± 59
Serum-Bilirubin (µmol/L) 10 ± 2 12 ± 3
Mean values ± the standard deviation are presented; # different at p<0.05 (Student’s t-test)
Chapter 9
170
Gemcitabine pharmacokinetics and pharmacogenetics
171
Table 2 Gemcitabine pharmacokinetic parameters in both treatment groups.
EG (n=12) GC (n = 10)
Gemcitabine
Dose (mg) 2136 ± 173 2180 ± 274
AUC0→3 h
(mg.h/L) 8.3 ± 2.9 7.6 ± 1.5
Vdistribution
(L) 60 ± 20 63 ± 20
Clmetabolic
(L/h) 240 ± 147 298 ± 66
T 1⁄2 elimination
(h) 0.20 ± 0.08 0.16 ± 0.04
dFdU
AUC0→3 h
(mg.h/L) 67 ± 14 56 ± 8 #
T 1⁄2 elimination
(h) 3.3 ± 1.4 1.2 ± 0.2 #
Mean values ± the standard deviation are presented # different at p<0.05 (Student’s t-test)
���
���
����
�����
� � � �
���� ���
����������� �� ���������������������� �����
���� �� ���������������������� �����
����������� �� ��������������������� �����
���� �� ��������������������� �����
����
�����
����
����
��
Figure 1 Pharmacokinetics of gemcitabine and its metabolite dFdU in epirubicin plus gemcitabine and gemcitabine plus cisplatin treated patients after a 30 min infusion of 1125 mg/m2 gemcitabine. Error bars represent the s.d. values.
Chapter 9
170
Gemcitabine pharmacokinetics and pharmacogenetics
171
Pharmacogenetic analysis
The pooled gemcitabine pharmacokinetic data of all 22 patients were analyzed with respect
to the influence of the A79C polymorphism in the CDD gene. These data are represented
in table 3. The mean pharmacokinetic curves of gemcitabine and dFdU according to CDD
genotype are represented in figure 3.
The A genotype corresponds to the CDD-2 variant of cytidine deaminase, which has a 2-
fold higher intrinsic activity than the to the C genotype corresponding CDD-1 variant. Our
data indeed show a trend towards higher AUC (+16%; p=0.20) and lower clearance values
(-11%; p=0.35) in individuals heterozygous or homozygous for the C-genotype (C/C; A/C;
n=12), compared to homozygotes for the A-genotype (A/A; n=8).
�
�
�
�
�
�
�
�
�� �� �� ��� ���
�� ������� ��������
�� ������� ������������
������������
����� ���������� ��������
Figure 2 Correlation between serum-creatinine levels and dFdU half-life in non-small cell lung cancer patients treated with a 30 min infusion of 1125 mg/m2 gemcitabine
Table 3 Gemcitabine drug elimination related parameters, as measured in each subgroup ac-cording to cytidine deaminase A79C genotype.
A/A
(n=8)
C/C
(n=4)
A/C
(n=8)
A allele bearing
(n=16)
C allele bearing
(n=12)
AUC (mg.h/L) 8.00 ± 1.56 9.79 ± 3.01 9.31 ± 3.31 8.75 ± 2.70 9.47 ± 3.08
Cl (L/h) 271 ± 50 245 ± 126 239 ± 60 252 ± 56 241 ± 82
T1⁄2 elimination (h) 0.19 ± 0.06 0.20 ± 0.05 0.18 ± 0.06 0.18 ± 0.06 0.18 ± 0.06
Mean values ± the standard deviation are presented
Chapter 9
172
Gemcitabine pharmacokinetics and pharmacogenetics
173
Discussion
In this study, we investigated the effect of epirubicin on the pharmacokinetics of gem-
citabine in NSCLC patients treated with both drugs. In all patients gemcitabine was
rapidly cleared from plasma, as was expected from previous reports [11]. We observed
no differences in gemcitabine clearance between EG and GC treated patients, indicat-
ing lack of interaction between gemcitabine and epirubicin. This is in line with previous
findings of Conte et al. who reported that the pharmacokinetics of gemcitabine remains
unchanged in the presence of 175 mg/m2 paclitaxel and 90 mg/m2 epirubicin [12]. It was
known already that cisplatin does not alter gemcitabine pharmacokinetics [13]. Interest-
ingly, the clearance of the gemcitabine metabolite dFdU was lower in EG compared to
GC treated patients. Since dFdU elimination is mainly determined by renal excretion we
analyzed the effect of renal function. Although the renal function was about 20% better
in GC compared to EG treated patients, we only found a weak correlation between dFdU
clearance and serum creatinine or glomerular filtration rate. This suggests that, apart from
renal function, also another factor contributes to the observed difference. We hypothe-
sized that the shorter half-life of dFdU in GC treated patients may in part be the result
of increased dFdU excretion and/or tissue disposition due to pre-hydration measures,
Figure 3 Pharmacokinetics of gemcitabine and its metabolite dFdU after a 30 min infusion of 1125 mg/m2 gemcitabine grouped according to genotype of the cytidine deaminase A79C polymorphism. Error bars represent the s.d. values.
���
���
����
�����
� � � � �
���� ���
����
�����
����
����
��
����������� ���
����������� ���
����������� ���
���� ���
���� ���
���� ���
Chapter 9
172
Gemcitabine pharmacokinetics and pharmacogenetics
173
necessary for cisplatin administration. Enhanced elimination due to hydration is known
to occur for a few drugs, including the anticancer agent methotrexate [14,15]. Another
possibility could be an interaction between dFdU and cisplatin or epirubicin. Interestingly,
increased elimination of dFdU has also been reported by Van Moorsel et al. when they
administered gemcitabine 4 hours after cisplatin compared to 4 h before cisplatin [13].
In our study, the cisplatin administration was started 1 h after the end of the gemcitabine
infusion in GC treated patients. Thus, dFdU pharmacokinetics may have been influenced
by the presence of cisplatin. Since dFdU is considered to be biologically inert, the observed
difference was considered of no clinical importance [16].
The most important factor that determines the clearance rate of gemcitabine is the
activity of the enzyme cytidine deaminase. This enzyme rapidly catabolizes gemcitabine.
The enzyme capacity of cytidine deaminase in all organs and tissues determines the
biotransformation rate of gemcitabine into dFdU and thus the duration of exposure to
gemcitabine. Therefore, we determined whether gemcitabine metabolism was affected
by a known A79C polymorphism in exon 1 of the CDD encoding gene. The C genotype
corresponds to the Gln carrying enzyme (CDD-1) and the A genotype to the Lys-carrying
natural variant (CDD-2). The CDD-2 enzyme has been shown to exert a 1.3 - 3.3 fold higher
deamination rate of cytarabine than CDD-1 [7]. The frequencies of the A/A, A/C and C/C
genotype were 42%, 37% and 21% respectively in our study. We observed no large dif-
ferences in gemcitabine clearance between the different genotypes. Our data showed a
trend towards higher AUC and lower clearance values in individuals who are heterozygous or
homozygous for the C-genotype, compared to homozygotes for the A-genotype. These dif-
ferences however did not reach statistical significance. The observed difference in clearance
was 11% and in AUC 16%, while the standard deviation reached nearly 33%. Based on these
data, we calculated that at least 120 patients are required to proof the influence of the A79C
polymorphism on gemcitabine pharmacokinetics.
Interestingly, recently two new polymorphisms in the CDD gene have been reported.
These concern the G208A and T435C polymorphism with allele frequencies of 4.3% and
70.1% respectively [17]. The G208A polymorphism produces a alanine to threonine sub-
stitution (A70T) within the conserved catalytic domain. Introduction of this gene in yeast
null mutants, resulted in a 20% reduction of the 50% inhibitory concentration value for
cytarabine [17]. The impact of this polymorphism on gemcitabine clearance is unclear.
The presence of several polymorphisms in the cytidine deaminase gene, with at least two
affecting the catalytic domain, may partly explain the interindividual variability in enzyme
activity. Since two polymorphisms already result in nine different genotypes, the full phar-
macogenetic picture of cytidine deaminase in relation to gemcitabine clearance may be
quite complex and can only be elucidated in larger clinical trials.
We conclude that the pharmacokinetics of gemcitabine is similar in EG treated compared
to GC treated patient. The influence of a common A79C polymorphism in the cytidine
deaminase gene on gemcitabine pharmacokinetics is probably only minor.
Chapter 9
174
Gemcitabine pharmacokinetics and pharmacogenetics
175
References
1. Schiller JH, Harrington D, Belani CP, Langer C, Sandler A, Krook J, Zhu J, Johnson DH; Eastern Coop-
erative Oncology Group. Comparison of four chemotherapy regimens for advanced non-small-
cell lung cancer. N Engl J Med 2002;346:92-98
2. van Putten JW, Eppinga P, Erjavec Z, de Leede G, Nabers J, Smeets JB, Th Sleijfer D, Groen HJ. Activ-
ity of high-dose epirubicin combined with gemcitabine in advanced non-small-cell lung cancer:
a multicenter phase I and II study. Br J Cancer 2000;82:806-811
3. Perez-Manga G, Lluch A, Alba E, Moreno-Nogueira JA, Palomero M, Garcia-Conde J, Khayat D, Riv-
elles N. Gemcitabine in combination with doxorubicin in advanced breast cancer: final results of
a phase II pharmacokinetic trial. J Clin Oncol 2000;18:2545-2552
4. Fogli S, Danesi R, Gennari A, Donati S, Conte PF, Del Tacca M. Gemcitabine, epirubicin and paclitax-
el: pharmacokinetic and pharmacodynamic interactions in advanced breast cancer. Ann Oncol
2002;13:919-927
5. Grunewald R, Abbruzzese JL, Tarassoff P, Plunkett W. Saturation of 2’,2’-difluorodeoxycytidine 5’-
triphosphate accumulation by mononuclear cells during a phase I trial of gemcitabine. Cancer
Chemother Pharmacol 1991;27:258-262.
6. Kirch HC, Schroder J, Hoppe H, Esche H, Seeber S, Schutte J. Recombinant gene products of two
natural variants of the human cytidine deaminase gene confer different deamination rates of
cytarabine in vitro. Exp Hematol 1998;26:421-425.
7. Kirch HC, Schroder J, Hoppe H, Esche H, Seeber S, Schutte J. Recombinant gene products of two
natural variants of the human cytidine deaminase gene confer different deamination rates of
cytarabine in vitro. Exp Hematol 1998;26:421-425
8. Wachters FM, Van Putten JW, Kramer H, Erjavec Z, Eppinga P, Strijbos JH, de Leede GP, Boezen HM,
de Vries EG, Groen HJ. First-line gemcitabine with cisplatin or epirubicin in advanced non-small-
cell lung cancer: a phase III trial. Br J Cancer 2003;89:1192-1199
9. Cockcroft DW, Gault MH. Prediction of creatinine clearance from serum creatinine. Nephron
1976;16:31-41
10. Freeman KB, Anliker S, Hamilton M, Osborne D, Dhahir PH, Nelson R, Allerheiligen SR. Validated as-
says for the determination of gemcitabine in human plasma and urine using high-performance
liquid chromatography with ultraviolet detection. J Chromatogr B Biomed Appl 1995;665:171-
181
11. Abbruzzese JL, Grunewald R, Weeks EA, Gravel D, Adams T, Nowak B, Mineishi S, Tarassoff P, Satter-
lee W, Raber MN, et al. A phase I clinical, plasma, and cellular pharmacology study of gemcitabine.
J Clin Oncol 1991;9:491-498.
12. Conte PF, Gennari A, Donati S, Salvadori B, Baldini E, Bengala C, Pazzagli I, Orlandini C, Danesi R,
Fogli S, Del Tacca M. Gemcitabine plus epirubicin plus taxol (GET) in advanced breast cancer: a
phase II study. Breast Cancer Res Treat 2001;68:171-179.
13. van Moorsel CJ, Kroep JR, Pinedo HM, Veerman G, Voorn DA, Postmus PE, Vermorken JB, van
Groeningen CJ, van der Vijgh WJ, Peters GJ. Pharmacokinetic schedule finding study of the com-
Chapter 9
174
Gemcitabine pharmacokinetics and pharmacogenetics
175
bination of gemcitabine and cisplatin in patients with solid tumors. Ann Oncol 1999;10:441-448
14. Kinoshita A, Kurosawa Y, Kondoh K, Suzuki T, Manabe A, Inukai T, Sugita K, Nakazawa S. Effects
of sodium in hydration solution on plasma methotrexate concentrations following high-dose
methotrexate in children with acute lymphoblastic leukemia. Cancer Chemother Pharmacol
2003;51:256-260
15. Relling MV, Fairclough D, Ayers D, Crom WR, Rodman JH, Pui CH, Evans WE. Patient characteristics
associated with high-risk methotrexate concentrations and toxicity. J Clin Oncol 1994;12:1667-
1672
16. Plunkett W, Huang P, Xu YZ, Heinemann V, Grunewald R, Gandhi V. Gemcitabine: metabolism,
mechanisms of action, and self-potentiation. Semin Oncol 1995;22(4 Suppl 11):3-10
17. Yue L, Saikawa Y, Ota K, Tanaka M, Nishimura R, Uehara T, et al. A functional single-nucleotide
polymorphism in the human cytidine deaminase gene contributing to ara-C sensitivity. Pharma-
cogenetics 2003;13:29-38
Summary
178
Summary
179
View from the sky. Chicago, USA 2003.
Summary
178
Summary
179
Summary
Pyrimidine antagonists belong to the group of antimetabolite anti-cancer drugs and
show structural resemblance with naturally occurring nucleotides. Their action is accom-
plished through the incorporation as false precursors in DNA or RNA or through inhibi-
tion of proteins involved in nucleotide metabolism. The most commonly used pyrimi-
dine antagonists are 5-fluorouracil, gemcitabine and cytarabine. Newer oral variants of
5-fluorouracil are capecitabine and tegafur. 5-Fluorouracil and its analogues are used e.g.
in the treatment of colorectal-, breast- and head and neck cancer, whereas gemcitabine
is especially prescribed for non-small cell lung cancer and pancreatic cancer. Cytarabine
is used in the treatment of leukemia. All pyrimidine antagonists are prodrugs and in-
tracellular conversion into cytotoxic nucleosides and nucleotides is needed to produce
cytotoxic metabolites. Proteins, involved in pyrimidine metabolism handle these synthetic
drugs, as if they were naturally occurring substrates. The extensive metabolism of pyrimi-
dine antagonists implies that the intracellular concentrations of cytotoxic metabolites,
largely depend on intracellular metabolic enzyme activity. Therefore, understanding of
the genetics of metabolizing enzymes and the range of (iso)enzyme kinetics involved is
essential for the optimal subscription of these anticancer drugs.
In this thesis, a number of pharmacokinetic and pharmacogenetic aspects of pyrimidine
antagonist chemotherapy are evaluated in relation to safe use of these agents. Better
knowledge of factors that have critical impact on pharmacokinetics and/or pharmacody-
namics may help to reduce the incidence of side effects.
Genetic factors at least partly explain interindividual variation in anti-tumor efficacy
and toxicity of pyrimidine antagonists. In chapter 2, proteins relevant for the efficacy
and toxicity of pyrimidine antagonists are described. In addition, the role of germ-line
polymorphisms, tumor specific somatic mutations and protein expression levels in the
metabolic pathways and clinical pharmacology of these drugs are discussed. With respect
to the 5-fluorouracil metabolic pathway, germ-line polymorphisms have been reported
in uridine monophosphate kinase (UMPK), orotate phosphoribosyl transferase (OPRT),
thymidylate synthase (TS), dihydropyrimidine dehydrogenase (DPD), and methylene
tetrahydrofolate reductase (MTHFR). The impact of most germ-line polymorphisms is not
yet clear. Mutations in the dihydropyrimidine dehydrogenase gene are however highly
associated with DPD enzyme deficiency and can result in life threatening toxicity after
5-fluorouracil chemotherapy due to reduced 5-fluorouracil catabolism. Furthermore, the
impact of a triple tandem repeat polymorphism in the promoter enhancer zone of the
thymidylate synthase gene has been studied in a number of small trials, but remains to be
established.
In addition, intratumoral gene expression levels of uridine monophosphate kinase, orotate
Summary
180
Summary
181
phosphoribosyl transferase, thymidylate synthase, dihydropyrimidine dehydrogenase,
uridine phosphorylase, uridine kinase, thymidine phosphorylase, thymidine kinase, and
dUTP nucleotide hydrolase have been studied in relation to 5-fluorouracil efficacy. Most
interesting results have been reported with respect to dihydropyrimidine dehydrogenase,
thymidylate synthase, thymidine phosphorylase, and orotate phosphoribosyl transferase
expression levels. High intratumoral expression levels of both dihydropyrimidine dehy-
drogenase and thymidylate synthase may be associated with decreased sensitivity of
tumor cells to 5-fluorouracil, but this remains to be established.
Regarding the gemcitabine and cytarabine metabolic pathway, germ line polymorphisms
in cytidine deaminase (CDA) and 5’-nucleotidase (5NT) have been reported, but the
impact of these polymorphisms on the efficacy of these drugs is hardly explored. Interest-
ing results were obtained with regard to intratumoral gene expression levels of cytidine
deaminase, 5’-nucleotidase and deoxycytidine kinase in relation to cytarabine efficacy,
but these need to be further explored in larger clinical trials.
In section A, involving chapters 3, 4.1, 4.2 and 5, several pharmacokinetic and pharma-
cogenetic aspects of 5-fluorouracil in colorectal cancer patients are explored.
A simple and sensitive high performance liquid chromatographic method with UV
detection was developed for the determination of both 5-fluorouracil and its metabo-
lite 5,6-dihydrofluorouracil in small volume plasma samples. The method is presented in
chapter 3. It is characterized by isocratic elution at ambient temperature on a C18 5 µm
column and subsequent ultraviolet diode array detection. The limits of quantification in
plasma were 0.040 µg /mL for 5-fluorouracil and 0.075 µg/mL for 5,6-dihydrofluorouracil.
The method appeared linear over a range from 0.04-15.90 µg/mL for 5-fluorouracil, and
from 0.075-3,84 µg/mL for 5,6-dihydrofluorouracil. Compared to previous methods, the
extraction procedure was simplified and the required sample size was reduced to only
100 µL.
The impact of liver metastases and liver function on 5-fluorouracil pharmacokinetics has
long remained unclear. In most clinical trials, only patients with good performance status
and adequate organ functions are included. However in actual practice, many patients
with compromised performance status and/or inadequate renal or liver function are
treated with chemotherapy.
In chapter 4.1 the influence of liver metastases on the pharmacokinetics of 5-fluorouracil
and its metabolite 5,6-dihydrofluorouracil is described in 33 patients with gastrointes-
tinal cancers. Patients were assigned to two different groups based on the presence or
absence of liver metastases. Chemotherapy consisted of 5-fluorouracil plus leucovorin
according to the Mayo Clinics schedule. Blood sampling was carried out on the first day
of the first chemotherapy cycle. A multi-compartiment Michaelis-Menten model was
developed for simultaneous analysis of 5-fluorouracil and 5,6-dihydrouracil pharmaco-
kinetic data. Extensive hepatic replacement due to liver metastases did not influence
Summary
180
Summary
181
the clearance of 5-fluorouracil and its metabolite. From the study it was concluded
that there is no need for dose adjustment of 5-fluorouracil as a standard procedure in
patients with liver metastases and mild to moderate elevations in liver function tests.
One of the patients who participated in the liver metastases study experienced more
than expected toxicity. Further research was subsequently initiated to elucidate the
cause of this and results are presented in chapter 4.2. 5-Fluorouracil pharmacokinetics,
dihydropyrimidine dehydrogenase-activity and DNA sequence analysis were compared
between an index patient with extreme 5-fluorouracil induced toxicity and six control
patients with normal 5-fluorouracil related symptoms. The 5-fluorouracil area under
the curve (AUC) in the index patient was about 2.5 timer higher, and the clearance 2.5
times lower than in control patients. The activity of dihydropyrimidine dehydrogenase
in blood mononuclear cells of the index patient was 50% of that in controls. Sequence
analysis of the dihydropyrimidine dehydrogenase gene revealed that the index patient
was heterozygous for a IVS14+1G→A point mutation. These results indicate that the
inactivation of one dihydropyrimidine dehydrogenase allele can result in a strong
reduction in 5-fluorouracil clearance, causing severe 5-fluorouracil induced toxicity.
The case of the dihydropyrimidine dehydrogenase deficient patient illustrates the impact
of dihydropyrimidine dehydrogenase deficiency on 5-fluorouracil pharmacokinetics. The
prevalence of dihydropyrimidine dehydrogenase deficiency has been estimated 1-2% in
the Caucasian population. During the last decade, several methods have been proposed
for early detection of dihydropyrimidine dehydrogenase deficiency, including genotyp-
ing, measurement of endogenous uracil/dihydrouracil plasma levels and measurement
of dihydropyrimidine dehydrogenase activity in peripheral mononuclear blood cells. For
general large scale purposes however, these methods are too expensive and/or lack sen-
sitivity.
Therefore, the pharmacokinetics of uracil after oral administration was studied with the
aim to develop a cheap and easy oral Uracil Challenge Test. Chapter 5 contains a prelimi-
nary report about the potential clinical use of such a test for dihydropyrimidine dehydro-
genase phenotyping. The pharmacokinetics of uracil and its metabolite 5,6-dihydrouracil
after oral administration of an uracil challenge dose were studied in 12 human volun-
teers and in one patient with dihydropyrimidine dehydrogenase deficiency. All subjects
ingested 500 mg/m2 uracil as an oral solution on an empty stomach. Blood sampling was
carried out during 4 h after oral intake. All volunteers had dihydropyrimidine dehydroge-
nase activities within normal range, but in the patient it was reduced due to heterozygos-
ity for missense mutation D949V in exon 22 and I543V polymorphism in exon 13 of the
dihydropyrimidine dehydrogenase gene. Uracil plasma concentrations at 1 and 2 h and
the uracil AUC were increased in the patient and differed more than 2 standard deviations
from mean values in volunteers. These preliminary results indicate that further research in
a larger number of previously characterized, partially dihydropyrimidine dehydrogenase
Summary
182
Summary
183
deficient patients is warranted, to determine its use in pre-chemotherapy phenotyping for
early detection of dihydropyrimidine dehydrogenase deficiency.
In section B, involving chapters 6, 7, 8, and 9, focus is placed on clinical pharmacologi-
cal, pharmacokinetic and pharmacogenetic aspects of gemcitabine in the treatment of
patients with non-small cell lung cancer.
Gemcitabine has been recognized as a potent radiosensitizer, and as such, an interesting
candidate for pre-radiotherapy radiosensitization in non-small cell lung cancer patients.
The mechanism of gemcitabine mediated radiosensitization is yet poorly understood.
Inhibition of DNA double-strand break repair by nonhomologous end-joining was previ-
ously excluded as a means of radiosensitization. In chapter 6 is explored whether gem-
citabine affects either homologous recombination-mediated double strand break repair
or base excision repair. Gemcitabine-mediated radiosensitization in cell lines deficient
in base excision repair or deficient in homologous recombination were compared with
that in their base excision repair-proficient and homologous recombination-proficient
parental counterparts. Sensitization to mitomycin C was also investigated in cell lines
deficient and proficient in homologous recombination. Mitomycine C is known to cause
DNA double strand breaks by interstrand cross-links and repair of these cross-links is es-
pecially dependent on homologous recombination. In addition, the effect of gemcitabine
on Rad51 foci formation after irradiation was studied. Rad51 foci are thought to represent
homologous recombination. Gemcitabine did induce radiosensitization in base excision
repair-deficient cells; however, the respective mutant cells deficient in homologous re-
combination did not show gemcitabine-mediated radiosensitization. In homologous re-
combination-proficient, but not in homologous recombination-deficient cells, gemcitabi-
ne also induced substantial enhancement of the cytotoxic effect of mitomycine. Finally,
it was observed that gemcitabine interferes with Rad51 foci formation after irradiation.
From this study was concluded that gemcitabine causes radiosensitization by specific
interference with homologous recombination.
A frequently prescribed chemotherapy schedule for the treatment of stage IIIB/IV non-
small cell lung cancer is the combination of gemctabine with cisplatin. Unfortunately,
cisplatin can cause nephro-, neuro-, and ototoxicity. Moreover, cisplatin administration
requires pre- and post hydration. The combination of gemcitabine plus epirubicin has
been proposed as an alternative treatment schedule, that can be administered in out-
patient setting. This schedule was well tolerated in phase 1/2 clinical trials. Mucositis was
reported as the main non-hematological toxicity. Therefore the excretion of gemcitabine
and epirubicin in saliva was studied in non-small cell lung cancer patients treated with
both drugs, in order to estimate the relative contribution of salivary excretion to total drug
exposure of mucosal cells in the oral cavity and upper gastrointestinal tract.
The high performance liquid chromatography (HPLC) method used for determination of
Summary
182
Summary
183
epirubicin and epirubicinol in plasma and saliva is described in chapter 7. Preparation of
saliva and plasma samples was performed by extraction in organic extraction fluid. The
chromatographic analysis was carried out by reversed-phase isocratic elution on a C18 5
µm column. The detection was performed with spectrofluorimetry. The method appeared
linear over a concentration range of 5 to 1000 µg/L for epirubicin and 2 to 400 µg/L for
epirubicinol in both saliva and plasma. The lower limit of quantification was 5 µg/L for
epirubicin and 2 µg/L for epirubicinol. The method proved to be precise and accurate.
The excretion in saliva of gemcitabine and epirubicin and their main metabolites dFdU
and epirubicinol was studied in 12 patients and is described in chapter 8. Gemcitabine
was detectable in saliva only during the first hour after infusion. The Cmax
in saliva was 0.66
± 0.61 mg/L and the saliva/plasma ratio was 0.038 ± 0.037. The epirubicin concentration in
saliva 6 h after administration was 55 ± 27 µg/L and decreased to 28 ± 14 µg/L at 22 h. The
corresponding saliva/plasma ratios were 1.28 ± 0.73 and 1.72 ± 1.00. The absolute amount
of drug excreted in saliva was for both anticancer agents estimated under 0.2% of the ad-
ministered dose. Is was therefore concluded that, although gemcitabine and epirubicin as
well as their main metabolites dFdU and epirubicinol are excreted in detectable amounts
in saliva, their absolute amounts in saliva remain relatively low.
Another issue that was explored in this thesis concerns the possible pharmacokinetic in-
teraction of gemcitabine and epirubicin when both drugs are used concurrently. Only few
reports are available with respect to the pharmacokinetics of this particular drug com-
bination. Information on pharmacokinetic and pharmacodynamic interactions of anti-
cancer drugs is essential for optimizing the efficacy-toxicity ratio of a treatment schedule.
Therefore a study was initiated to determine the pharmacokinetics of gemcitabine in
gemcitabine-epirubicin compared to gemcitabine-cisplatin treated non-small cell lung
cancer patients. Additionally, the effect of a common A79C polymorphism in the cytidine
deaminase gene in relation to gemcitabine pharmacokinetics was explored. The results of
this study are presented in chapter 9. Patients were treated with gemcitabine followed by
epirubicin (n=12) or cisplatin (n=10). Plasma was collected during 3 h after administration
of gemcitabine. The pharmacokinetics of gemcitabine was similar in both treatment groups.
The half-life of 2’,2’ difluorodeoxyuridine was larger in epirubicin- compared to cisplatin
co-treated patients. Although the renal function was about 20% better in gemcitabine-
cisplatin treated patients, we only found a weak correlation between 2’,2’ difluorodeoxy-
uridine clearance and serum creatinine (R=0.39) or glomerular filtration rate (GFR; R=0.40)
in a spearman rank correlation analysis. This suggests that, apart from renal function, also
another factor contributes to the observed difference.
We hypothesized that this might be due to increased 2’,2’-difluorodeoxyuridine excretion
and/or tissue disposition, as a result of pre-hydration measures, necessary for cisplatin
administration. Another possibitly could be an interaction of epirubicin or cisplatin with
Summary
184
2’,2’-difluorodeoxyuridine. Since 2’,2’-difluorodeoxyuridine has no cytotoxic potential, the
observed difference was considered as clinically irrelevant.
The influence of the cytidine deaminase A79C genotype was studied in 20 patients. PCR
plus DNA sequencing was performed to determine the genotype. A trend towards slightly
higher AUC (+16%) and little lower clearance values (-11%) was observed in individuals het-
erozygous or homozygous for the C-genotype (C/C; A/C; n=12), compared to homozygotes for
the A-genotype (A/A; n=8). Based on these data, it can be calculated that at least 120 patients
would be required to elucidate the precise role of the A79C polymorphism. It was concluded
that the pharmacokinetics of gemcitabine is similar in epirubicin- compared to cisplatin
co-treated patients. There was a small 10-15%, not significant influence of a common
A79C polymorphism in the cytidine deaminase gene on gemcitabine pharmacokinetics.
186
General discussion and future perspectives
187
Back to the future. NASA. Florida USA 2002.
186
General discussion and future perspectives
187
General discussion en future perspectives
The aim of this thesis was to clarify the role of a number of potential factors in the clinical
pharmacology and pharmacogenetics of pyrimidine antagonists related to the occur-
rence of side effects.
To date, the impact of genetic testing in clinical practice is only minor and mainly re-
stricted to patients with specific pharmacogenetic syndromes, such as dihydropyrimidine
dehydrogenase deficiency. In the near future, possibly as a result of further development
of micro-array techniques, a process of tumor “chemotyping” might precede drug dosing.
Based on germ-line DNA polymorphisms combined with tumor specific mRNA or protein
expression patterns, individualization of chemotherapy may become daily practice. Pre-
diction of non-responders can prevent unnecessary treatment and save treatment costs,
but far more large clinical trials are needed to elucidate, optimize and validate such an
approach.
In the mean time, a 1-2% prevalence of dihydropyrimidine dehydrogenase deficiency in
the population can not be fully ignored in relation to the high number of patients that
are each year treated with 5-fluorouracil. A Number Needed to Genotype in the range
of 50-100 patients to prevent one serious event has so far been considered as too high
to justify routine screening, due to high costs of current screening methods. However, a
Uracil Challenge Test, as proposed in this thesis, may be an effective approach for routine
pre-chemotherapy dihydropyrimidine dehydrogenase phenotyping at reasonable cost.
Very preliminary results of this approach at least indicate that further research in a larger
number of previously characterized, partially dihydropyrimidine dehydrogenase deficient
patients is warranted to establish the sensitivity of this method. In the near future, the
use of LC-MS/MS techniques in stead of standard HPLC for analysis of uracil may even
minimize sample preparation and increase sample throughput time.
With respect to gemcitabine, a small impact of the cytidine deaminase A79C genotype
on the pharmacokinetics was observed. The current findings, however, do not exclude the
A79C polymorphism from a larger panel of factors that together determine the interindi-
vidual variation in gemcitabine pharmacokinetics. We calculated that at least 120 patients
are needed to elucidate the exact role of the A79C polymorphism for gemcitabine phar-
macokinetics. Since, recently, a number of new polymorphisms in the cytidine deaminase
gene have been discovered, a combined analysis of all known polymorphisms in relation
to gemcitabine pharmacokinetics may be needed to establish the impact of genetic
factors on cytidine deaminase mediated gemcitabine catabolism more precisely.
We observed that in tumor cell lines gemcitabine causes radiosensitization by specific
interference with homologous recombination, while non-homologous end-joining and
base excision repair are unaffected. It is however yet unclear which step in the pathway of
homologous recombination is inhibited. Based on current results, it was speculated that
188
gemcitabine might interfere with the DNA polymerization step in homologous recombi-
nation, thereby halting the process. This has to be established experimentally. Based on
current and previous in vitro data, we hypothesized that gemcitabine may be a tumor-
selective radiosensitizer. This, however, has so far not been confirmed in current clinical
trials investigating gemcitabine induced radiosensitization in locally advanced non-small
cell lung cancer. In recent phase I/II clinical trials the feasibility of gemcitabine/radiation
therapy has been shown with potential interesting results. Additional clinical trials are
warranted to assess the long-term efficacy and safety of gemcitabine in combination with
other chemotherapeutic agents and radiation therapy.
Regarding the impact of a number of non-inherited factors on pyrimidine antagonist
chemotherapy, this thesis showed that hepatic replacement due to liver metastases with
concurrent mild to moderate elevations in liver function tests has minor impact on the
pharmacokinetics of 5-fluorouracil. The dihydropyrimidine dehydrogenase activity in
liver metastases appears largely to compensate the dihydropyrimidine dehydrogenase
activity of replaced liver tissue. As a result, 5-fluorouracil dose reduction should not be
performed as a standard procedure in patients with liver metastases, accompanied by
mild to moderate elevations in liver function tests. Since, no patients with CTC grade 4
disturbances in liver function tests were included in the study, it is still unclear whether
dose reduction may be needed in this subgroup.
The last issue explored in this thesis, is the pharmacokinetic interaction of gemcitabine
and epirubicin. Both drugs appear not to interact with respect to plasma pharmacokinet-
ics. This implicates that schedule optimization procedures to improve efficacy may include
variations in the order of drug administration (gemcitabine before epirubicin or the
reverse) without consequences for pharmacokinetics. However, the use of this anticancer
drug combination has been terminated based on phase 3 trial results. Progression-free
survival, overall survival, response rate, and quality of life were not different between the
gemcitabine-epirubicin and gemcitabine-cisplatin combination, however, overall toxicity
was more severe in the gemcitabine-epirubicin arm. Therefore, further exploration of this
treatment schedule in non-small cell lung cancer is no current topic.
Samenvatting
190
Samenvatting
191
Klompen, Molens &…Kaas. Alkmaar 1998.
Samenvatting
190
Samenvatting
191
Samenvatting
Pyrimidine-antagonisten zijn antikanker-medicijnen die wat betreft hun chemische
structuur grote gelijkenis vertonen met in het lichaam voorkomende bouwstenen van
DNA en RNA. Door deze grote overeenkomst worden ze door het lichaam ingebouwd in
het DNA of RNA. Als gevolg hiervan ontstaan fouten in de DNA- en RNA-structuur en kan
celdeling niet meer plaatsvinden. Verder kan door pyrimidine-antagonisten blokkering
van eiwitten plaatsvinden die een rol spelen in de opbouw van het DNA of RNA. Dit alles
resulteert in afsterving van de cel.
DNA duplicatieDNA bestaat uit een dubbelstrengs gedraaide helix. De erfelijke code is vastgelegd in de volgorde van de bouw-stenen, die worden aangeduid met de letters A, C, G en T. Binnen de dubbele helix zijn de twee strengen met elkaar verbonden: tegenover elke A past alleen een T, tegenover elke C past alleen een G. Hierdoor is DNA in staat zichzelf te kopiëren: door de dubbele streng uit elkaar te draaien en op elke enkele streng tegenover elke vrijgekomen A, C, G of T positie de passende bouwsteen te plaatsen ontstaan twee nieuwe dubbelstrengs DNA ketens.
� � � � � � �
� � � � � � �
� � � � � � �
� � � � � � �
� � � � � � �
� � � �� � � � � � �
� � � � � � �
� � � � � � �� � � �
� � � � � � �
� � � � � � �
� � � �
Door ingebouwde cytostatica (X), onstaan fouten in de DNA code. Het kopieerproces loopt mis of stopt en de cel kan niet meer delen en sterft af.
Veel toegepaste pyrimidine-antagonisten zijn 5-fluorouracil, gemcitabine en cytarabine.
Nieuwe varianten van 5-fluorouracil zijn capecitabine en tegafur.
5-Fluorouracil wordt toegepast bij de behandeling van dikke-darmkanker, borstkanker en
hoofd- en hals tumoren. Gemcitabine wordt vooral bij longkanker en bij alvleesklierkan-
ker toegepast, cytarabine hoofdzakelijk bij de behandeling van leukemie. Alle pyrimidine-
antagonisten zijn zogenaamde pro-drugs. Ze moeten namelijk in het lichaam geactiveerd
worden voordat ze hun toxische werking kunnen uitoefenen. Dit betekent dat de hoeveel-
heid geactiveerde stof in tumorcellen mede afhankelijk is van de mate van activering
door lichaamseigen eiwitten. Een goed inzicht in de farmacogenetische aspecten en
werkingswijze van eiwitten die betrokken zijn bij de activering van pyrimidine-antagonis-
ten is dus belangrijk om deze middelen optimaal te kunnen doseren.
Samenvatting
192
Samenvatting
193
Een belangrijk doel van de kankerbehandeling is ervoor te zorgen het maximale
antitumor-effect te bewerkstelligen, terwijl de bijwerkingen zo beperkt mogelijk blijven.
Genetische factoren bepalen mede de eiwitactiviteit en verklaren daarom ook deels de
interindividuele verschillen in antitumor-effectiviteit en toxiciteit van pyrimidine-antago-
nisten.
Van DNA naar eiwitDNA codeert voor eiwitten. Eiwitten zijn opgebouwd uit reeksen aminozuren. In het menselijk lichaam worden 20 verschillende aminozuren toegepast in eiwitten. Om van DNA tot eiwit te komen wordt één van de DNA strengen afgelezen, waarbij een enkele streng RNA wordt gevormd. Dit proces heet DNA transcriptie. De bouw-stenen van RNA zijn gelijk aan die van DNA, met één uitzondering: op de plaats van T komt een U. Een set van drie bouwstenen van RNA (een codon) correspondeert met 1 aminozuur van de te vormen eiwitketen.
����� �
� � � � � � � � �
� � � � � � � � �
� � � � � � � � � ��� � ��� � �������� � ����� �
Hier codeert UGG voor het aminozuur tryptofaan (Trp), UCU voor serine (Ser) en AAU voor asparagine (Asn). De stap van RNA naar eiwit heet translatie.
Figuur 1 Verschillende factoren hebben invloed op de werking van een geneesmiddel. Dit zijn enerzijds erfelijke factoren, anderzijds ‘omgevingsfactoren’. Alle factoren tezamen bepalen de mate van werkzaamheid van een middel op individueel niveau.
��������� ��������
�������
��������������
�����
������ �� �������
�����������
��������
��������
�������������
������
�������������
�������
In dit proefschrift zijn een aantal farmacokinetische en farmacogenetische aspecten van
pyrimidine-antagonisten onderzocht in relatie tot veiliger gebruik van deze medicijnen.
Farmacokinetiek bestudeert het gedrag van een geneesmiddel in het lichaam, zoals
verdeling naar weefsel, omzetting in inactieve stoffen en uitscheiding door nieren en
lever. Farmacogenetica bestudeert de relatie tussen werking van het geneesmiddel en
gencodering in het DNA.
In hoofdstuk 2, een literatuurstudie, worden de enzymen, waarvan bekend is dat ze een
Samenvatting
192
Samenvatting
193
rol spelen in het metabolisme van pyrimidine-antagonisten op een rij gezet. Vervolgens
wordt de rol van DNA polymorfismen in de kiembaan (variaties in DNA-codering), van tu-
morcelspecifieke somatische DNA mutaties (in de tumorcel ontstane DNA veranderingen)
en van eiwitactiviteit voor elk enzym apart besproken.
DNA mutaties en DNA polymorfismen in de kiembaanDNA codeert voor eiwitten. In de erfelijke code van het DNA komen echter natuurlijke variaties voor. Als een variatie in meer dan 1% van de populatie voorkomt heet dit een polymorfisme. Meer zeldzame variaties heten mutaties. De meeste polymorfismen zijn veranderingen in slechts 1 bouwsteen van de DNA keten. Deze kunnen echter enorme gevolgen hebben voor de werkzaamheid en/of functie van het eiwit waarvoor het codeert. Hieronder een voorbeeld:DNA, RNA en eiwit van persoon 1:
� � � � � � � � � � � � � � � � � � ��� � ��� � ���
� � � � � � � � � � � � � � � � � � ��� � ��� � ���
In persoon 2 is op de derde positie in het DNA de C veranderd in een A. Dit heeft tot gevolg dat in RNA wordt gecodeerd voor UGU, wat correspondeert met aminozuur cysteïne (Cys). De eigenschappen van het eiwit kunnen hierdoor zijn veranderd. Als bijvoorbeeld het eiwit de afbraak van een geneesmiddel bepaalt en het eiwit in persoon 1 is daarin effectiever dan dat van persoon 2, dan blijft het geneesmiddel langer in het lichaam van persoon 2. Dosisaanpassing kan nodig zijn.
Somatische mutatiesVeranderingen in het DNA kunnen ook optreden tijdens een levenscyclus van een cel. Meestal vindt reparatie plaats van fouten in DNA. Als een fout niet wordt opgemerkt en wordt doorgegeven aan dochtercellen heet dit een somatische mutatie. Een kritische somatische mutatie kan grote gevolgen hebben voor de dochtercellen. Kanker wordt veroorzaakt door een reeks van somatische mutaties in genen die een rol spelen bij celdeling en celgroei.
Uit deze literatuurstudie blijkt dat studies naar de invloed van tumorcelspecifieke so-
matische DNA-mutaties op de effectiviteit en bijwerkingen van de behandeling met
pyrimidine-antagonisten tot dusver klein van opzet zijn. Het is nagenoeg onmogelijk om
conclusies te trekken uit beschikbare onderzoeksgegevens, wegens onvoldoende sta-
tistische onderbouwing, verschillen in onderzoekspopulatie en onderzoekstechnieken.
Daarentegen is met betrekking tot DNA polymorfismen in de kiembaan in de afgelopen
jaren duidelijk geworden dat bij patiënten met defecten aan het dihydropyrimidine-
dehydrogenase-gen zeer ernstige bijwerkingen kunnen optreden na toediening van 5-
fluorouracil. Dit gendefect komt voor bij ongeveer 1-2% van de bevolking. Screening op
een tekort aan dihydropyrimidine-dehydrogenase (DPD-deficiëntie) voorafgaand aan de
5-fluorouracil toediening wordt momenteel echter nog te duur geacht.
De precieze rol van genetica voor de dagelijkse praktijk ten aanzien van de behandeling
met pyrimidine-antagonisten is voor de korte termijn dus nog onduidelijk. DNA-onderzoek
Samenvatting
194
Samenvatting
195
wordt momenteel vooral ingezet om zogenaamde farmacogenetische syndromen, zoals
dihydropyrimidine-dehydrogenase-deficiëntie vast te stellen. Gezien de snelle ontwik-
kelingen op het gebied van DNA- en RNA-diagnostiek wordt het in de toekomst wellicht
mogelijk om patiënten te “chemotyperen” voorafgaand aan het voorschrijven van een
chemotherapiekuur. Op basis van familiair overgeërfde DNA-kenmerken in combinatie
met de tumorspecifieke genetische eigenschappen zou dan voor ieder individu het
meest optimale chemotherapieschema kunnen worden vastgesteld. Voorspelling van
non-responders (personen die geen baat hebben van de therapie) kan dan onnodige
behandeling met dure chemotherapie voorkomen. Er is echter nog heel veel onderzoek
nodig voordat dit scenario toepasbaar is in de dagelijkse praktijk.
Sectie A van dit proefschrift omvat de hoofdstukken 3, 4.1, 4.2 en 5 en belicht verschil-
lende farmacokinetische en farmacogenetische aspecten van de behandeling met het
antikankermiddel 5-fluorouracil. Een vast onderdeel van farmacokinetisch onderzoek
is het meten van geneesmiddelconcentraties in bloed. Om deze metingen te kunnen
uitvoeren, werd een eenvoudige en gevoelige Hoge Druk Vloeistof Chromatografie (HPLC)
analysemethode ontwikkeld voor het aantonen van 5-fluorouracil en het afbraakproduct
5,6-dihydrofluorouracil. De methode wordt beschreven in hoofdstuk 3. Ten opzichte van
eerder in de literatuur beschreven methoden werd de extractieprocedure vereenvoudigd
en werd het benodigd monstervolume verlaagd naar 100 microliter.
Een van de aspecten van 5-fluorouracil behandeling waarover lang onduidelijkheid heeft
bestaan is de invloed van levermetastasen (uitzaaiingen in de lever) en de daaraan ge-
relateerde verstoring van de leverfunctie op de farmacokinetiek van 5-fluorouracil. In de
meeste grote klinische onderzoeken worden namelijk uitsluitend patiënten toegelaten
die een normale lever- en nierfunctie hebben.
Hoofdstuk 4.1 beschrijft het onderzoek naar de invloed van levermetastasen op de
farmacokinetiek van 5-fluorouracil en 5,6 dihydrofluorouracil in patiënten met colon- of
rectumkanker. De patiënten werden verdeeld over twee groepen, op basis van aan- of
afwezigheid van levermetastasen. De behandeling bestond voor alle patiënten uit een
Leverfunctie en levermetastasenDe uitscheiding van geneesmiddelen uit het lichaam vindt meestal plaats via de lever of de nieren. De lever is een soort chemische fabriek, waar allerlei stoffen die het lichaam binnenkomen (meestal via maagdarmkanaal) chemisch worden aangepast om ze geschikt te maken voor uitscheiding via de gal of de nieren. Levermetastasen bestaan uit kankerweefsel afkomstig van een primaire tumor. Bij colonkanker kunnen er dus uitzaaiingen van de oorspronkelijke tumor in de lever zijn. Dit weefsel verdringt het bestaande leverweefsel. Bij uitgebreide verdring-ing van leverweefsel door kankerweefsel kan de functie van de lever als chemische fabriek onder druk komen te staan. Gelukkig heeft de lever een enorme overcapaciteit.
Samenvatting
194
Samenvatting
195
combinatie van 5-fluorouracil met folinezuur volgens het zogenaamde Mayo-Clinics-
schema. Er werd geen effect van levermetastasen op de bloedconcentraties van beide
verbindingen vastgesteld. De studie toont aan dat dosisaanpassing van 5-fluorouracil
niet noodzakelijk is in patiënten die levermetastasen en lichte tot matige verhogingen in
leverfunctiewaarden hebben. Bij één van de patiënten in deze studie uit de groep zonder
levermetastasen traden kort na chemotherapie zeer ernstige bijwerkingen op. Verder
onderzoek is daarom uitgevoerd om de oorzaak hiervan te achterhalen. De resultaten van
dit onderzoek worden beschreven in hoofdstuk 4.2.
De farmacokinetiek van 5-fluorouracil, de activiteit van het dihydropyrimidine-dehy-
drogenase-enzym in witte bloedcellen en de DNA-defecten in het dihydropyrimidine-
dehydrogenase-gen zijn onderzocht in de patiënt met ernstige bijwerkingen en in een
zestal controlepatiënten met voorspelbare aan de therapie gerelateerde bijwerkingen. De
oppervlakte onder de plasmaconcentratie-tijd curve, een maat voor blootstelling aan het
medicijn, was in de patiënt met bijwerkingen 2,5 maal groter dan in de controlepatiënten.
De verdwijningsnelheid van 5-fluorouracil uit plasma was 2,5 maal lager. De activiteit van
het dihydropyrimidine-dehydrogenase-enzym, gemeten in witte bloedcellen, was in de
patiënt met bijwerkingen 50% van die in de controlegroep. Uit onderzoek op DNA niveau
aan het dihydropyrimidine-dehydrogenase-gen bleek dat de patiënt met ernstige bijwer-
kingen heterozygoot was voor een specifieke mutatie (IVS14+1G→A) in het gen. Deze
resultaten laten zien dat een tekort aan dihydropyrimidine-dehydrogenase-eiwit een
sterke vermindering in de afbraak van 5-fluorouracil tot gevolg kan hebben, waardoor
zeer ernstige bijwerkingen optreden bij toepassing van een standaarddosering.
Homozygoot of heterozygootIeder mens beschikt over een dubbele set chromosomen. De ene set is afkomstig van vader, de andere van moeder. Op beide sets kunnen polymorfismen voorkomen. Als een persoon homozygoot is voor een bepaald genotype, betekent dit dat van zowel vader als moeder hetzelfde gen is overgeërfd. Als iemand heterozygoot is, dan is het genpaar van vader en moeder verschillend. In het geval van heterozygotie voor een IVS14+1G→A mutatie in het dihydropyrimidine-dehydrogenase gen erft iemand van één van beide ouders (meestal) het normale gen, dat werkzaam eiwit oplevert, en van de andere ouder een gen dat resulteert in een onwerkzaam eiwit. Van alle gevormde dihydropyrimidine-dehydrogenase eiwitmoleculen is bij deze persoon dus maar de helft actief.
In de afgelopen decennia zijn verschillende methoden beschreven om een dihydropyri-
midine-dehydrogenase-tekort vroegtijdig op te sporen. Hieronder vallen genotypering
van mutaties in het dihydropyrimidine-dehydrogenase-gen, meting van de verhouding
(ratio) tussen lichaamseigen uracil en dihydrouracil in bloedplasma, en meting van de
dihydropyrimidine-dehydrogenase-activiteit in witte bloedcellen. Deze methoden zijn
echter tot dusver niet gebruikt voor routinematige screening op grote schaal, vanwege
gebrek aan gevoeligheid van de methode of hoge kosten. Het meten van uracilconcen-
traties in bloed na toedienen van een testdosis uracil aan de patiënt zou misschien een
klinisch haalbare en betaalbare screeningsmethode kunnen zijn. In hoofdstuk 5 staan de
Samenvatting
196
Samenvatting
197
Genotypering en fenotyperingGenotypering is het vaststellen van de erfelijke code in DNA. De erfelijke code op de chromosomen afkomstig van vader en moeder bepalen gezamenlijk de eigenschappen van een individu, het fenotype. Het vaststellen van een bepaalde eigenschap in relatie tot overerving heet fenotypering. Een verandering in genotype hoeft niet altijd gevolgen te hebben voor het fenotype. Een voorbeeld is de overerving van oogkleur. Iemand kan drager zijn van een gen voor blauwe oogkleur, maar zelf bruine ogen hebben. Deze persoon is heterozygoot voor een bruin en een blauw gen. Dragers van twee genen voor bruine oogkleur (homozygoten) hebben ook bruine ogen. Aan de buitenkant (fenotype) zijn beide personen dus hetzelfde, maar genetisch (genotype) zijn ze verschillend.
voorlopige resultaten van een lopend onderzoek met een dergelijke test voor dihydropy-
rimidine-dehydrogenase-fenotypering beschreven.
De farmacokinetiek van uracil en zijn metaboliet 5,6 dihydrouracil werd onderzocht in
een twaalftal gezonde vrijwilligers en 1 patiënt met een dihydropyrimidine-dehydro-
genase-tekort. Alle deelnemers moesten op lege maag 500 mg/m2 uracil in drankvorm
innemen. Gedurende 4 uur na inname van de drank werden bloedmonsters afgenomen.
De verlaging van de enzymactiviteit in de patiënt bleek het gevolg te zijn van een tweetal
mutaties (D949V en I543V) in het dihydropyrimidine-dehydrogenase-gen. De uracil
plasma-concentraties gemeten 1 en 2 uur na inname van de drank en de oppervlakte
onder de plasmaconcentratie-tijd curve (als maat voor blootstelling) bleken ongeveer
verdubbeld in de patiënt in vergelijking met de vrijwilligers. De voorlopige resultaten zijn
dus hoopvol, maar nader onderzoek is nodig in een groter aantal patiënten met DPD-defi-
ciëntie om de waarde van de test voor screeningsdoeleinden vast te stellen.
Sectie B van dit proefschrift omvat de hoofdstukken 6, 7, 8 en 9 en gaat in op klinisch
farmacologische en farmacogenetische aspecten van het antikankermiddel gemcitabine
in patiënten met niet-kleincellig longcarcinoom.
Gemcitabine is een cytostaticum waarvan bekend is dat het cellen gevoeliger kan maken
voor de inwerking van gammastraling bij radiotherapie. Dit wordt radiosensitisatie
genoemd. Gemcitabine is daarom een interessante kandidaat voor radiosensitisatie
voorafgaand aan radiotherapie bij patiënten met niet-kleincellig longcarcinoom. Over
de manier waarop gemcitabine de cellen gevoeliger maakt voor straling is nog maar
weinig bekend. Onlangs is aangetoond dat dit in ieder geval niet gebeurt door ingrijpen
op het cellulair mechanisme voor reparatie van dubbele breuken in DNA, genaamd non-
homologe eind-koppeling. In hoofdstuk 7 wordt bekeken of gemcitabine mogelijk radio-
sensitisatie veroorzaakt door invloed op het proces van homologe recombinatie dan wel
door effecten op base excisie reparatie.
Samenvatting
196
Samenvatting
197
DNA reparatieFouten in DNA kunnen door diverse oorzaken ontstaan. Gelukkig worden deze fouten in de meeste gevallen direct herkend en gerepareerd, zodat de genetische code niet in gevaar komt.De belangrijkste reparatiemechanismen zijn:
1. Base Excisie Reparatie (BER). Hierbij wordt de foute bouwsteen (base) uit de keten verwijderd en vervangen door de juiste component.
2. Nucleotide Excisie Reparatie (NER). Hierbij wordt een korte reeks bouwstenen uit de DNA keten verwij-derd en vervangen door de juiste reeks.
3. Mismatch Reparatie (MMR). Hierbij worden reparaties uitgevoerd als er binnen de dubbele helix structuur een fout is ontstaan die de standaard A-T en C-G paring verstoort.
Bovendien kunnen door straling en sommige chemische stoffen breuken in het DNA ontstaan. Hierbij kunnen enkelstrengs of dubbelstrengs breuken optreden. Enkelstrengs breuken worden gerepareerd via het zelfde mechanisme als BER. Dubbelstrengs breuken kunnen op twee manieren worden hersteld:
1. Non-Homologe Eind Koppeling (non-homologous end joining, NHEJ). Dit is een directe koppeling van beide strengen.
2. Homologe Recombinatie (homologous recombination, HR). Hierbij wordt gebruik gemaakt van DNA informatie op het zogenaamde homologe chromosoom. Dit is het chromosoom dat genetisch afkomstig is van de andere ouder.
Stralingsexperimenten����� ������������ ������������ ��������
����������� ����������
������� �������� �������������� ������������
������ ���� �� ����� ��� ���
�������� ������ ��� ���
������ ���� �� ����� ��� ��
�������� ������ ��� ������������� ����������
BER = base excisie reparatie; HR = homologe recombinatie
Om de invloed van homologe recombinatie en van base excisie reparatie vast te stellen
werden bestralingsexperimenten uitgevoerd, na blootstelling aan gemcitabine, met
cellijnen die wel of niet de beschikking hadden over deze verschillende reparatiemecha-
nismen. Gemcitabine veroorzaakte wel radiosensitisatie in base excisie reparatie-deficiënte
cellen, maar niet in homologe recombinatie-deficiënte cellen. Uit de gecombineerde resul-
taten van deze experimenten werd de conclusie getrokken dat gemcitabine waarschijnlijk
radiosensitisatie veroorzaakt door een effect op homologe recombinatie.
Gemcitabine in combinatie met cisplatine is een relatief vaak toegepaste combinatie
bij de behandeling van niet-kleincellig longcarcinoom. Aan deze combinatie kleeft het
bezwaar dat voor toediening van cisplatine vrijwel altijd ziekenhuisopname nodig is,
vanwege de vocht- en elektrolytentoediening die noodzakelijk is om nierschade door cis-
platine te voorkomen. De combinatie van gemcitabine met het cytostaticum epirubicine
Samenvatting
198
Samenvatting
199
Geneesmiddelen in speekselSterk bepalend voor de mate waarin stoffen vanuit de bloedbaan in speeksel terechtkomen zijn ondermeer de volgende chemische eigenschappen:
1. Vetoplosbaarheid. Goed vetoplosbare stoffen kunnen makkelijker celmembranen passeren en komen eerder in speeksel.
2. Elektrische lading. Alleen ongeladen (neutrale) stoffen kunnen celmembranen passeren. De lading van een chemische stof (ionvorm of neutraal) is ondermeer afhankelijk van de zuurgraad (pH). Bloed is neutraal en heeft pH 7.4; speeksel is vaak enigszins zuur en varieert meestal van pH 4 tot 7.5
3. Sterk eiwitgebonden stoffen worden in bloed “vastgehouden” door bloedeiwitten. Alleen ongebonden stof kan naar speeksel overgaan.
zou een alternatief kunnen vormen voor de ‘klassieke’ gemcitabine-cisplatine-combinatie
vanwege eenvoudiger toepasbaarheid. In vroege klinische studies bleek de combina-
tie gemcitabine plus epirubicine goed te worden verdragen. Wel trad er relatief vaak
ontsteking van het mondslijmvlies (mucositis) op.
Daarom werd besloten vast te stellen in welke mate de beide anti-kankermedicijnen in
speeksel worden uitgescheiden. Zo kon een indruk verkregen worden van de relatieve
bijdrage van in speeksel uitgescheiden chemotherapie aan de totale blootstelling van
het maagdarmkanaal aan chemotherapie. De Hoge Druk Vloeistof-Chromatografische
(HPLC) methode die werd ontwikkeld om epirubicine en epirubicinol te meten in plasma
en speeksel is beschreven in hoofdstuk 7. De bepalingslimiet in plasma en speeksel was
5 µg/L voor epirubine en 2 µg/L voor epirubicinol.
De uitscheiding van gemcitabine, epirubicine en hun metabolieten in speeksel is onder-
zocht in 12 patiënten en staat beschreven in hoofdstuk 8.
Gemcitabine was alleen gedurende het eerste uur na start van het infuus meetbaar in
speeksel. Epirubicine daarentegen kon zelfs 22 uur na toediening nog in speeksel worden
aangetoond. De concentratie in speeksel was 6 en 22 uur na het infuus zelfs 28 en 72%
hoger dan in plasma. De totale hoeveelheid die via speeksel werd uitgescheiden is naar
schatting echter minder dan 0,2% van de epirubicine- en minder dan 0,1% van de gem-
citabinedosis. Beide anti-kankermedicijnen waren dus meetbaar in speeksel, maar de
absolute hoeveelheid bleef relatief laag.
Een ander punt van de gemcitabine-epirubicine behandelcombinatie betrof de vraag of
de middelen elkaars farmacokinetiek beïnvloeden bij gelijktijdige toediening.
Er is maar heel weinig onderzoek gedaan naar farmacokinetische interactie tussen gemci-
tabine en epirubicine. Daarom werd een studie gestart om de farmacokinetiek van gem-
citabine te vergelijken tussen enerzijds patiënten die gemcitabine samen met epirubine
en anderzijds patiënten die gemcitabine samen met cisplatine kregen toegediend.
Daarnaast is ook gekeken naar de invloed van een in de bevolking algemeen voorkomend
A79C-polymorfisme in het cytidine-deaminase-gen op de farmacokinetiek van gemcita-
Samenvatting
198
Samenvatting
199
bine. Circa 80-90% van de gemcitabine dosis wordt afgebroken door cytidine deaminase.
De resultaten van dit onderzoek staan beschreven in hoofdstuk 9. Tussen beide behan-
delgroepen werd geen verschil gemeten in de farmacokinetiek van gemcitabine. De
halfwaardetijd van de metaboliet dFdU bleek wel langer in de gemcitabine-epirubicine-
groep ten opzichte van gemcitabine-cisplatine-groep. Dit leek ten dele te kunnen worden
toegeschreven aan de iets betere nierfunctie van de patiënten in de gemcitabine-cisplati-
ne-groep, aangezien dFdU via de nieren het lichaam verlaat. Dit kon echter niet het gehele
verschil verklaren. Een ander deel van het verschil zou mogelijk verklaard kunnen worden
door verhoogde uitscheiding of verdeling naar weefsels van dFdU als gevolg van de intra-
veneuze toediening van grote hoeveelheden vocht die noodzakelijk zijn bij behandeling
met cisplatine. Ook zou een interactie van epirubicine of cisplatine met dFdU het verschil
kunnen verklaren. Omdat dFdU geen anti-kankeractiviteit heeft werd het geconstateerde
verschil niet klinisch relevant gevonden.
Het effect van het A79C-polymorfisme in het cytidine-deaminase-gen op de farmacoki-
netiek van gemcitabine is waarschijnlijk relatief beperkt. Onze studie was te klein om
hierover precieze uitspraken te doen. Een groter onderzoek met minimaal 120 patiënten
zou hier wel antwoord op kunnen geven.
Aanvullend onderzoek naar optimalisatie van het gemcitabine-epirubicine-schema in
relatie tot effectiviteit van de behandeling zou mogelijk interessant zijn geweest. Het
schema wordt echter niet meer toegepast naar aanleiding van de uitkomsten van klinisch
vergelijkend onderzoek. De combinatie gemcitibine-epirubicine bleek wat betreft anti-
kankerwerking niet verschillend van de combinatie gemcitabine-cisplatine, maar gaf wel
meer bijwerkingen. Aanvullende onderzoek met het gemcitabine-epirubicine-schema
bij patiënten met niet-kleincellig longcarcinoom is derhalve op dit moment niet aan de
orde.
201
Dankwoord
Vele personen hebben bijgedragen aan de totstandkoming van dit proefschrift. Promove-ren doe je niet alleen. Sterker nog, promoveren kan je niet eens alleen. Op deze plaats wil ik daarom de volgende personen bedanken voor hun inzet.
In de eerste plaats wil ik prof. dr. E.G.E. de Vries bedanken voor de jarenlange ondersteu-ning van het onderzoek. Liesbeth, dankzij jouw kritisch commentaar en waardevolle sug-gesties heeft dit proefschrift tot zijn huidige vorm kunnen uitgroeien. Mijn tweede promotor, prof. dr. H.J.M. Groen wil ik van harte danken voor de ondersteu-ning bij alle “gem-epi” delen van het onderzoek. Harry, jouw enthousiasme in de zoektocht naar nieuwe wegen en mogelijkheden in het onderzoek was aanstekelijk.Onmisbaar was de bijdrage van prof. dr. D.R.A Uges aan de totstandkoming van dit proef-schrift. Donald, dank zij jouw expertise zijn alle HPLC analyses meer dan uitstekend uitge-voerd.
Onmisbaar was ook de inzet van Floris Wachters en Monique Slijfer. Floris het was geweldig om met je samen te werken. Heel wat onderzoeksuren van jou zitten in dit boekje. Goede herinneringen bewaar ik ook aan de post-ASCO minitour door Florida. Toch jammer dat de space-shuttle bij NASA niet echt was…. Monique, bedankt voor de uitstekende wijze waarop je het onderzoeksdeel in het Martini Ziekenhuis hebt uitgevoerd en gecoördineerd.
Graag wil ik ook de bijvakstudenten farmacie Wilma Dodde, Leonie Schouten, Marina Maurer en Marieke Welzen bedanken voor hun inzet bij het analyseren van de vele farma-cokinetiek monsters. Zij werden in hun werk uitstekend bijgestaan door de analisten van het Laboratorium Apotheek van het AZG en begeleid door Gert Hendriks en Ben Greijda-nus, die ik hiervoor wil dankzeggen.
Alle DPD metingen hebben plaatsgevonden op het Laboratorium voor Genetisch Metabole Ziekten van het AMC te Amsterdam. Ik ben dr. André van Kuilenburg zeer erken-telijk voor de plezierige wijze waarop wij de afgelopen jaren hebben samengewerkt.
Dr. Hans Proost wil ik bedanken voor de heldere wijze waarop complexe farmacokineti-sche vraagstukken konden worden teruggebracht tot analyseerbare farmacokinetische modellen.
Dr. Wim Sluiter en dr. Marieke Boezen wil ik bedanken voor hun gedegen statistisch advies bij het opzetten en interpreteren van de diverse klinische onderzoeken.
Een speciaal dankwoord gaat uit naar alle artsen, arts-assistenten, oncologieverpleeg-kundigen en overige medewerkers van de afdelingen oncologie van het Academische Ziekenhuis en het Martini Ziekenhuis in Groningen, het Diaconessenhuis in Meppel en
202 203
het ziekenhuis Bethesda in Hoogeveen voor hun bijdrage aan het onderzoek door onder-steuning bij het insluiten van patiënten in de diverse studies, bij het uitvoeren van de vele bloedafnames en bij het verrichten van de toxiciteits-scores.
In het bijzonder wil ik Henk Piersma, Barbara Bong, dr. Robert de Jong, Janny Haasjes en Henk de Korte danken voor hun inzet.
Zeer veel dank ben ik ook verschuldigd aan alle patiënten en proefpersonen die op vrijwillige basis bereid zijn geweest deel te nemen aan de klinische onderzoeken in dit proefschrift.
De leden van de beoordelingscommissie, prof. dr. J.H. Beijnen, prof. dr. H.J. Guchelaar en prof. dr. J.Verweij, wil ik bedanken voor hun bereidheid het manuscript te beoordelen.
De analisten van de apotheeklaboratoria van ziekenhuisapotheek Meppel-Hoogeveen en van het Martini Ziekenhuis Groningen wil ik bedanken voor hun begeleiding bij de HPLC analyses die in respectievelijk Meppel en Groningen plaatsvonden. HLO studente Yvette Huisman wil ik danken voor haar bijdrage aan de uracil HPLC analyses.
Mijn collega-ziekenhuisapothekers dr. Peter Lerk en Solko Bolman wil ik danken voor de mogelijkheid het onderzoek flexibel in te passen naast een baan als full-time ziekenhuis-apotheker. Collega Barbara Theeuwes-Oonk wil ik danken voor haar inzet bij de totstand-koming van de uracil studie en voor de nauwgezette uitvoering ervan.Dankbaar ben ik ook voor de bijdrage van dr. Geke Hospers van de afdeling medische oncologie van het AZG aan dit deel van het onderzoek.
Onder de indruk ben ik van de transformatie van tekst naar boekje die door creatief en kundig handwerk van Paula Berkemeyer heeft plaatsgevonden. Paula het is prachtig geworden!
Mathijs, leuk dat je paranimf wilt zijn. Tijdens de studie farmacie hebben wij heel wat practica en studieblokken samen doorlopen. Het voelt goed om, als vanouds, dit grote academisch “examen” ook een beetje samen te doen.
Boys from the band: “ ‘t was niet nix, maar woensdag bleef en blijft No-Dix”.
JUPE, lieve Peter en Judith: betere vriendjes kunnen wij ons niet wensen. Peter, de vorige keer samen in rokkostuum was bij jouw promotie. Ik ben blij dat, in omge-keerde rolverdeling, jij mij ditmaal bijstaat in de aula van het academiegebouw.
Tenslotte, lieve Monique, bedankt voor je geduld en steun, vooral tijdens de laatste zware loodjes.
202 203
Curriculum Vitae
Jan Gerard Maring werd geboren op 19 februari 1967 te Assen. Na het behalen van het VWO diploma aan de Christelijke Scholengemeenschap Assen (thans Vincent van Gogh) begon hij in 1986 aan de studie farmacie aan de Rijksuniversiteit Groningen. Na het behalen van het propedeutisch examen in 1987 volgde hij tijdens de doctoraalfase de specialisatierichting farmacologie. Het bijvakonderzoek werd uitgevoerd bij de vakgroep Farmacokinetiek & Drug Delivery onder leiding van prof. dr. D.K.F. Meijer en betrof onderzoek naar kationtransport in de lever (begeleiding dr. H. Steen). In 1992 behaalde hij het doctoraal examen (cum laude). Na het doctoraal examen volgde hij de beroepsop-leiding tot apotheker, waarvan het examen in 1994 werd behaald. Hierna verrichtte hij als projectapotheker onderzoek naar een propofol formulering in het St. Antonius Ziekenhuis in Nieuwegein. In 1995 startte hij met de opleiding tot ziekenhuisapotheker in het Martini Ziekenhuis Groningen (opleider: O.G. Groenewold). In 1997 werd als onderdeel van deze opleiding in samenwerking met de afdeling medische oncologie van het Academisch Ziekenhuis Groningen een aanvang gemaakt met de in dit proefschrift beschreven lever-metastasen studie. De opleiding tot ziekenhuisapotheker werd eind 1998 afgerond. Sinds 1999 werkt hij als ziekenhuisapotheker in ziekenhuisapotheek Meppel-Hoogeveen en is vanaf de oprichting van de Sazinon ziekenhuisapotheek, een samenwerkingsverband van de ziekenhuizen in Emmen, Hardenberg, Hoogeveen en Meppel, tevens werkzaam voor de ziekenhuisapotheek Emmen-Hardenberg. Zijn aandachtsgebieden zijn het klinisch-farma-ceutisch en toxicologische laboratorium, de klinisch-farmaceutische zorg en hieraan gere-lateerde informatisering & automatisering. Het in dit proefschrift beschreven onderzoek vond plaats in de periode 1997-2004 en werd begeleid door prof. dr. E.G.E. de Vries van de afdeling medische oncologie, prof. dr. H.J.M. Groen van de afdeling longziekten en prof. dr. D.R.A. Uges van de apotheek van het Academisch Ziekenhuis Groningen.
204 205
204 205
Publications related to this thesis
Maring JG, van Kuilenburg AB, Haasjes J, Piersma H, Groen HJ, Uges DR, Van Gennip AH, De Vries EG. Reduced 5-FU clearance in a patient with low DPD activity due to heterozygosity for a mutant allele of the DPYD gene. Br J Cancer 2002;86:1028-1033.
Maring JG, Piersma H, van Dalen A, Groen HJ, Uges DR, De Vries EG. Extensive hepatic replacement due to liver metastases has no effect on 5-fluorouracil pharmacokinetics. Cancer Chemother Pharmacol 2003;51:167-173.
Dodde WI, Maring JG, Hendriks G, Wachters FM, Groen HJ, de Vries EG, Uges DR. Determina-tion of epirubicin and its metabolite epirubicinol in saliva and plasma by HPLC. Ther Drug Monit 2003;25:433-440.
Wachters FM, van Putten JW, Maring JG, Zdzienicka MZ, Groen HJ, Kampinga HH. Selective targeting of homologous DNA recombination repair by gemcitabine. Int J Radiat Oncol Biol Phys 2003;57:553-562.
Maring JG, Schouten L, Greijdanus B, De Vries EGE, Uges DRA. A simple and sensitive fully validated HPLC-UV method for the determination of 5-fluorouracil and its metabolite 5,6-dihydrofluorouracil in plasma. Ther Drug Monit 2004. In press.
Maring JG, Groen HJM, Wachters FM, Uges DRA, De Vries EGE. Genetic factors influencing pyrimidine antagonist chemotherapy. Pharmacogenetics J. Revised resubmitted.
Maring JG, Wachters FM, Maurer M, Uges DRA, De Vries EGE, Groen HJM. Gemcitabine and epirubicin plasma concentrations and excretion in saliva in non-small cell lung cancer patients. To be submitted.
Maring JG, Wachters FM, Slijfer M, Maurer M, Boezen HM, Uges DRA, De Vries EGE, Groen HJM. Pharmacokinetics and pharmacogenetics of gemcitabine combined with epirubicin or cisplatin in non-small cell lung cancer patients. Submitted.
Other publications
Steen H, Maring JG, Meijer DK. Differential effects of metabolic inhibitors on cellular and mitochondrial uptake of organic cations in rat liver. Biochem Pharmacol 1993;45:809-818.
Van Kuilenburg AB, Haasjes J, Richel DJ, Zoetekouw L, Van Lenthe H, De Abreu RA, Maring JG, Vreken P, van Gennip AH. Clinical implications of dihydropyrimidine dehydrogenase (DPD) deficiency in patients with severe 5-fluorouracil-associated toxicity: identification of new mutations in the DPD gene. Clin Cancer Res 2000;6:4705-4712.
206 207
Koster VS, Maring JG, Knibbe CAJ, Lange R, Kuks PFM, Langemeijer JJM, Talsma H, Lie-A-Huen L. Propofol 6% SAZN: preparation and stability of a new formulation of propofol. Eur Hosp Pharm 2000;6:92–96
Beaufort TM, Proost JH, Maring JG, Scheffer ER, Wierda JK, Meijer DK. Effect of hypothermia on the hepatic uptake and biliary excretion of vecuronium in the isolated perfused rat liver. Anesthesiology 2001;94:270-279.
Wachters FM, Groen HJ, Maring JG, Gietema JA, Porro M, Dumez H, de Vries EG, van Oosterom AT. A phase I study with MAG-camptothecin intravenously administered weekly for 3 weeks in a 4-week cycle in adult patients with solid tumours. Br J Cancer 2004;90:2261-2267
Publications in dutch
Maring JG. Azitromycine. Meer microkracht, maar nauwelijks schonere weefsels. Pharma Sel 1994;10:130-134
Maring JG, Van der Graaf CJ. Afleveren van geneesmiddelen: van kunst naar kunde. Pharm Weekbl 1994;129:546
Maring JG. Helicobacter pylor eradicatie. Zuur einde voor een lastig heerschap. Pharm Sel 1995;11:45-48
Maring JG. Meropenem. Carbapenem op solotour. Pharm Sel 1996;12:46-50.
Maring JG. Riluzole. Bij amyotrofische lateraal sclerose. Pharm Sel 1996,12:116-118
Maring JG. Methotrexaat. Als ontstekingsremmer bij chronische aandoeningen. Pharm Sel 1997;13:44-47
Troost SJ, Maring JG. Anti-emetica. Welk middel voor welke toepassing. Pharm Sel 1997,13:82-86
Maring JG. Tacrolimus. Pro graft of ook pro host? Pharm Sel 1997;13:134-137.
Maring JG, Weening EC. Thuisbehandeling van diep-veneuze trombose. Pharm Sel 1998;14:68-74
Maring JG, Niemeijer MG. De mogelijkheden van insluipend gedoseerde beta-blokkers. Pharm Weekbl 1998;133:747-751
206 207
Maring JG, Eppinga M. Cholinesteraseremmers bij alzheimer. Verbeterde stroomvoorzien-ing voor beschadigd geheugen. Pharm Sel 1999;15:17-20
Maring JG. Oxaliplatin. Nieuw edelmetaal in strijd tegen kanker. Pharm Sel 1999;15:96-99.
Maring JG. Ibopamine obsoleet. Pharm Weekbl 1999;134:754-755
Stolk LML, Maring JG. Leflunomide. Doorbraak bij rheuma? Pharm Sel 2000;16:2-5.
Maring JG, Eppinga M. Entacapon. Blijf het ‘off’ of comt het ‘on’? Pharm Sel 2000;16:46-49.
Troost SJ, Maring JG. Gabapentine. (R)evolutionair bij refractaire epilepsie. Pharm Sel 2000;16:93-96
Westerman EM, Maring JG. Trastuzumab. Antilichaam in de strijd tegen borstkanker. Pharm Sel 2001;17:14-17.
Maring JG, Stolk LML. Capecitabine. Oraal 5-FU met kans op mond- en voetzeer. Pharm Sel 2001;17:61-64.
Van de Ven LI, Maring JG. Levetiracetam. Nog geen schokkende verbetering. Pharm Sel 2001;17:129-132
Maring JG, Schimmel K. Imatinib. Bestrijdt leukemie, ontstaan na chromosomaal pootje over. Pharm Sel 2002;18:37-40
Maring JG, Dekens KG, Piersma H, Groenewold OG, De Vries EGE. De farmacokinetiek van 5-fluorouracil en 5,6 dihydrofluorouracil. Invloed van levermetastasen. Pharm Weekbl 2002;137:1344-1348
Maring JG, Dettmers EM. Gefetinib. Pas in derde plaats effectief? Pharm Sel 2003;19:135-137
Kuiper L, Maring JG. Fulvestrant. Puur is duur? Pharm Sel 2004;20:79-82
Bartelink IH, Maring JG. Bortezomib. Nieuwe therapieën tegen (w)elke prijs? Pharm Sel 2004;20:94-97
Maring JG, Bruggeman R. Alefacept. Bij psoriasis beter dan … wat? Pharm Sel 2004:20:100-102
Top Related