New Insights in Pyrimidine Antagonist Chemotherapy The ... · cology and pharmacogenetics of...

New Insights in Pyrimidine Antagonist Chemotherapy

The role of Pharmacokinetics and Pharmacogenetics

RIJKSUNIVERSITEIT GRONINGEN

New Insights in Pyrimidine Antagonist Chemotherapy

The role of Pharmacokinetics and Pharmacogenetics

PROEFSCHRIFT

ter verkrijging van het doctoraat in deMedische Wetenschappen

aan de Rijksuniversiteit Groningenop gezag van de

Rector Magnificus, dr. F. Zwarts,in het openbaar te verdedigen op

woensdag 12 januari 2005 om 13.15 uur

door

Jan Gerard Maring

geboren op 19 februari 1967

te Assen

Promotores: Prof. dr. E.G.E. de Vries Prof. dr. H.J.M. Groen Prof. dr. D.R.A. Uges

Beoordelingscommissie: Prof. dr. J.H. Beijnen Prof. dr. H.J. Guchelaar Prof. dr. J. Verweij

De gezonde mens heeftDuizend wensen,

De zieke slechts één.

Ton Luiting, dichter

Voor mijn oudersVoor Monique, Sanne en Floor

The following centres participated in the research described in this thesis: Departments of Pharmacy and Internal Medicine, Diaconessen Hospital Meppel and Bethesda Hospital Hoogeveen; Departments of Medical Oncology, Pulmonary Diseases and Pharmacy, Uni-versity Hospital Groningen; Departments of Pharmacy and Internal Medicine, Martini Hospital Groningen; Department of Clinical Chemistry, Section Genetic Metabolic Diseases, Academic Medical Centre Amsterdam; Department of Toxicogenetics, Leiden University Medical Centre; Department of Radiation and Stress Cell Biology, University of Groningen.

Financial support for the publication of this thesis was kindly provided by the executive boards of Diaconessen Hospital Meppel and Bethesda Hospital Hoogeveen, the Stichting OZG, Department of Pharmacy, University Hospital Groningen, MerckSharp&Dohme, Novartis Oncology, Eli Lilly, GlaxoSmithKline, Pfizer, Ortho Biotech, Bristol-Myers Squibb, PharmaChemie, Roche and AstraZeneca.

Cover design and layout: Paula Berkemeyer, Amersfoort, www.PBVerbeelding.nl

Photographs on cover and title pages by Jan Gerard MaringCover photograph: Architectural polymorphism in shape and colour. Manarola, Cinque Terre Unesco World Heritage, Italy 2001.

Printed by: Ponsen & Looijen b.v., Wageningen, The Netherlands

ISBN: 90-367-2199-7

© 2004 J.G. MaringAll rights reserved. No part of this publication may be reproduced, stored in a retrieveal system or transmitted in any form or by any means, mechanically, by photocopy, recording or otherwise, without prior written permission of the author.

Contents

Chapter 1 General introduction, objectives and outline. 9

Chapter 2 Genetic factors influencing pyrimidine antagonist chemo-therapy. 15

Section A FOCUS ON FLUOROURACIL

Chapter 3 A simple and sensitive fully validated HPLC-UV method for the determination of 5-fluorouracil and its metabolite 5,6-dihydrofluorouracil in plasma. 53

Chapter 4.1 Extensive hepatic replacement due to liver metastases has no effect on 5-fluorouracil pharmacokinetics 69

Chapter 4.2 Reduced 5-FU clearance in a patient with low DPD activity due to heterozygosity for a mutant allele of the DPYD gene. 87

Chapter 5 Dihydropyrimidine dehydrogenase phenotyping in human volunteers and a DPD deficient patient by assessing uracil pharmacokinetics after an oral uracil test dose. A preliminary report. 101

Section B FOCUS ON GEMCITABINE

Chapter 6 Selective targeting of homologous DNA recombination repair by gemcitabine 115

Chapter 7 Determination of epirubicin and its metabolite epirubicinol in saliva and plasma by HPLC 133

Chapter 8 Gemcitabine and epirubicin plasma concentrations and excretion in saliva in non-small cell lung cancer patients. 151

Chapter 9 Pharmacokinetics and pharmacogenetics of gemcitabine combined with epirubicin or cisplatin in non-small cell lung cancer patients. 163

Summary 177

General discussion and future perspectives 185

Samenvatting 189

Dankwoord 201

Curriculum Vitae 203

List of Publications 205

Introduction

10

Chapter 1 Introduction

11

Lean back and read. Louisiana, USA 2000.

10


11

Introduction

Background

Pyrimidine antagonists belong to the group of antimetabolite anti-cancer drugs and show

structural resemblance with naturally occurring nucleotides. Their action is accomplished

through incorporation as false precursor in DNA or RNA or through inhibition of proteins

involved in nucleotide metabolism. The most commonly used pyrimidine antagonists

are 5-fluorouracil, gemcitabine and cytarabine. Newer oral variants of 5-fluorouracil are

capecitabine and tegafur. 5-Fluorouracil and its analogues are used e.g. in the treatment

of colorectal-, breast- and head and neck cancer [1-3], whereas gemcitabine is especially

prescribed for non-small cell lung cancer and pancreatic cancer [4,5]. Cytarabine is ad-

ministered in the treatment of leukaemia [6]. All pyrimidine antagonists are prodrugs

and intracellular conversion into cytotoxic nucleosides and nucleotides is needed to

produce cytotoxic metabolites. Proteins, involved in pyrimidine metabolism handle these

synthetic drugs, as if they were naturally occurring substrates. The extensive metabolism

of pyrimidine antagonists implies that the intracellular concentrations of cytotoxic me-

tabolites, largely depend on intracellular metabolic enzyme activity. Therefore, under-

standing of the genetics and kinetics of the range of (iso)enzymes involved in pyrimidine

antagonist metabolism is essential for the optimal utilization of these anticancer drugs.

Dihydropyrimidine dehydrogenase is the enzyme that is responsible for the catabolism of

5-fluorouracil and its analogues [7]. Gemcitabine and cytarabine are predominantly me-

tabolized by cytidine deaminase [8]. Thus, not only body surface area, but particularly the

total capacity of metabolizing enzymes in an individual, in combination with some other

factors such as organ function, food and drug interactions, age and gender, determine the

clearance of these drugs.

Aim of the thesis

This thesis aims to clarify the role of a number of potential factors in the clinical pharma-

cology and pharmacogenetics of pyrimidine antagonists, related to the occurrence of side

effects, in order to improve the drug safety of pyrimidine antagonist chemotherapy

Outline of the thesis

In chapter 2, the enzymology and genetics of the proteins, involved in the metabolism

and action mechanism of pyrimidine antagonists are discussed. This should serve as a

basis for adequate understanding of factors involved in the clinical pharmacology of

these drugs.

Section A, comprising chapters 3, 4.1, 4.2, and 5, focuses on a number of clinical phar-

macological and pharmacogenetic aspects of 5-fluorouracil chemotherapy. Chapter

3 describes a novel assay for quantification of 5-fluorouracil in plasma, to be used for

studying 5-fluorouracil pharmacokinetics. 5-Fluorouracil clearance is mainly determined

12


13

by dihydropyrimidine dehydrogenase activity, which is highest in the liver. Therefore,

chapter 4.1 focuses on the impact of liver metastases on 5-fluorouracil pharmacoki-

netics, whereas chapter 4.2 describes the impact of dihydropyrimidine dehydrogenase

deficiency caused by a polymorphism in the dihydropyrimidine dehydrogenase gene on

5-fluorouracil clearance. Since early detection of dihydropyrimidine dehydrogenase defi-

ciency may prevent extreme 5-fluorouracil treatment related toxicity, chapter 5 explores

the use of an oral uracil challenge for dihydropyrimidine phenotyping.

In section B, comprising chapters 6, 7, 8 and 9 a number of clinical pharmacological and

pharmacogenic aspects of gemcitabine chemotherapy are evaluated.

Gemcitabine has been recognized as a potent radiosensitizer, and as such, an interesting

candidate for pre-radiotherapy radiosensitization in non-small cell lung cancer [9]. The

mechanism of gemcitabine mediated radiosensitization is yet poorly understood. Inhibi-

tion of DNA double strand break repair by non-homologous end-joining was previously

excluded as a means of radiosensitization [9]. In Chapter 6 the role of base excision repair

and homologous recombination with respect to gemcitabine induced radiosensitization is

explored in cell line experiments.

Chapter 7 describes a novel assay for determination of epirubicin in plasma and saliva.

The excretion of cytotoxic drugs in saliva may be related to the development of side

effects such as oral mucositis and diarrhea. Therefore, chapter 8 focuses on the excretion

of gemcitabine and epirubicin in saliva. In chapter 9, the potential interaction of gem-

citabine and epirubicin at the level of plasma pharmacokinetics is explored. Additionally,

the possible influence of a common genetic polymorphism in the cytidine deaminase

gene on gemcitabine clearance is evaluated.

Finally, the summary, general discussion and future perspectives chapters summarize

the main findings, strengths and limitations of the studies in the preceding chapters and

give ideas for future research.

12


13

References

1. Harari PM. Why has induction chemotherapy of advanced head and neck cancer become a

United States community standard of practice? J Clin Oncol 1997;15:2050-2055

2. Macdonald JS, Astrow AB. Adjuvant therapy of colon cancer. Semin Oncol 2001;28:30-40

3. Cochrane Review. Multi-agent chemotherapy for early breast cancer. Cochrane Database Syst

Rev. 2002;CD000487

4. Wiernik PH. Current status of and future prospects for the medical management of adenocarci-

noma of the exocrine pancreas. J Clin Gastroenterol 2000;30:357-363

5. Sorenson S, Glimelius B, Nygren P, SBU group. Swedish Council of Technology Assessment in

Health Care. A systematic overview of chemotherapy effects in non-small cell lung cancer. Acta

Oncol 2001;40:327-339

6. Bishop JF. Approaches to induction therapy with adult acute myeloid leukaemia. Acta Haematol

1998; 99:133-137

7. Pinedo HM, Peters GF. Fluorouracil: biochemistry and pharmacology. J Clin Oncol 1988;6:1653-

1664

8. Galmarini CM, Mackey JR, Dumontet C. Nucleoside analogues: mechanisms of drug resistance

and reversal strategies. Leukemia 2001:15:875-890

9. van Putten JWG, Groen HJM, Smid K, Peters GJ, Kampinga HH. End-joining deficiency and radio-

sensitization induced by gemcitabine. Cancer Res 2001;61:1585-1591

Genetic factors influencing pyrimidine-antagonist chemotherapy

Jan Gerard Maring1, Harry J.M. Groen2, Floris M. Wachters2, Donald R.A. Uges3, Elisabeth

G.E. de Vries4

1Department of Pharmacy, Diaconessen Hospital Meppel and Bethesda Hospital

Hoogeveen; Departments of 2Pulmonary Diseases, 3Pharmacy and 4Medical Oncology ,

University Hospital Groningen, The Netherlands

Pharmacogenetics J, revised resubmitted

Chapter 2

16


17

Grandmother & Children. Almeria, Spain 1996.

Chapter 2

16


17

Abstract

Pyrimidine antagonists, e.g. 5-fluorouracil, cytarabine and gemcitabine, are widely used in

chemotherapy regimes for colorectal, breast, head and neck, non-small cell lung cancer,

pancreatic cancer and leukaemias. Extensive metabolism is a prerequisite for conver-

sion of these pyrimidine prodrugs into active compounds. Interindividual variation in

the activity of metabolising enzymes can affect the extent of pro-drug activation and,

as a result, act on the efficacy of chemotherapy treatment. Genetic factors at least partly

explain interindividual variation in anti-tumour efficacy and toxicity of pyrimidine an-

tagonists. In this review, proteins relevant for the efficacy and toxicity of pyrimidine an-

tagonists will be summarised. In addition, the role of germline polymorphisms, tumour

specific somatic mutations and protein expression levels in the metabolic pathways and

clinical pharmacology of these drugs are described. Germ line polymorphisms of uridine

monophosphate kinase (UMPK), orotate phosphoribosyl transferase (OPRT), thymidylate

synthase (TS), dihydropyrimidine dehydrogenase (DPD), and methylene tetrahydrofolate

reductase (MTHFR) and gene expression levels of OPRT, UMPK, TS, DPD, uridine phos-

phorylase, uridine kinase, thymidine phosphorylase, thymidine kinase, dUTP nucleotide

hydrolase are discussed in relation to 5-FU efficacy. Cytidine deaminase (CDA) and 5’-

nucleotidase (5NT) gene polymorphisms and CDA, 5NT, deoxycytidine kinase and MRP5

gene expression levels and their potential relation to gemcitabine and cytarabine cyto-

toxicity are reviewed.

Introduction

Pyrimidine antagonists belong to the group of antimetabolite anti-cancer drugs and

show structural resemblance with naturally occurring nucleotides (see figure 1). Their

action is accomplished through incorporation as false precursor in DNA or RNA or through

inhibition of proteins involved in nucleotide metabolism. The most commonly used pyri-

midine antagonists are 5-fluorouracil (5-FU), gemcitabine and cytarabine (ara-C). Newer

oral variants of 5-FU are capecitabine and tegafur. 5-FU and its analogues are used e.g. in

the treatment of colorectal-, breast- and head and neck cancer [1-3], whereas gemcitabine

is especially prescribed for non-small cell lung cancer and pancreatic cancer [4,5]. Ara-C

is used in the treatment of leukaemia [6]. All pyrimidine antagonists are prodrugs and

intracellular conversion into cytotoxic nucleosides and nucleotides is needed to produce

cytotoxic metabolites. Proteins, involved in pyrimidine metabolism handle these synthetic

drugs, as if they were naturally occurring substrates. The extensive metabolism of pyrimi-

dine antagonists implies that the intracellular concentrations of cytotoxic metabolites,

thus indirectly the potential anti-tumour effects, largely depend on intracellular metabolic

enzyme activity. The aim of this review is to summarise pharmacogenomic data regarding

Chapter 2

18


19

proteins related to the efficacy and toxicity of pyrimidine antagonists and to identify

potential predictive and/or prognostic genetic factors for toxicity and treatment outcome.

The impact of germ line polymorphisms as well as tumour specific somatic mutations and

protein expression levels on the clinical pharmacology and metabolic pathways of these

drugs will be discussed.

Metabolic pathways of pyrimidine antagonists

5-Fluorouracil

The initial metabolism of 5-FU into nucleotides is essential for its action. Several enzymes

of the pyrimidine metabolic pathway are required for the conversion of 5-FU to nucle-

otides [7]. Cytotoxic nucleotides can be formed by three routes as is illustrated in figure

2: 1. Conversion of 5-FU to 5-fluoro-uridine-monophosphate (5-FUMP) by orotate phos-

phoribosyl transferase (OPRT); 2. Sequential conversion of 5-FU to 5-FUMP by uridine

phosphorylase and uridine kinase; 3. Sequential conversion of 5-FU to 5-fluoro-deoxy-

uridine-monophosphate (FdUMP) by thymidine phosphorylase and thymidine kinase [8].

The antitumour activity results from inhibition of thymidylate synthase (TS) by FdUMP,

as well as from incorporation of 5-FU metabolites into RNA and DNA. Only a small part

�

��

�

��

��

��

�

��

�

�

�

��

��

��

��

�

��

�

�

�

��

�

�

��

��

�

� ��

�

�

�

�

��

�

��

��

�

�

��

��

�

�

��

�

��

�

�

��

��

�

Figure 1 Overview of the chemical structures of the naturally occurring pyrimidines cytosine and uracil and the synthetic pyrimidine analogues cytarabine, gemcitabine, capecitabine, 5-fluorouracil and tegafur.

Chapter 2

18


19

of the dose is activated via these routes, as in humans 80-90% of the administered dose

is degraded by dihydropyrimidine dehydrogenase (DPD). 5-FU degradation occurs in all

tissues, including tumour tissue, but is highest in the liver [9].

Capecitabine and tegafur

Capecitabine is an oral prodrug of 5-FU. After absorption from the gut capecitabine

is converted into 5’-deoxy-5-fluorocytidine (5’-dFCR) by carboxyl-esterase in the liver,

and subsequently further converted into 5’-deoxy-5-fluorouridine (5’-dFUR) by cytidine

deaminase (CDA). Finally, 5-FU results from bioconversion of 5’-dFUR by thymidine phos-

phorylase [10] (see figure 2). Tegafur is another oral 5-FU prodrug, that is converted into

5-FU by cytochrome P450 (CYP450) enzymes in the liver. CYP2A6 is the main CYP450

enzyme involved in tegafur metabolism, but CYP1A2 and CYP2C8 also play a role (see

Figure 2 Metabolism of 5-FU and 5-FU analogues. For explanation of symbols and metabolic routes see text.

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

�

Chapter 2

20


21

figure 2). Tegafur is combined with uracil in a molar proportion of 1:4 available in the com-

mercial preparation UFT®. Uracil is a competitive substrate for DPD and its role in UFT® is

to diminish 5-FU catabolism by DPD.

Gemcitabine and cytarabine

The metabolic pathways of gemcitabine and ara-C are almost alike [11,12] (see figure 3).

Membrane transport of both gemcitabine and ara-C is mediated by equilibrative nucle-

oside transporters. Subsequently gemcitabine (dFdC) is phosphorylated into gemcitabine

monophosphate (dFdCMP) by deoxycytidine kinase (dCK). The same enzyme is respon-

sible for the intracellular phosphorylation of ara-C into cytarabine monophosphate (ara-

CMP). dCK is the rate limiting enzyme in the biotransformation of both gemcitabine and

ara-C. Inactivation of dFdCMP and ara-CMP can occur through dephosphorylation by 5’-

nucleotidase (5NT). Monophosphates, escaping from dephosphorylation are available for

further phosphorylation into di- and triphospates by dCMP kinase and nucleoside diphos-

phate kinase, respectively. Gemcitabine diphosphate (dFdCDP) is a potent inhibitor of the

enzyme ribonucleotide reductase (RNR), which will lead to depletion of dCDP and dCTP

in the cell. This may favour the incorporation of dFdCTP into DNA. Moreover, gemcitabine

has the unique property that after incorporation of gemcitabine monophosphate in DNA,

one deoxynucleotide molecule more can be inserted. This stops DNA polymerase [13]. This

pattern is distinct from that of ara-C, which halts polymerase progression at the analogue

insertion site. The “masked termination” of gemcitabine makes the inserted analogue more

resistant to removal from DNA [13]. Other differences with ara-C are the faster membrane

transport velocity of dFdC, the greater effectiveness of dFdC phosphorylation by dCK and

the longer intracellular retention of dFdCTP. These factors may, at least in part, explain the

different spectra of antitumour activity of both drugs. Only a small part of the gemcitabine

and ara-C dose is responsible for the cytotoxic effects, since more than 90% of the dose is

inactivated by the enzyme cytidine deaminase into dFdU and ara-U respectively.

Germline polymorphisms and fluoropyrimidine efficacy

5-fluorouracil

Genetic polymorphisms of enzymes involved in the metabolic activation pathway of 5-FU

have been described for the enzymes uridine kinase (UMPK) and orotate phosphorylase

transferase (OPRT). Three allelic variants of UMPK have been recognised in the human

population: UMPK1, UMPK2 and UMPK3 [14]. The UMPK1 allele is associated with about

3 times the catalytic activity of the UMPK2 allele. Therefore UMPK2 homozygotes are

relatively deficient of total UMPK enzyme. The allele frequency of UMPK1 is about 95-97%

and that of UMPK2 3-5%, in both Caucasians and Asians [15-17]. UMPK3 is rarely seen. The

consequences of this polymorphism for 5-FU chemotherapy have not yet been studied.

Chapter 2

20


21

In the OPRT gene a G213A mutation in exon 3 and a 440G mutation in exon 6 have been

observed, with allele frequencies of 26% and 27% respectively [18]. Both mutations do

not significantly compromise in vitro OPRT activity, and therefore it seems unlikely that

they affect 5-FU anti-tumour efficacy.

Contrary to 5-FU activating enzymes, much more information is available regarding

Figure 3 Metabolism of gemcitabine and cytarabine. For explanation of symbols and metabolic routes see text.

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

�

Chapter 2

22


23

polymorphisms of target enzyme TS and 5-FU degrading enzyme DPD. For TS, at least

two genotypes have been identified, characterised by triple and double tandem repeat

sequences in the DNA promoter enhancer region (TSER). The triple tandem 3R genotype

is associated with higher TS mRNA and TS protein levels [19-22]. The allele frequency of

the 3R genotype is subject to considerable ethnic variation, being about 67% in Asians

and 38% in Caucasians [23]. The consequences of the TSER genotype for fluoropyrimi-

dine chemosensitivity have been studied in tumour cell lines and in clinical trials. In the

only study performed in tumour cell lines, the TSER polymorphism had no effect on 5-

FU chemosensitivity [24]. In 65 patients with rectal cancer, tumour downstaging after

preoperative 5-FU based chemoradiation was observed in only 22% of homozygotes

for triple tandem repeat sequences (3R/3R genotype) compared to 60% of patients who

were heterozygous (3R/2R) or homozygous for double tandem repeats (2R/2R) [25]. In

another small retrospective study of 24 patients with metastatic colorectal cancer, 3 out

of 4 patients with the 2R/2R genotype responded on capecitabine, whereas only 1 out

of 12 of heterozygotes and 2 out of 8 patients with the 3R/3R genotype responded [26].

Furthermore, in a study of 221 patients with Dukes C colorectal cancer, patients with the

3R/3R genotype gained no survival benefit from 5-FU treatment, whereas survival was

increased in patients with a 2R/2R or 2R/3R genotype [27]. However, the TSER genotype

did not seem to be an efficacious marker for tumour sensitivity to 5-FU based oral

adjuvant chemotherapy in 135 Japanese colorectal patients [28]. Surprisingly, in a small

study of 54 colorectal cancer patients, not the 2R but the 3R/3R genotype correlated with

an increased disease free survival after adjuvant 5-FU chemotherapy [29].

Several factors can possibly explain these inconclusive data. Firstly, within the second 28

bp tandem repeat sequence, a G/C polymorphism was recently discovered. Functional

analysis revealed that the 3R/G genotype has three to four times greater efficiency of

translation than other polymorphic sequences. [30,31]. In a study of the G/C polymor-

phism in 258 primary colorectal tumours was found that all low expression genotypes

were associated with longer survival after adjuvant fluoropyrimidine chemotherapy,

whereas no benefit was seen for high expression genotypes [30].

Secondly, a 6bp deletion genotype (TS1494del6) in the 3’ untranslated region of the TS

gene has been associated with reduced TS mRNA stability [32,33]. The frequency of this

genotype was found to be 41% in non-Hispanic whites, 26% in Hispanic whites, 52% in

African-Americans and 76% in Singapore Chinese. The relative instability of TSmRNA may

have its effect on TS protein activity and thus indirectly on fluoropyrimidine chemosensi-

tivity. However, this polymorphism was not directly related to in vitro chemosensitivity in

tumour cell lines [24] or disease free survival after adjuvant 5-FU chemotherapy in a small

study of 54 colorectal cancer patients [29]. Another cause of conflicting data is the loss

of heterozygosity (LOH), that is frequently observed for TS [34]. The TS gene is located on

chromosome 18p11.32, a region most frequently lost in colorectal cancer. In a small study

of 30 stage IV colorectal cancer patients, LOH was observed in 17 out of 22 heterozygotes

Chapter 2

22


23

[35]. The presence of a 3R allele (3R/3R, 3R/loss, 2R/3R) was associated with lower survival

on fluoropyrimidine chemotherapy. LOH in tumour tissue is a significant factor, to be

taken into account when TS genotypes are to be considered for outcome prediction. It is

important to bear in mind that LOH limits the use of germ line DNA from e.g. blood for pre-

dictive genotyping. Finally, it must be stressed that many studies of the TS polymorphism

were underpowered to detect relations of the different genotypes with clinical outcome.

Hence, the exact consequences of the triple tandem repeat genotypes for 5-FU chemo-

sensitivity are not yet clear. Sufficiently powered clinical trials and additional mechanistic

studies may be needed to elucidate the cause of so far unexpected outcomes.

Besides the TS polymorphisms, the phenomenon of inherited DPD deficiency is an

important issue. DPD deficiency is caused by molecular defects in the DPD gene that

result in complete or partial loss of DPD activity [36]. This can cause extreme 5-FU toxicity.

So far, in patients suffering from severe 5-FU associated toxicity, 11 different mutations

in the dihydropyrimidine dehydrogenase (DPYD) gene have been identified, including at

least 1 polymorphism [36-38]. In patients who are deficient for DPD, 5-FU clearance is dra-

matically reduced and standard doses of 5-FU cause excessive toxicity in these patients

[36,39,40]. The frequency of DPD deficiency has been estimated to be as high as 2-3% in

Caucasians based on measurements of DPD activity in peripheral mononuclear cells in

patients and healthy volunteers [41,42]. This percentage is probably high enough to justify

screening on DPD deficiency prior to 5-FU based chemotherapy. Instead of screening for

specific mutations in the DPYD gene, Mattison et al. developed a simple uracil breath test

for DPD phenotyping, based on the release of 13CO2 from 2-13C uracil in the presence of

intact DPD [43]. Expired air was collected 5-90 min after oral ingestion of 6 mg/kg 2-13C

uracil. Partially deficient DPD breath profiles were well differentiated from normal profiles.

An oral challenge with uracil, prior to chemotherapy, with subsequent measurement of

the uracil clearance in plasma, might also give a good prediction of the patient’s DPD

status. Such tests are currently developed, but not yet available [44].

A polymorphism that might also influence the efficacy of 5-FU and its analogues is that of

the methylene tetrahydrofolate reductase (MTHFR) gene. MTHFR catalyses the conversion

of 5,10-methyltetrahydrofolate to 5-methyltetrahydrofolate. 5,10-methyltetrahydrofolate

is an essential cofactor in the biosynthesis of dTMP (see figure 2). The dissociation of FdUMP

from the ternairy complex with thymidylate synthase and 5,10-methyltetrahydrofolate is

suppressed when levels of 5,10- methyltetrahydrofolate are increased [45]. A common

C677T transition in the MTHFR gene results in a variant with lower specific activity [46].

The geographic and ethnic distribution of this genotype was studied by Wilcken et al.

[47]. The homozygote T genotype was found to be particularly common in northern China

(20%), southern Italy (26%) and Mexico (32%). In two studies with respectively 45 and 51

colorectal cancer patients, the MTHFR genotype has been shown to affect the folate pool

[48,49]. In the latter study, no effect was seen of the MTHFR genotype on overall survival

after oral 5-FU based chemotherapy [49]. Contrary to this, in another study of 43 meta-

Chapter 2

24


25

static colorectal cancer patients receiving fluoropyrimidine-based chemotherapy, the

presence of one or two mutant alleles was associated with increased tumour response

[50]. In vitro transfection of mutant 677T MTHFR cDNA in colon and breast cancer cells

increased the chemosensitivity of these cells to 5FU [51], suggesting at least a modulating

role of the MTHFR genotype on cellular fluoropyrimidine sensitivity. The exact role of the

MTHFR genotype has to be elucidated in larger clinical trials.

Capecitabine and tegafur

Polymorphisms in capacitabine metabolising enzymes have only been reported for

cytidine deaminase. Since this polymorphism may also be relevant for gemcitabine and

ara-C metabolism it will be discussed in the next paragraph. Furthermore, mutations in

CYP2A6 have recently been identified to affect tegafur metabolism [52]. Two mutant

alleles, CYP2A6*4C and CYP2A6*11 were detected in a patient with largely reduced

tegafur clearance. The prevalence of these mutations and its impact on clinical outcome

are not yet clear.

Gemcitabine and cytarabine

There are at least two polymorphisms in the metabolising pathway, that might be

relevant for gemcitabine and ara-C toxicity and efficacy. Firstly, cloning of human cytidine

deaminase revealed two protein variants (CDD1 and CDD2) with different in vitro deami-

nation rates of ara-C [53]. Theoretically, patients who deaminate gemcitabine or ara-C more

efficiently, are shorter exposed to the parent drugs, while faster metabolism of capecitab-

ine results in increased 5-FU levels. In vitro transfection of human bladder cancer cells with

CDD2 cDNA did increase CDD activity, and indeed made the cells more sensitive to 5’dFUR

and capecitabine, but resistant to gemcitabine [54]. This warrants further investigation of

the possible role of the CDD genotype in fluoropyrimidine chemosensitivity.

Secondly, 5’-nucleotidase deficiency, is an autosomal recessive condition, known to

cause haemolytic anaemia. Several mutations causing 5’-nucleotidase deficiency have

been identified [55]. On theoretical grounds, in patients with 5’-nucleotidase deficiency,

treatment with gemcitabine or ara-C may result in increased toxicity although this has not

yet been published.

An overview of polymorphic genes and related enzymes with possible relevance for

fluoropyrimidine chemotherapy is presented in table 1.

Chapter 2

24


25

Tabl

e 1

Ove

rvie

w o

f pro

tein

s tha

t pot

entia

ly m

ay a

ffect

dru

g tre

atm

ent o

utco

me

due

to g

enet

ic p

olym

orph

isms

Enzy

me

Po

lym

orp

his

mA

llel

e fr

equ

ency

Dru

gP

atie

nt

dat

aC

on

seq

uen

ces

Dih

ydro

pyr

imid

ine

deh

y-d

rog

enas

e (D

PD)

11 m

uta

tio

ns

fou

nd

in p

ar-

tial

DPD

defi

cien

t p

atie

nts

IVS1

4+1G

→A

mu

tati

on

m

ost

freq

uen

t0.

5-1%

5-FU

an

d a

nal

og

ues

mis

cella

neo

us

can

cer t

ypes

Incr

ease

d to

xici

ty o

f 5-

FU

Met

hyl

ene

tetr

ahyd

rofo

late

re

du

ctas

e (M

FHFR

)C

667T

in e

xon

3d

ecre

ased

MFH

FR a

ctiv

ity

45%

in n

ort

her

n C

hin

a51

% in

so

uth

ern

Ital

y56

% in

Mex

ico

5-FU

an

d a

nal

og

ues

colo

rect

al c

ance

rPo

ssib

ly d

ecre

ased

ef

ficac

y

Oro

tate

ph

osp

ho

rib

osy

l tr

ansf

eras

e (O

PRT

)G

213A

in e

xon

3in

crea

sed

OPR

T ac

tivi

ty26

%5-

FU a

nd

an

alo

gu

esco

lore

ctal

can

cer

Poss

ibly

incr

ease

d

effic

acy

Thym

idyl

ate

syn

thas

e (T

S)TS

ER*3

incr

ease

d T

S ac

tivi

ty

1494

del

6

38%

in C

auca

sian

s67

% in

Asi

ans

29%

5-FU

an

d a

nal

og

ues

colo

rect

al c

ance

rPo

ssib

ly d

ecre

ased

ef

ficac

y

Un

kno

wn

Uri

din

e m

on

op

ho

sph

ate

kin

ase

(UM

PK)

UM

PK1

vari

ant

UM

PK2

vari

ant

UM

PK3

vari

ant

95-9

7%3-

5%<

1%

5-FU

an

d a

nal

og

ues

colo

rect

al c

ance

rU

nkn

ow

n

Cyt

och

rom

e P4

50 2

A6

(CY

P2A

6)C

YP2

A6*

4CC

YP2

A6*

19U

nkn

ow

nte

gaf

ur

colo

rect

al c

ance

rD

ecre

ased

met

abo

-lis

m o

f teg

afu

r in

to

5-FU

Cyt

idin

e d

eam

inas

e (C

DA

)C

DA

1 va

rian

tC

DA

2 va

rian

t70

%30

%C

apec

itab

ine,

gem

ci-

tab

ine,

ara

-Cn

ot

avai

lab

leU

nkn

ow

n

5’-n

ucl

eoti

das

e(5

NT

)Se

vera

l mu

tati

on

su

nkn

ow

nG

emci

tab

ine

and

ar

a-C

leu

kaem

iaU

nkn

ow

n

Chapter 2

26


27

Impact of somatic mutations and gene expression levels: 5-fluorouracil and its metabolic enzymes

5-Fluorouracil

Data on expression levels of enzymes involved in the metabolic activation of 5-FU in

relation to chemosensitivity is sparse. Low UMPK levels were observed in 29 colorectal

tumour samples of patients with acquired 5-FU resistance [56]. Low OPRT as well as UP and

UK activity have been associated with 5-FU resistance in tumour cell lines [57-60]. The role

of OPRT has also been investigated in a few clinical studies. High OPRT activity was associ-

ated with good in vitro sensitivity to 5-FU, measured by Collagen Gel Droplet Embedded

Culture Drug Sensitivity test, Fluoresceine Diacetate Assay or Histoculture Drug Response

Assay, in human colorectal cancer tissues [61,62]. Furthermore, in 37 patients treated with

oral tegafur-uracil for disseminated colorectal cancer, responding tumours had higher

expressions of OPRT than non-responding tumours [63]. In the same study, there was no

difference in UP mRNA between responding and non-responding tumours. The role of UP

in 5-FU sensitivity is probably marginal, since transfection of tumour cells with UP cDNA,

did not affect fluoropyrimidine sensitivity [64]. More research is needed to establish the

exact role of OPRT in 5-FU sensitivity.

Most research of fluoropyrimidine activation pathways has been focused on the role

of TP. Results regarding the role of tumoural TP expression appear to be contradictory.

In patients, high as well as low TP mRNA expression levels have been correlated with

response to 5-FU therapy. An increase in both relapse free survival and overall survival

was suggested in TP-positive compared to TP-negative breast tumours in a small study of

109 patients treated with adjuvant cyclophosphamide, methotrexate and 5-FU (CMF) [65].

Furthermore, in 38 metastatic colorectal cancer patients treated with 5-FU and leucovorin,

TP mRNA levels in non-responding tumours were higher than in responding patients [66].

In 28 patients treated for advanced gastric cancer with 5-FU plus pirarubicin and cisplatin,

high tumour tissue TP expression was associated with response on chemotherapy [67].

In another 126 advanced gastric cancer patients, TP overexpression was associated with

increased patient survival after fluoropyrimidine chemotherapy, but correlated with unfa-

vourable prognosis in patients not treated with fluoropyrimidines [68]. Consequently, it is

hard to draw conclusions from current, in general small trials.

Taking a close look at 5-FU metabolism, one might expect that cells with higher TP levels

would be more sensitive to 5-FU, due to higher FdUMP levels resulting from increased

5-FU activation (see figure 2). However, TP also functions as angiogenesis factor since TP

and platelet derived endothelial cell growth factor (ECGF1) have been recognised as the

same protein. High TP gene expression might therefore be associated with a more aggres-

sive and malignant tumour phenotype [66]. Transfection of cancer cells with TP cDNA has

been performed in several in vitro studies to investigate the effect of TP overexpression

on chemosensitivity. A clear correlation was found between TP activity and in vitro sensi-

Chapter 2

26


27

tivity to the 5-FU analogue 5’-dFUR, and to a lesser extent to 5-FU itself [69-74]. Marchetti

et al. also studied the effect of TP overexpression on in vivo tumour growth in a rat model

[69]. The impact on tumour growth turned out to be relatively modest and only involved

the initial stages of tumour growth. These results suggest that tumour growth and

chemosensitivity are independently related to TP expression. A major point of interest in

interpreting the clinical data in relation to in-vitro data is the role of infiltrating stromal fi-

broblasts and macrophages in TP expression. In most tumour types, TP expression is much

higher in infiltrating cells compared to tumour cells [75]. This may largely trouble the inter-

pretation of data of in vivo PCR as well as IHC studies. Consequently, this aspect particulary

has to be taken into account in study designs to validate TP as predictive marker.

Data on the role of TK in 5-FU chemosensitivity are also contradictory. Chemosensitivity

was unchanged in TK deficient colon cancer cells compared to parent cells, suggesting

only a marginal role of TK in 5FU sensitivity [76]. In another study, TK overexpression has

been associated with 5-FU resistance in gastric tumour cell lines [59], but other groups

found a reduction of TK activity in chemoresistant colon cancer cell lines [58,60]. Intra-

cellular availability of deoxyribose-1-phosphate might account for these differences,

since the activation of 5-FU by TP and TK is fully dependent on the availability of this

co-substrate. If cellular levels of this co-substrate are too low, hardly any 5-FU can be me-

tabolised via this route. Only one patient study is available regarding tumour TK activity in

relation to treatment efficacy. In this study, tumour TK activity could not be related to the

efficacy of second line 5-FU (poly)chemotherapy in 121 advanced breast cancer patients

who failed on first-line tamoxifen treatment [77]. Thus, TK is probably not a strong factor

related to 5-FU sensitivity.

A route that has been extensively evaluated in relation to 5-FU chemoresistance is the in-

tracellular biodegradation of 5-FU by DPD. In vitro experiments in human tumour cell lines

demonstrated an inverse correlation between both DPD mRNA expression and activity

with 5-FU response [78]. DPD mRNA levels were also related to primary 5-FU resistance

in 7 human gastrointestinal cell lines [79]. Furthermore, high DPD activity and DPD mRNA

levels were correlated with low sensitivity to 5FU in 3 human gastric, 2 colon, 1 breast

and 1 pancreatic carcinoma xenografts in the nude mice model [80]. However, data of

presently available clinical studies are less unequivocal. An overview of clinical relevant

studies is presented in table 2. Most studies have been performed in colorectal cancer

[61,81-84 ], some in gastric [85-87], head and neck [88-90], and non-small cell lung cancer

[91-93], and few in breast and bladder cancer [94,95]. A number of studies have indicated

that there is no strong link between DPD mRNA levels and DPD protein activity levels. It

has been reported that DPD mRNA, but not DPD activity, is reduced in colorectal tumours

compared with normal mucosa, although considerable overlap exists in measured mRNA

levels [96-103]. Reduced mRNA levels have also been reported in ovarian cancer [104].

DPD activity appears to be increased in breast cancer (see table 3) [94,105]. This suggests

that DPD is not only regulated at transcriptional and translational but also at the post-

Chapter 2

28


29

Tabl

e 2

Ove

rvie

w o

f stu

dies

rega

rdin

g in

tratu

mor

ial D

PD e

xpre

ssio

n le

vels

in re

latio

n to

chem

osen

sivity

can

cer

pat

ien

tsch

emo

ther

apy

reg

imen

assa

yo

utc

om

ere

fere

nce

Co

lore

ctal

33 100

348

54 309

5-FU

/LV

5-FU

5-FU

5-FU

5-FU

mRN

AEL

ISA

mRN

Aac

tivi

tym

RNA

Low

DPD

rela

ted

to re

spo

nse

No

co

rrel

atio

ns

fou

nd

No

co

rrel

atio

ns

fou

nd

No

co

rrel

atio

ns

fou

nd

Low

DPD

rela

ted

to lo

ng

er s

urv

ival

[81]

[82]

[83]

[61]

[84]

Gas

tric

81 22 38

5-FU

DFU

R5-

FU/M

TX

Act

ivit

yEL

ISA

IHC

Hig

h D

PD re

late

d to

po

or s

urv

ival

Low

DPD

rela

ted

to D

FUR

sen

siti

vity

No

co

rrel

atio

ns

fou

nd

[85]

[86]

[87]

hea

d a

nd

nec

k 62 82 10

9

5-FU

5-FU

/LV

/cis

pla

tin

UFT

acti

vity

acti

vity

IHC

No

co

rrel

atio

ns

fou

nd

No

co

rrel

atio

ns

fou

nd

Low

DPD

co

rrel

ated

wit

h U

FT re

spo

nse

[88]

[89]

[90]

NSC

LC54 68 60

UFT

5-FU

5-FU

IHC

IHC

acti

vity

Low

DPD

co

rrel

ated

wit

h b

ette

r pro

gn

osi

sH

igh

DPD

co

rrel

ated

wit

h p

oo

r su

rviv

alN

o c

orr

elat

ion

s fo

un

d

[91]

[92]

[93]

bre

ast

191

5-FU

acti

vity

Hig

h D

PD re

late

d to

po

or D

FS[9

4]

bla

dd

er74

5-FU

acti

vity

Low

DPD

rela

ted

to 5

-FU

sen

siti

vity

[95]

MTX

= m

etho

trexa

te;; I

HC =

imm

unoh

istoc

hem

istry

Chapter 2

28


29

transcriptional level. This hampers the use of DPD mRNA as predictive marker for 5-FU

efficacy. Inhomogeneity of tumour tissue samples may, in part, also account for conflicting

results.

Summarising, it can be concluded that data on tumour expression levels of 5-FU metabo-

lising enzymes in relation to chemosensitivity is sparse and that studies show conflicting

results. This may at least partly be due to small numbers and therefore lack of statistical

power in the studies.

Capecitabine/tegafur

In the animal model, high TP/DPD ratios have been associated with antitumour efficacy of

capecitabine and its metabolite 5’dFUR in human tumour xenografts [106]. In vivo, high

TP/DPD ratios suggested a better clinical outcome after adjuvant treatment with 5’dFUR

in a study of 88 colorectal cancer patients, and in 17 metastatic gastric cancer patients

[107,108]. TP expression was examined by immunohistochemistry in 650 breast tumours

of patients with early breast cancer receiving adjuvant 5’dFUR [109]. Eight-year follow-up

data showed that high TP expression in the tumour was a favourable prognostic indicator.

Thus, TP expression seems to be a predictive factor for 5’dFUR efficacy. Since the activa-

tion of tegafur depends on several CYP450 enzymes, interindividual variations in enzyme

expression may affect the rate of tegafur metabolism. Indeed, the relative contribution

of each enzyme is known to differ among patients but the clinical consequences of this

phenomenon are unclear [110].

Impact of somatic mutations and gene expression levels: 5-fluorouracil and its target enzymes

Contrary to enzymes related to the 5-FU metabolic activation pathway, the target enzyme

TS has been extensively studied in relation to 5-FU efficacy.

A large amount of preclinical in vitro data suggest a correlation between TS activity and

sensitivity to 5-FU. In a panel of 19 nonselected breast, digestive tract and head and neck

cancer cell lines as well as in a panel of 13 non selected human colon cancer cell lines, the

TS activity was inversely correlated with 5-FU sensitivity [78,111]. Several in vitro studies

in tumour cell lines also suggest TS overexpression as a mechanism of resistance after

repeated exposure to 5-FU [79,112,113]. Chemosensitivity to 5-FU was also increased after

transfection of human colon cancer cells with antisense TS cDNA [114]. However, conflict-

ing data have been observed in clinical studies evaluating the prognostic role of mRNA,

protein and activity levels of TS in relation to tumour response and clinical outcome to 5FU

based chemotherapy. An overview of relevant clinical studies is presented in table 4. Most

studies regarding TS expression in relation to chemosensitivity have been performed in

patients with disseminated colorectal cancer [61,84,115-127], some in gastric cancer

Chapter 2

30


31

[87,128-131] and few studies in head and neck cancer [88,89,132], non-small cell lung

cancer [92,93] pancreatic and breast cancer [77,133,134].

Several factors may account for the difficult interpretation of combined clinical data.

Firstly, it has been reported that TS protein can down-regulate its own translation,

whereas its transcription is regulated by E2F, a cell cycle checkpoint regulator. Together,

this results in low TS levels in stationary phase cells. Although cells with a low TS might

theoretically be more sensitive to 5-FU, the low proliferation rate prevents induction of

DNA damage and 5-FU antitumour efficacy [135]. Secondly, a specific interaction exists

between oncogenes and TS, by binding of TS protein to the p53 and c-myc RNA, while wild

type p53 can also inhibit TS promotor activity. TS inhibition by 5-FU can also result in a

depression of TS protein mediated inhibition of TS mRNA translation leading to induction

of more TS protein synthesis, and p53 protein may further deregulate this process. These

complex indirect and direct interactions between oncogenes and TS may have as yet

Table 3 DPD expression and activity in different tissue types

Tumour type Samples Parameter Tumour vs. Normal reference

Gastrointestinal 51, matched

41, matched

10 tumours + 7 me-tastases, matched

15 tumours + 10 metastases, 25 non-matched controls

36, matched

43, matched

36, matched

40, matched

mRNAactivity

mRNAactivity

mRNA

protein

protein

mRNAproteinactivity

protein

mRNAproteinactivity

lowerno difference

lowerno difference

lower

lower

no difference

lowerno differenceno difference

lower

lowerlowerno difference

[96]

[97]

[98]

[99]

[100]

[101]

[102]

[103]

Ovarian 85 tumour + 27 non-matched controls

mRNA lower [104]

Breast 26, matched49, matched

activityactivity

higherhigher

[105][94]

Chapter 2

30


31

Tabl

e 4

Ove

rvie

w o

f stu

dies

rega

rdin

g in

tratu

mor

ial T

S ex

pres

sion

leve

ls in

rela

tion

to ch

emos

ensiv

ity

can

cer

pat

ien

tsch

emo

ther

apy

reg

imen

assa

yo

utc

om

ere

fere

nce

colo

rect

al

47 46 36 41 52 48 108

27 29 50 134

124

309

54 54

5-FU

/LV

bo

lus

5-FU

/LV

pro

trac

ted

5-FU

/LV

5-

FU/L

V b

olu

s5-

FU/L

V p

rotr

acte

d5-

FU/L

V/M

TX5-

FU/L

V/M

TX5-

FU/L

V/M

TX5-

FU/L

V/M

ITO

or M

ITO

X

5-FU

/LV

/oxa

lipla

tin

5-FU

/IFN

alfa

-2b

5-FU

/LV;

5-F

U/M

TX5F

U/L

V5-

FU5-

FU/L

V

acti

vity

mRN

Am

RNA

+ IH

C T

S106

IHC

po

lycl

on

alIH

C T

S106

IHC

po

lycl

on

alIH

C T

S106

IHC

po

lycl

on

alm

RNA

mRN

AIH

C p

oly

clo

nal

IHC

MRN

AA

ctiv

ity

acti

vity

hig

h T

S re

late

d to

no

n-r

esp

on

seh

igh

TS

rela

ted

to n

on

-res

po

nse

low

TS

rela

ted

to re

spo

nse

low

TS

rela

ted

to re

spo

nse

hig

h T

S re

late

d to

no

n-r

esp

on

selo

w T

S re

late

d to

resp

on

selo

w T

S re

late

d to

resp

on

selo

w m

eta-

TS re

late

d to

resp

on

selo

w T

S re

late

d to

resp

on

seh

igh

TS

rela

ted

to n

on

-res

po

nse

no

co

rrel

atio

ns

fou

nd

low

TS

rela

ted

to re

spo

nse

5FU

/LV

hig

h T

S re

late

d to

lon

ger

su

rviv

allo

w T

S re

late

d to

5-F

U s

ensi

tivi

tylo

w T

S re

late

d to

5-F

U re

spo

nse

Pete

rs e

t al

. [11

4]Le

ich

man

et

al. [

115]

Len

z et

al.

[116

]C

asci

nu

et

al. [

117]

Wo

ng

et

al. [

118]

Asc

hel

e et

al.

[119

]Pa

rad

iso

et

al. [

120]

Asc

hel

e et

al.

[121

]K

orn

man

n e

t al

. [12

2]Sh

iro

ta e

t al

. [12

3]Fi

nd

lay

et a

l. [1

24]

Asc

hel

e et

al.

[125

]K

orn

man

n e

t al

. [84

]Fu

jii e

t al

. [61

]N

oo

rdh

uis

et

al. [

126]

gas

tric

65 38 30 39 38

5-FU

/LV

/cis

pla

tin

5-FU

/LV

/cis

pla

tin

5-FU

/LV

/cis

pla

tin

5-FU

/cis

pla

tin

5-FU

/MTX

mRN

Am

RNA

IHC

TS1

06IH

C

IHC

low

TS

rela

ted

to lo

ng

er s

urv

ival

hig

h T

S re

late

d to

no

n-r

esp

on

seh

igh

TS

rela

ted

to n

on

-res

po

nse

low

TS

rela

ted

to re

spo

nse

no

co

rrel

atio

ns

fou

nd

Len

z et

al.

[127

]M

etzg

er e

t al

. [12

8]Ye

h e

t al

. [12

9]B

oku

et

al. [

130]

Tah

ara

et a

l. [8

7]

hea

d a

nd

nec

k 70 82 52

5-FU

/LV

/cis

pla

tin

/MTX

/IFN

5-FU

/LV

/cis

pla

tin

5-FU

IHC

TS1

06TS

act

ivit

yTS

act

ivit

y

hig

h T

S re

late

d to

no

n-r

esp

on

sen

o c

orr

elat

ion

s fo

un

dn

o c

orr

elat

ion

s fo

un

d

Joh

nst

on

et

al. [

131]

Etie

nn

e et

al.

[89]

Etie

nn

e et

al.

[88]

NSC

LC60 68

in v

itro

5-F

U s

ensi

tivi

ty5-

FU o

r UFT

®Fd

UM

P b

ind

ing

IHC

po

lycl

on

alTS

no

t re

late

d to

5-F

U s

ensi

tivi

tylo

w T

S re

late

d to

lon

ger

su

rviv

alH

igas

hiy

ama

et a

l. [9

3]H

uan

g e

t al

. [92

]

bre

ast

75 121

CA

F re

gim

enC

AF

or C

MF

reg

imen

mRN

ATS

act

ivit

yn

o c

orr

elat

ion

s fo

un

dh

igh

TS

rela

ted

to b

ette

r tre

atm

ent

ef-

ficac

y af

ter f

ailu

re o

n t

amox

ifen

Liza

rd-N

aco

l et

al. [

132]

Foek

ens

et a

l. [7

7]

pan

crea

tic

735-

FU b

ased

TS m

RNA

Hig

h T

S re

late

d to

5-F

U re

spo

nse

Hu

et

al. [

133]

MTX

= m

etho

trexa

te; M

ITO

= m

itom

ycin

e; M

ITOX

= m

itoxa

ntro

ne; IH

C =

imm

unoh

istoc

hem

istry

; TS1

06 =

mon

oclo

nal a

ntib

ody

agai

nst T

S; IF

N =

inte

rfero

n

Chapter 2

32


33

unclear clinical implications [136].

Finally, the assay type may have influenced the outcome of some studies, since

immunohistochemistry as well as rt-PCR were used to measure TS expression.

Immunohistochemistry has been performed using different types of antibodies, including

monoclonal TS106 was well as polyclonal antibodies. Differences in binding specificity

and selectivity may have had a decisive impact on study outcome. Furthermore, the issue

of infiltrating cells disturbing tumour tissue homogeneity and thus troubling PCR data, as

mentioned earlier when interpreting TP data, may also hold for TS.

Acknowledging the importance of TS expression in colorectal cancer, another determinant

for 5-FU cytotoxicity may be the enzyme dUTP nucleotidohydrolase (dUTPase), which is

the key regulator of dUTP pools. There are at least two isoforms of dUTPase, a nuclear

and a mitochondrial form, encoded by the same gene. In tumour cell lines, increased

dUTPase levels accounted for resistance to the 5-FU metabolite 5’dFUR [136,137]. In a

small retrospective study in tumours of 20 metastatic colorectal cancer patients, high

nuclear dUTPase protein expression was associated with poor tumour response on 5-FU

therapy [138]. However, larger studies are needed to establish the role of dUTPase in 5-FU

chemoresistance.

Impact of somatic mutations and gene expression levels: gemcitabine and cytarabine

Resistance to nucleoside analogues can be due to a number of factors, affecting drug

metabolism, including increased deamination, loss of expression of activating kinases,

and increased activity of nucleotidases. In vitro, gene transfer of CDA cDNA into murine

fibroblast cells was shown to induce cellular resistance to ara-C through increased deami-

nation [140]. In patients with acute myeloid leukaemia (AML), pre-treatment CDA activity

did correlate with response on ara-C induction treatment in two studies both involving 36

patients [141,142]. Ara-C resistance has also been associated with low dCK activity both

in vitro [143,144] and in 21 AML patients [145]. In turn, increased dCK activity was associ-

ated with increased activation of both compounds to cytotoxic nucleoside triphosphate

derivates. However, mutational inactivation of dCK is not thought to confer resistance to

ara-C in AML patients because mutations in the dCK gene are rarely found in refractory

or relapsed AML patients [146,147]. Alternatively, inactivation of dCK by the formation of

alternatively spliced dCK transcripts has been demonstrated in 7 out of 12 patients with

resistant AML compared to 1 out of 10 patient with sensitive AML [148]. This mechanism

is probably a cause of therapy failure in patients with resistant AML [149]. Finally, high

5NT expression in blast cells was shown to be an independent prognostic factor for poor

outcome in 108 AML patients after ara-C containing regimens [150]. The balance between

dCK and 5NT might predict drug toxicity, since strongly increased 5NT activity combined

Chapter 2

32


33

with reduced dCK activity was observed in a human leukaemic cell line, resistant to ara-C

and gemcitabine [151].

Apart from resistance to nucleoside analogues caused by aberrant drug metabolism,

altered drug transport may cause decreased chemosensitivity. Recently, overexpression of

the human multidrug resistance protein 5 (MRP5), an ABC transporter known to transport

nucleotide monophosphates, has been associated with resistance to gemcitabine in vitro

[152]. MRP5 mediated efflux of gemcitabine metabolites may lower the accumulation of

gemcitabine in cells. So far, other chemoresistance related transport mechanisms have

not been identified for pyrimidine antagonists.

Other proteins related to pyrimidine antagonist chemosensitivity

As mentioned in the previous sections, expression levels of specific proteins, directly

involved in drug metabolism of pyrimidine antagonists may affect treatment efficacy.

However, expression of genes related to cell growth and the apoptotic pathway may also

affect chemosensitivity. This interaction of apoptosis regulator proteins with chemosen-

sitivity is an intriguing issue, but an extensive analysis of current literature on this subject

falls outside the scope of this review. The most extensively studied genes with regard

to pyrimidine antagonist chemotherapy are bcl-2, bax, c-myc and p53 [153-161]. Here,

we will only briefly report on the putative role of p53 with respect to 5-FU efficacy, as

this relationship has been most extensively studied. Mutations in the p53 gene and p53

overexpression have been associated with 5-FU chemoresistance both in vitro [162-164]

and in vivo in colorectal [117,165-168], head and neck [169,170], and breast cancer [171].

However, results in some other studies are less unequivocal [172,173]. Recently, it has been

suggested that only patients whose primary colorectal tumour contain amplified c-myc

and wild-type p53 might benefit from 5-FU based chemotherapy [174]. Interestingly,

there is an increasing evidence of interactions between TS and p53. P53 gene mutation

and protein overexpression are associated with increased TS mRNA levels and TS cyto-

plasmatic protein in colorectal tumours [117,121,175]. It has been demonstrated that

wild-type p53 is able to bind TS mRNA which results in a feedback regulation of TS protein

synthesis [176]. In cells with mutated p53 this feedback mechanism fails and, as previously

mentioned, overexpression of TS is associated with poor clinical outcome.

Impact of current data on clinical practice

Summarising, we conclude that in tumour material none of the enzymes discussed above

can currently function as predictive marker by itself. So far, only small studies have been

performed and drawing conclusions from combined data of these often statistically

Chapter 2

34


35

Tabl

e 5

Ove

rvie

w o

f pro

tein

s tha

t pot

entia

ly m

ay a

ffect

dru

g tre

atm

ent o

utco

me

due

to a

ltere

d ge

ne e

xpre

ssio

n

Pro

tein

Dru

gP

atie

nt

dat

aC

on

seq

uen

ces

Dih

ydro

pyr

imid

ine

deh

ydro

gen

ase

(DPD

)5-

FU

mis

cella

neo

us

can

cer

typ

esH

igh

DPD

act

ivit

y in

tu

mo

ur t

issu

e as

soci

ated

wit

h

red

uce

d 5

-FU

effi

cacy

dU

TP n

ucl

eoti

do

hyd

rola

se (d

UTP

ase)

5-

FU a

nd

an

alo

gu

esco

lore

ctal

can

cer

Hig

h d

UTP

ase

acti

vity

may

be

asso

ciat

ed w

ith

red

uce

d

5-FU

effi

cacy

Thym

idin

e ki

nas

e (T

K)

5-FU

an

d a

nal

og

ues

bre

ast

can

cer

Un

kno

wn

, in

con

clu

sive

dat

a

Thym

ine

ph

osp

ho

ryla

se /

En

do

thel

ial c

ell g

row

th fa

cto

r (TP

; EC

GF1

)5-

FU

Co

lore

ctal

can

cer

Gas

tric

can

cer

Bre

ast

can

cer

Un

kno

wn

, in

con

clu

sive

dat

a

Thym

idyl

ate

syn

thas

e (T

S)5-

FU a

nd

an

alo

gu

esco

lore

ctal

can

cer

Hig

h T

S ex

pre

ssio

n a

sso

ciat

ed w

ith

red

uce

d 5

-FU

ef-

ficac

y

Cyt

idin

e d

eam

inas

e (C

DA

)A

ra-C

(gem

cita

bin

e)A

cute

mye

loid

leu

kaem

iaH

igh

CD

A e

xpre

ssio

n a

sso

ciat

ed w

ith

red

uce

d e

ffica

cy

of a

ra-C

Deo

xycy

tid

ine

kin

ase

(dC

K)

Ara

-C(g

emci

tab

ine)

Acu

te m

yelo

id le

uka

emia

Low

dC

K e

xpre

ssio

n a

sso

ciat

ed w

ith

resi

sten

ce to

ar

a-C

5’-n

ucl

eoti

das

e(5

NT

)A

ra-C

(gem

cita

bin

e)A

cute

mye

loid

leu

kaem

iaH

igh

5N

T ex

pre

ssio

n a

sso

ciat

ed w

ith

red

uce

d e

ffica

cy

of a

ra-C

Chapter 2

34


35

underpowered studies is fairly impossible due to differences in applied techniques or

patient groups. Clinical practice affecting studies are not available yet. Good predictive

genetic markers or marker sets are lacking. The specificity of a predictive marker needs to

be high, as it will be used to discriminate between treatment options. Probably, panels of

genes will be needed to obtain an adequate specificity. To find such gene panels, far more

studies are needed. Looking at current data, a combination of the expression of DPD, TS,

TP and OPRT, all four crucial enzymes in the metabolism of 5-FU, at least appears to be a

promising approach in colorectal cancer [61-63,177-179] (table 5).

Future perspectives: the polygenetic approach

Despite the here summarised potential genes and proteins interfering with pyrimidine

antagonist metabolism, only few factors indeed have been proven to affect chemothera-

py efficacy and/or toxicity. Most consistent data is available regarding the role of TS, DPD

and p53 in 5-FU chemotherapy, and that of TP in capecitabine chemotherapy (see table 1

and table 5). The impact of germ line DPD deficiency on 5-FU pharmacokinetics and the

development of severe life threatening toxicity is obvious. Although screening on germ

line DPD deficiency is currently believed to be too expensive, it should become standard

clinical practice as soon as a rapid and cheap test becomes available.

Regarding 5-FU efficacy, some attempts recently have been made to identify putative

markers of response in tumour material for use in patient treatment guidance

[89,131,176,180]. However, despite some promising studies, the overall data are difficult

to interpret and not always in line with previous results in larger patient groups. This

might, at least in part, be due to the complexity in transcription and translation of some of

the genes discussed above (e.g. TS). Additional mechanistic studies are needed to explore

this issue more in detail. Furthermore, as mentioned before, many available studies

are insufficiently powered to reach statistical significance. Therefore, incorporation of

pharmacogenomic issues in future phase II and III clinical trials should be encouraged.

Another cause for inconsistency in current data may be found in the applied scientific

methodology. Crucial factor in the search for predictive markers is the availability of a

standardised, accurate, precise and robust test. Method validation, such as performed

for the TS106 antibody for TS immunohistochemistry, is a prerequisite for standardised

testing [181]. Subsequently, these quality controlled diagnostics should be tested not only

retrospectively, but also in prospective multi-center (and multi-laboratory) clinical trials.

Unfortunately, such tests are not available yet.

Also causing inconsistency in the outcome of monogenetic studies may be the fact that

the impact of other genes related to response and survival is ignored in the final calcula-

tions. Since cancer is a genetically heterogeneous disease, the monogenetic approach is

likely too simple. This implies that far more research is needed to gain more insight in the

Chapter 2

36


37

exact role of genetic polymorphisms and gene expression levels on pyrimidine antagonist

chemotherapy. The interaction between TS and p53, combined with the impact of several

TS polymorphisms illustrates the complexity of pharmacogenomic research.

The two most important approaches in current and near future research to find predic-

tive marker sets will be the candidate gene and the microarray strategies. A broad range

of candidate genes to focus on in future research has been summarised in this review.

On the other hand, further developments in microarray techniques and proteomics may

eventually lead to the identification of a subset of relevant genes for a certain drug in

a certain tumour type. In the near future, identification of relevant germline polymor-

phisms, combined with relevant mRNA expression levels in tumour tissue, might permit

more effective, individualised cancer chemotherapy. Ideally, a process of “chemotyping”,

i.e. choosing the right chemotherapy regimen in the right dose, based on selected geno-

typical and phenotypical information, should precede drug prescribing. The interdiscipli-

nary Pharmacogenetics Anticancer Agents Research (PAAR) group is an example of an

excellent initiative to coordinate research on these issues [182]. Eventually, well-controlled

prospective clinical trials with adequate sample size and statistical power will be needed

to demonstrate the surplus value of new concepts above current practice.

Chapter 2

36


37

References

1. Harari PM. Why has induction chemotherapy of advanced head and neck cancer become a

United States community standard of practice? J Clin Oncol 1997;15:2050-2055

2. Macdonald JS, Astrow AB. Adjuvant therapy of colon cancer. Semin Oncol 2001;28:30-40

3. Cochrane Review. Multi-agent chemotherapy for early breast cancer. Cochrane Database Syst

Rev. 2002;CD000487

4. Wiernik PH. Current status of and future prospects for the medical management of adenocarci-

noma of the exocrine pancreas. J Clin Gastroenterol 2000;30:357-363

5. Sorenson S, Glimelius B, Nygren P, SBU group. Swedish Council of Technology Assessment in

Health Care. A systematic overview of chemotherapy effects in non-small cell lung cancer. Acta

Oncol 2001;40:327-339

6. Bishop JF. Approaches to induction therapy with adult acute myeloid leukaemia. Acta Haematol

1998; 99:133-137


1664

8. Diasio RB, Johnson MR. The role of pharmacogenetics and pharmacogenomics in cancer chemo-

therapy with fluorouracil. Pharmacology 2000;61:199-203

9. Ho DH, Townsend L, Luna MA, Bodey GP. Distribution and inhibition of dihydrouracil dehydro-

genase activities in human tissues using 5-fluorouracil as a substrate. Anticancer Res 1986;6:781-

784

10. Kuhn JG. Fluorouracil and the new oral fluorinated pyrimidines. Ann Pharmacother 2001;35:217-

227

11. Kufe DW, Spriggs DR. Biochemical and cellular pharmacology of cytosine arabinoside. Semin

Oncol 1985;12:34-48

12. Plunkett W, Huang P, Xu YZ, Heinemann V, Grunewald R, Gandhi V. Gemcitabine: metabolism,

mechanisms of action, and self-potentiation. Sem Oncol 1995;22:3-10

13. Plunkett W, Huang P, Gandhi V. Preclinical characteristics of gemcitabine. Anticancer Drugs

1995;6:7-13

14. Giblett ER, Anderson JE, Chen SH, Teng YS, Cohen F. Uridine monophosphate kinase: a new ge-

netic polymorphism with possible clinical implications. Am J Hum Genet 1974;26:627-635

15. Komatsu N, Kimura Y, Kido A, Oya M. Polymorphism of uridine monophosphate kinase: popula-

tion study in Japanese and phenotyping in blood stains. Int J Legal Med 1990;104:13-16

16. Halasa J, Schlesinger D, Manczak M. UMPK polymorphism in the Polish population. Arch Immunol

Ther Exp 1985;33:621-624

17. Gallango ML, Suinaga R. Uridine monophosphate polymorphism in two Venezuelan populations.

Am J Hum Genet 1978;30:215-218

18. Suchi M, Mizuno H, Kawai Y, Tsuboi T, Sumi S, Okajima K, Hodgson mE, Ogawa H, Wada Y. Molecular

cloning of the human UMP synthase gene and characterization of point mutations in two heredi-

tary orotic aciduria families. Am J Hum Genet 1997;60:525-539

Chapter 2

38


39

19. Kawakami K, Omura K, Kanehira E, Watanabe Y. Polymorphic tandem repeats in the thymidylate

synthase gene is associated with its protein expression in human gastrointestinal cancers. Anti-

cancer Res 1999;19:3249-3252

20. Marsh S, McKay JA, Cassidy J, McLeod HL. Polymorphism in the thymidylate synthase promoter

enhancer region in colorectal cancer. Int J Oncol 2001;19:383-386

21. Kawakami K, Salonga D, Park JM, Danenberg KD, Uetake H, Brabender J, et al. Different lengths of

a polymorphic repeat sequence in the thymidylate synthase gene affect translational efficiency

but not its gene expression. Clin Cancer Res 2001;7:4096-4101

22. Merkelbach-Bruse S, Hans V, Mathiak M, Sanguedolce R, Alessandro R, Ruschoff J, et al. Associa-

tions between polymorphisms in the thymidylate synthase gene, the expression of thymidylate

synthase mRNA and the microsatellite instability phenotype of colorectal cancer. Oncol Rep

2004; 11:839-843.

23. Marsh S, Colli-Duguid ES, Li T, Liu X, McLeod HL. Ethnic variation in the thymidylate synthase

enhancer region polymorphism among Caucasians and Asian populations. Genomics 1999;58:

310-312

24. Etienne MC, Ilc K, Formento JL, Laurent-Puig P, Formento P, Cheradame S, et al. Thymidylate syn-

thase and methylenetetrahydrofolate reductase gene polymorphisms: relationships with 5-fluo-

rouracil sensitivity. Br J Cancer 2004;90:526-534.

25. Villafranca E, Okruzhnov Y, Dominguez MA, Garcia-Foncillas J, Azinovic I, Martinez E, et al. Poly-

morphisms of the repeated sequences in the enhancer region of the thymidylate synthase gene

promoter may predict downstaging after preoperative chemoradiation in rectal cancer. J Clin

Oncol 2001;19:1779-1786

26. Park DJ, Stoehlmacher J, Zhang W, Tsao-Wei D, Groschen S, Lenz HJ. Thymidylate synthase gene

polymorphism predicts response to capecitabine in advanced colorectal cancer. Int J Colorectal

Dis 2002;17:46-49

27. Iacopetta B, Grieu F, Joseph D, Elsaleh H. A polymorphism in the enhancer region of the thymi-

dylate synthase promoter influences the survival of colorectal cancer patients treated with 5-

fluorouracil. Br J Cancer 2001;85:827-830

28. Tsuji T, Hidaka S, Sawai T, Nakagoe T, Yano H, Haseba M, Komatsu H, Shindou H, Fukuoka H, Yoshi-

naga M, Shibasaki S, Nanashima A, Yamaguchi H, Yasutake T, Tagawa Y. Polymorphism in the

thymidylate synthase promoter enhancer region is not an efficacious marker for tumor sensi-

tivity to 5-fluorouracil-based oral adjuvant chemotherapy in colorectal cancer. Clin Cancer Res

2003;9:3700-3704

29. Jonker DJ, Maroun JA, Le Francois B, Dahrouge S, Birnboim HC. Correlation between 2 thymi-

dylate synthase gene polymorphisms and clinical outcomes in colorectal cancer patients receiv-

ing adjuvant chemotherapy. Proc Am Soc Clin Oncol 2002; abstract 638

30. Kawakami K, Watanabe G. Identification and functional analysis of single nucleotide polymor-

phism in the tandem repeat sequence of thymidylate synthase gene. Cancer Res 2003;63:6004-

6007.

31. Mandola MV, Stoehlmacher J, Muller-Weeks S, Cesarone G, Yu MC, Lenz HJ, Ladner RD. A novel

Chapter 2

38


39

single nucleotide polymorphism within the 5’ tandem repeat polymorphism of the thymidylate

synthase gene abolishes USF-1 binding and alters transcriptional activity. Cancer Res 2003;63:

2898-2904

32. Ulrich CM, Bigler J, Velicer CM, Greene EA, Farin FM, Potter JD. Searching expressed sequence tag

databases: discovery and confirmation of a common polymorphism in the thymidylate synthase

gene. Cancer Epidemiol Biomarkers Prev 2000;9:1381-1385

33. Mandola MV, Stoehlmacher J, Zhang W, Groshen S, Yu MC, Iqbal S, et al. A 6 bp polymorphism

in the thymidylate synthase gene causes message instability and is associated with decreased

intratumoral TS mRNA levels. Pharmacogenetics 2004;14:319-327.

34. Kawakami K, Ishida Y, Danenberg KD, Omura K, Watanabe G, Danenberg PV. Functional polymor-

phism of the thymidylate synthase gene in colorectal cancer accompanied by frequent loss of

heterozygosity. Jpn J Cancer Res 2002;93:1221-1229.

35. Uchida K, Hayashi K, Kawakami K, Schneider S, Yochim JM, Kuramochi H, et al. Loss of heterozy-

gosity at the thymidylate synthase (TS) locus on chromosome 18 affects tumor response and

survival in individuals heterozygous for a 28-bp polymorphism in the TS gene. Clin Cancer Res

2004;10:433-439.

36. Van Kuilenburg ABP, Haasjes J, Richel DJ, Zoetekouw L, Van Lenthe H, Waterham HR, et al. Clinical

implications of dihydropyrimidine dehydrogenase (DPD) deficiency in patients with severe 5-

fluorouracil associated toxicity. Identification of new mutations in the DPD gene. Clin Cancer Res

2000;6:4705-4712

37. Collie-Duguid ES, Etienne MC, Milano G, McLeod HL. Known variant DPYD alleles do not explain

DPD deficiency in cancer patients. Pharmacogenetics 2000;10: 217-223

38. Van Kuilenburg ABP, De Abreu RA, Van Gennip AH. Pharmacogenetic and clinical aspects of dihy-

dropyrimidine dehydrogenase deficiency. Ann Clin Biochem 2003;40:41-45

39. Diasio RB, Beavers TL, Carpenter JT. Familial deficiency of dihydropyrimidine dehydrogenase. Bio-

chemical basis for familial pyrimidinemia and severe 5-fluorouracil-induced toxicity. J Clin Invest

1988;81:47-51

40. Maring JG, van Kuilenburg ABP, Haasjes J, Piersma H, Groen HJM, Uges DRA, et al. Reduced 5-FU

clearance in a patient with low DPD activity due to heterozygosity for a mutant allele of the

DPYD gene. Br J Cancer 2002;86:1028-103

41. Lu Z, Zhang R, Diasio RB. Dihydropyrimidine dehydrogenase activity in human peripheral blood

mononuclear cells and liver: population characteristics, newly identified deficient patients, and

clinical implication in 5-fluorouracil chemotherapy. Cancer Res 1993;53:5433-5438

42. Etienne MC, Lagrange JL, Dassonville O, Fleming R, Thyss A, Renee N, et al. Population study of

dihydropyrimidine dehydrogenase in cancer patients. J Clin Oncol 1994;12:2248-53

43. Mattison LK, Ezzeldin H, Carpenter M, Modak A, Johnson MR, Diasio RB. Rapid identification of di-

hydropyrimidine dehydrogenase deficiency by using a novel 2-13C-uracil breath test. Clin Cancer

Res 2004;10:2652-2658

44. Maring JG, Oonk BN, De Vries EGE, Hospers GAP. Plasma pharmacokinetics of uracil after an oral

uracil challenge dose for dihydropyrimidine dehydrogenase (DPD) phenotyping. Proc Am Soc

Chapter 2

40


41

Clin Oncol 2004; abstract 2120

45. Danenberg PV, Danenberg KD. Effect of 5, 10-methylenetetrahydrofolate on the dissociation of

5-fluoro-2’-deoxyuridylate from thymidylate synthetase: evidence for an ordered mechanism.

Biochemistry 1978;17:4018-24

46. Stern LL, Bagley PJ. Rosenberg IH, Selhub J. Conversion of 5-formylhydrofolic acid to 5-methylhy-

drofolic acid in unimpaired folate-adequate persons homozygous for the C677T mutation in the

methylene tetrahydrofolate reductase gene. J Nutr 2000;130:2238-2242

47. Wilcken B, Bamforth F, Li Z, Zhu H, Ritvanen A, Redlund M, Stoll C, Alembik Y, et.al. Geographical

an ethnic variation of the 677C>T allele of 5,10 methylenetetrahydrofolate reductase (MTHFR):

findings from over 7000 newborns from 16 areas world wide. J Med Genet 2003;40:619-625

48. Wisotzkey JD, Toman J, Bell T, Monk JS, Jones D. Polymorphisms and stage III colon cancer: re-

sponse to therapy. Mol Diagn 2000;5:5-6

49. Kawakami K, Omura K, Kanehira E, Watanabe G. Methylene tetrahydrofolate reductase polymor-

phism is associated with folate pool in gastrointestinal tissue. Anticancer Res 2001;21:285-289

50. Cohen V, Panet-Raymond V, Sabbaghian N, Morin I, Batist G, Rozen R. Methylenetetrahydrofolate

Reductase Polymorphism in Advanced Colorectal Cancer: A Novel Genomic Predictor of Clinical

Response to Fluoropyrimidine-based Chemotherapy. Clin Cancer Res 2003;9:1611-1615.

51. Sohn KJ, Croxford R, Yates Z, Lucock M, Kim YI. Effect of the methylenetetrahydrofolate reductase

C677T polymorphism on chemosensitivity of colon and breast cancer cells to 5-fluorouracil and

methotrexate. J Natl Cancer Inst 2004;96:134-144.

52. Daigo S, Takahashi Y, Fujieda M, Ariyoshi N, Yamazaki H, Koizumi W, et al. A novel mutant allele of

the CYP2A6 gene (CYP2A6*11) found in a cancer patient who showed poor metabolic pheno-

type towards tegafur. Pharmacogenetics 2002;12:299-306

53. Kirch HC, Schroder JK, Hoppe H, Esche H, Seeber S, Schutte J. Recombinant gene products of two

natural variants of the human cytidine deaminase gene confer different deamination rates of

cytarabine in vitro. Exp Hematol 1998;26:421-425

54. Morita T, Matsuzaki A, Kurokawa S, Tokue A. Forced expression of cytidine deaminase confers

sensitivity to capecitabine. Oncology 2003;65:267-274.

55. Marinaki AM, Escuredo E, Duley JA, Simmonds HA, Amici A, Naponelli V, et al. Genetic basis of

hemolytic anemia caused by 5’-nucleotidase deficiency. Blood 2001;97:3327-3332

56. Banerjee D, Gorlick R, Sowers R, Miles JS, Rode W, Kemeny N, et al. Lack of uridine monophosphate

kinase (UMPK) expression in tumour samples from colorectal cancer patients clinically resistant

to 5-fluorouracil. Proc Am Soc Clin Oncol 2002; abstract 350

57. Inaba M, Mitsuhashi J, Sawada H, Miike N, Naoe Y, Daimon A, et al. Reduced activity of anabolizing

enzymes in 5-fluorouracil-resistent human stomach cancer cells. Jpn J Cancer Res 1996;87:212-

220

58. Inaba M, Naoe Y, Mitsuhashi J. Mechanisms of 5-fluorouracil resistance in human colon cancer

DLD-1 cells. Biol Pharm Bull 1998;21:569-573

59. Chung YM, Park SH, Park JK, Kim YT, Kang YK, Yoo YD. Establishment and characterization of 5-

fluorouracil-resistant gastric cancer cells. Cancer Lett 2000;159:95-101

Chapter 2

40


41

60. Murakami Y, Kazuno H, Emura T, Tsujimoto H, Suzuki N, Fukushima M. Different mechanisms of ac-

quired resistance to fluorinated pyrimidines in human colorectal cancer cells. Int J Oncol 2000;17:

277-283

61. Fujii R, Seshimo A, Kameoka S. Relationships between the expression of thymidylate synthase,

dihydropyrimidine dehydrogenase, and orotate phosphoribosyltransferase and cell proliferative

activity and 5-fluorouracil sensitivity in colorectal carcinoma. Int J Clin Oncol 2003;8:72-78.

62. Isshi K, Sakuyama T, Gen T, Nakamura Y, Kuroda T, Katuyama T, et al. Predicting 5-FU sensitivity

using human colorectal cancer specimens: comparison of tumor dihydropyrimidine dehydroge-

nase and orotate phosphoribosyl transferase activities with in vitro chemosensitivity to 5-FU. Int

J Clin Oncol 2002;7:335-342.

63. Ichikawa W, Uetake H, Shirota Y, Yamada H, Takahashi T, Nihei Z, et al. Both gene expression for

orotate phosphoribosyltransferase and its ratio to dihydropyrimidine dehydrogenase influence

outcome following fluoropyrimidine-based chemotherapy for metastatic colorectal cancer. Br J

Cancer 2003;89:1486-1492.

64. Cuq P, Rouquet C, Evrard A, Ciccolini J, Vian L, Cano JP. Fluoropyrimidine sensitivity of human MCF-

7 breast cancer cells stably transfected with human uridine phosphorylase. Br J Cancer 2001;84:

1677-1680.

65. Fox SB, Engels K, Comley M, Whitehouse RM, Turley H, Gatter KC, et al. Relationship of elevated

tumour thymidine phosphorylase in node-positive breast carcinomas to the effects of adjuvant

CMF. Ann Oncol 1997;8:271-275

66. Metzger R, Danenberg K, Leichman CG, Salonga D, Schwartz EL, Wadler S, et al. High basal level

gene expression of thymidine phosphorylase (platelet-derived endothelial cell growth factor) in

colorectal tumors is associated with nonreponse to 5-fluorouracil. Clin Cancer Res 1998;4:2371-

2376

67. Kikuyama S, Inada T, Shimizu K, Miyakita M, Ogata Y. P53, bcl-2 and thymidine phosphorylase

as predictive markers of chemotherapy in patients with advanced and recurrent gastric cancer.

Anticancer Res 2001;21:2149-2153

68. Saito H, Tsujitani S, Oka S, Kondo A, Ikeguchi M, Maeta M, et al. The expression of thymidine phos-

phorylase correlates with angiogenesis and the efficacy of chemotherapy using fluorouracil

derivatives in advanced gastric carcinoma. Br J Cancer 1999;81:484-489

69. Marchetti S, Chazal M, Dubreuil A, Fischel JL, Etienne MC, Milano G. Impact of thymidine phos-

phorylase surexpression on fluoropyrimidine activity and on tumour angiogenesis. Br J Cancer

2001;85:439-445

70. Morita T, Matsuzaki A, Tokue A. Enhancement of sensitivity to capecitabine in human renal carci-

noma cells transfected with thymidine phosphorylase cDNA. Int J Cancer 2001;92:451-456

71. de Bruin M, van Capel T, Van der Born K, Kruyt FA, Fukushima M, Hoekman K, et al. Role of platelet-

derived endothelial cell growth factor/thymidine phosphorylase in fluoropyrimidine sensitivity.

Br J Cancer 2003;88:957-964

72. Evrard A, Cuq P, Robert B, Vian L, Pelegrin A, Cano JP. Enhancement of 5-fluorouracil cytotoxicity

by human thymidine-phosphorylase expression in cancer cells: in vitro and in vivo study. Int J

Chapter 2

42


43

Cancer 1999;80:465-470

73. Evrard A, Cuq P, Ciccolini J, Vian L, Cano JP. Increased cytotoxicity and bystander effect of 5-fluoro-

uracil and 5-deoxy-5-fluorouridine in human colorectal cancer cells transfected with thymidine

phosphorylase. Br J Cancer 1999;80:1726-1733.

74. Schwartz EL, Baptiste N, Wadler S, Makower D. Thymidine phosphorylase mediates the sensitivity

of human colon carcinoma cells to 5-fluorouracil. J Biol Chem 1995;270:19073-19077.

75. van Triest B, Pinedo HM, Blaauwgeers JL, van Diest PJ, Schoenmakers PS, Voorn DA, et al. Prog-

nostic role of thymidylate synthase, thymidine phosphorylase/platelet-derived endothelial cell

growth factor, and proliferation markers in colorectal cancer. Clin Cancer Res 2000;6:1063-1072

76. Radparvar S, Houghton PJ, Germain G, Pennington J, Rahman A, Houghton JA. Cellular pharma-

cology of 5-fluorouracil in a human colon adenocarcinoma cell line selected for thymidine kinase

deficiency. Biochem Pharmacol 1990;39:1759-1765

77. Foekens JA, Romain S, Look MP, Martin PM, Klijn JG. Thymidine kinase and thymidine synthase in

advanced breast cancer: response to tamoxifen and chemotherapy. Cancer Res 2001;61:1421-

1425

78. Beck A, Etienne MC, Cheradame S, Fischel JL, Formento P, Renee N, et al. A role for dihydropyrimi-

dine dehydrogenase and thymidylate synthase in tumour sensitivity to fluorouracil. Eur J Cancer

1994;30A:1517-1522

79. Kirihara Y, Yamamoto W, Toge T, Nishiyama M. Dihydropyrimidine dehydrogenase, multidrug

resistance-associated protein, and thymidylate synthase gene expression levels can predict 5-

fluorouracil resistance in human gastrointestinal cancer cells. Int J Oncol 1999;14:551-556

80. Ishikawa Y, Kubota T, Otani Y, Watanabe M, Teramoto T, Kumai K, et al. Dihydropyrimidine dehydro-

genase activity and messenger RNA level may be related to the antitumor effect of 5-fluorouracil

on human tumor xenografts in nude mice. Clin Cancer Res 1999;5:883-889

81. Salonga D, Danenberg KD, Johnson M, Metzger R, Groshen S, Tsao-Wei DD, et al. Colorectal tumors

responding to 5-fluorouracil have low gene expression levels of dihydropyrimidine dehydroge-

nase, thymidylate synthase, and thymidine phosphorylase. Clin Cancer Res 2000;6:1322-1327

82. Ikeguchi M, Makino M, Kaibara N. Thymidine phosphorylase and dihydropyrimidine dehydroge-

nase activity in colorectal carcinoma and patients prognosis. Langenbecks Arch Surg 2002;387:

240-245

83. Kornmann M, Link KH, Galuba I, Ott K, Schwabe W, Hausler P et al. Association of time to recur-

rence with thymidylate synthase and dihydropyrimidine dehydrogenase mRNA expression in

stage II and III colorectal cancer. J Gastrointest Surg 2002;6:331-337

84. Kornmann M, Schwabe W, Sander S, Kron M, Strater J, Polat S, et al. Thymidylate synthase and

dihydropyrimidine dehydrogenase mRNA expression levels: predictors for survival in colorectal

cancer patients receiving adjuvant 5-fluorouracil. Clin Cancer Res 2003;9:4116-4124

85. Terashima M, Irinoda T, Fujiwara H, Nakaya T, Takagane A, Abe K, et al. Roles of thymidylate syn-

thase and dihydropyrimidine dehydrogenase in tumor progression and sensitivity to 5-fluoro-

uracil in human gastric cancer. Anticancer Res 2002;22(2A):761-768

86. Terashima M, Fujiwara H, Takagane A, Abe K, Araya M, Irinoda T, et al. Role of thymidine phos-

Chapter 2

42


43

phorylase and dihydropyrimidine dehydrogenase in tumour progression and sensitivity to doxi-

fluridine in gastric cancer patients. Eur J Cancer 2002;38:2375-2381

87. Tahara M, Ochiai A, Fujimoto J, Boku N, Yasui W, Ohtsu A, et al. Expression of thymidylate syn-

thase, thymidine phosphorylase, dihydropyrimidine dehydrogenase, E2F-1, Bak, Bcl-X, and Bcl-2,

and clinical outcomes for gastric cancer patients treated with bolus 5-fluorouracil. Oncol Rep

2004;11:9-15

88. Etienne MC, Cheradame S, Fischel JL, Formento P, Dassonville O, Renee N, et al. Response to fluor-

ouracil therapy in cancer patients: the role of tumoral dihydropyrimidine dehydrogenase activity.

J Clin Oncol 1995;13:1663-1670

89. Etienne MC, Pivot X, Formento JL, Bensadoun RJ, Formento P, Dassonville O, et al. A multifacto-

rial approach including tumoural epidermal growth factor receptor, p53, thymidylate synthase

and dihydropyrimidine dehydrogenase to predict treatment outcome in head and neck cancer

patients receiving 5-fluorouracil. Br J Cancer 1999;79:1864-1869

90. Kawasaki G, Yoshitomi I, Yanamoto S, Mizuno A. Thymidylate synthase and dihydropyrimidine

dehydrogenase expression in oral squamous cell carcinoma: an immunohistochemical and clini-

copathologic study. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2002;94:717-723

91. Nakagawa T, Tanaka F, Takata T, Matsuoka K, Miyahara R, Otake Y, Yanagihara K, Fukushimab M,

Wada H. Predictive value of dihydropyrimidine dehydrogenase expression in tumor tissue,

regarding the efficacy of postoperatively administered UFT (Tegafur + Uracil) in patients with

p-stage I nonsmall-cell lung cancer. J Surg Oncol 2002;81:87-92

92. Huang CL, Yokomise H, Kobayashi S, Fukushima M, Hitomi S, Wada H. Intratumoral expression

of thymidylate synthase and dihydropyrimidine dehydrogenase in non-small cell lung cancer

patients treated with 5-FU based chemotherapy. Int J Oncol 2000;17:47-54

93. Higashiyama M, Kodama K, Yokouchi H, Takami K, Fukushima M, Minamigawa K, et al. Thymidylate

synthase and dihydropyrimidine dehydrogenase activities in non-small cell lung cancer tissues:

relationship with in vitro sensitivity to 5-fluorouracil. Lung Cancer 2001;34:407-416

94. Horiguchi J, Yoshida T, Koibuchi Y, Iijima K, Ninomiya J, Takei H, et al. DPD activity and immunohis-

tochemical DPD expression in human breast cancer. Oncol Rep 2004;11:65-72

95. Mizutani Y, Wada H, Fukushima M, Yoshida O, Ukimura O, Kawauchi A, et al. The significance of di-

hydropyrimidine dehydrogenase (DPD) activity in bladder cancer. Eur J Cancer 2001;37:569-575

96. Uetake H, Ichikawa W, Takechi T, Fukushima M, Nihei Z, Sugihara K. Relationship between intra-

tumoral dihydropyrimidine dehydrogenase activity and gene expression in human colorectal

cancer. Clin Cancer Res 1999;5:2836-2839

97. Ishikawa Y, Kubota T, Otani Y, Watanabe M, Teramoto T, Kumai K, et al. Thymidylate synthetase and

dihydropyrimidine dehydrogenase levels in gastric cancer. Anticancer Res 1999;19(6C):5635-

5640

98. Johnston SJ, Ridge SA, Cassidy J, McLeod HL. Regulation of dihydropyrimidine dehydrogenase in

colorectal cancer. Clin Cancer Res 1999;5:2566-2570

99. Collie-Duguid ES, Johnston SJ, Boyce L, Smith N, Cowieson A, Cassidy J, et al. Thymidine phos-

phorylase and dihydropyrimidine dehydrogenase protein expression in colorectal cancer. Int J

Chapter 2

44


45

Cancer 2001;94:297-301

100. Hiroyasu S, Shiraishi M, Samura H, Tokashiki H, Shimoji H, Isa T, et al. Clinical relevance of the

concentrations of both pyrimidine nucleoside phosphorylase (PyNPase) and dihydropyrimidine

dehydrogenase (DPD) in colorectal cancer. Jpn J Clin Oncol 2001;31:65-68

101. Miyamoto S, Ochiai A, Boku N, Ohtsu A, Tahara M, Yoshida S, et al. Discrepancies between the gene

expression, protein expression, and enzymatic activity of thymidylate synthase and dihydropy-

rimidine dehydrogenase in human gastrointestinal cancers and adjacent normal mucosa. Int J

Oncol 2001;18:705-713

102. Hotta T, Taniguchi K, Kobayashi Y, Johata K, Sahara M, Naka T, et al. Comparative analysis of thymi-

dine phosphorylase and dihydropyrimidine dehydrogenase expression in gastric and colorectal

cancers. Oncol Rep 2004;11:1045-1051

103. Tanaka-Nozaki M, Onda M, Tanaka N, Kato S. Variations in 5-fluorouracil concentrations of color-

ectal tissues as compared with dihydropyrimidine dehydrogenase (DPD) enzyme activities and

DPD messenger RNA levels. Clin Cancer Res 2001;7:2783-2787

104. Fujiwaki R, Hata K, Nakayama K, Fukumoto M, Miyazaki K. Gene expression for dihydropyrimidine

dehydrogenase and thymidine phosphorylase influences outcome in epithelial ovarian cancer. J

Clin Oncol 2000;18:3946-3951

105. Anan K, Mitsuyama S, Tamae K, Suehara N, Nishihara K, Ogawa Y, et al. Increased dihydropyrimi-

dine dehydrogenase activity in breast cancer. J Surg Oncol 2003;82:174-179

106. Ishikawa T, Sekiguchi F, Fukase Y, Sawada N, Ishitsuka H. Positive correlation between the efficacy

of capecitabine and doxifluridine and the ratio of thymidine phosphorylase to dihydropyrimi-

dine dehydrogenase activities in tumors in human cancer xenografts. Cancer Res 1998;58:685-

690

107. Nishimura G, Terada I, Kobayashi T, Ninomiya I, Katigawa H, Fushida S, et al. Thymidine phosphory-

lase and dihydropyrimidine dehydrogenase levels in primary colorectal cancer show a relation-

ship to clinical effects of 5’-deoxy-5-fluorouridine as adjuvant chemotherapy. Oncol Rep 2002;9:

479-482

108. Nishina T, Hyodo I, Moriwaki T, Endo S, Hirasaki S, Doi T, et al. The ratio of thymidine phosphorylase

(TP) to dihydropyrimidine dehydrogenase (DPD) levels in tumour tissues is predictive of re-

sponse to 5’-deoxy-5-fluorouridine (an intermediate metabolite of capecitabine): a prospective

study in patients with metastatic gastric cancer. Proc Am Soc Clin Oncol 2002; abstract 602

109. Tominaga T, Toi M, Ohashi Y, Abe O; on behalf of the 5’-BC study group. Prognostic and predictive

value of thymidine phosphorylase activity in early-stage breast cancer patients. Clin Breast Can-

cer 2002;3:55-64

110. Komatsu T, Yamazaki H, Shimada N, Nakajima M, Yokoi T. Roles of cytochromes P450 1A2, 2A6 and

2C8 in 5-fluorouracil formation from tegafur, an anticancer prodrug, in human liver microsomes.

Drug Metab Dispos 2000;28:1457-1463

111. van Triest B, Pinedo HM, van Hensbergen Y, Smid K, Telleman F, Schoenmakers PS, et al. Thymi-

dylate synthase level as the main predictive parameter for sensitivity to 5-fluorouracil, but not

for folate-based thymidylate synthase inhibitors, in 13 nonselected colon cancer cell lines. Clin

Chapter 2

44


45

Cancer Res 1999;5:643-654

112. Fukushima M, Fujioka A, Uchida J, Nakagawa F, Takechi T. Thymidylate synthase (TS) and ribo-

nucleotide reductase (RNR) may be involved in acquired resistance to 5-fluorouracil (5-FU) in

human cancer xenografts in vivo. Eur J Cancer 2001;37:1681-1687

113. Copur S, Aiba K, Drake JC, Allegra CJ, Chu E. Thymidylate synthase gene amplification in human

colon cancer cell lines resistant to 5-fluorouracil. Biochem Pharmacol 1995;49:1419-1426

114. Matsuoka K, Tsukuda K, Suda M, Kobayashi K, Ota T, Okita A, et al. The transfection of thymidylate

synthase antisense suppresses oncogenic properties of a human colon cancer cell line and aug-

ments the antitumor effect of fluorouracil. Int J Oncol 2004;24:217-222

115. Peters GJ, Van der Wilt CL, Van Groeningen CJ, Smid K, Meijer S, Pinedo HM. Thymidylate synthase

inhibition after adminstration of fluorouracil with or without leucovorin in colon cancer patients:

implications for treatment with fluorouracil. J Clin Oncol 1994;12:2035-2042

116. Leichman CG, Lenz HJ, Leichman L, Danenberg K, Baranda J, Groshen S, et al. Quantitation of intra-

tumoral thymidylate synthase expression predicts for disseminated colorectal cancer response

and resistance to protracted-infusion fluorouracil and weekly leucovorin. J Clin Oncol 1997;15:

3223-3229

117. Lenz HJ, Hayashi K, Salonga D, Danenberg KD, Danenberg PV, Metzger R, et al. P53 point muta-

tions and thymidylate synthase messenger RNA levels in disseminated colorectal cancer: an

analysis of response and survival. Clin Cancer Res 1998;4:1243-1250

118. Cascinu S, Aschele C, Barni S, Debernardis D, Baldo C, Tunesi G, et al. Thymidylate synthase protein

expression in advanced colon cancer: correlation with the site of metastasis and the clinical re-

sponse to leucovorin-modulated bolus 5-fluorouracil. Clin Cancer Res 1999;5:1996-1999

119. Wong NACS, Brett L, Stewart M, Leitch A, Longley DB, Dunlop MG, et al. Nuclear thymidylate syn-

thase expression, p53 expression and 5FU response in colorectal carcinoma. Br J Cancer 2001;85:

1937-1943

120. Aschele C, Debernardis D, Casazza S, Antonelli G, Tunesi G, Baldo C, et al. Immunohistochemical

quantitiation of thymidylate synthase expression in colorectal cancer metastases predicts for

clinical outcome to fluorouracil based chemotherapy. J Clin Oncol 1999;17:1760-1770

121. Paradiso A, Simone G, Petroni S, Leone B, Vallejo C, Lacava J, et al. Thymidylate synthase and p53

primary tumour expression as predictive factors for advanced colorectal cancer patients. Br J

Cancer 2000;82:560-567

122. Aschele C, Debernardis D, Tunesi G, Maley F, Sobrero A. Thymidylate synthase protein expression

in primary colorectal cancer compared with the corresponding distant metastases and relation-

ship with clinical response to 5-fluorouracil. Clin Cancer Res 2000;6:4797-4802

123. Kornmann M, Link KH, Lenz HJ, Pillasch J, Metzger R, Butzer U, et al. Thymidylate synthase is a

predictor for response and resistance in hepatic artery infusion therapy. Cancer Lett 1997;118:

29-35

124. Shirota Y, Stoehlmacher J, Brabender J, Xiong YP, Uetake H, Danenberg KD, et al. EECC1 and thymi-

dylate synthase mRNA levels predict survival for colorectal cancer patients receiving combina-

tion oxaliplatin and fluorouracil chemotherapy. J Clin Oncol 2001;19:4298-4304

Chapter 2

46


47

125. Findley MP, Cunningham D, Morgan G, Clinton S, Hardcastle A, Aherne GW. Lack of correlation

between thymidylate synthase levels in primary colorectal tumours and subsequent response to

chemotherapy. Br J Cancer 1997;75:903-909

126. Aschele C, Debernardis D, Bandelloni R, Cascinu S, Catalano V, Giordani P, et al. Thymidylate

synthase protein expression in colorectal cancer metastases predicts for clinical outcome to

leucovorin-modulated bolus or infusional 5-fluorouracil but not methotrexate-modulated bolus

5-fluorouracil. Ann Oncol 2002;13:1882-1892

127. Noordhuis P, Holwerda U, Van Der Wilt CL, Van Groeningen CJ, Smid K, Meijer S, et al. 5-Fluoro-

uracil incorporation into RNA and DNA in relation to thymidylate synthase inhibition of human

colorectal cancers. Ann Oncol 2004;15:1025-1032

128. Lenz HJ, Leichman CG, Danenberg KD, Danenberg PV, Groshen S, Cohen H, et al. Thymidylate syn-

thase mRNA level in adenocarcinoma of the stomach: a predictor for primary tumour response

and overall survival. J Clin Oncol 1996;14:176-18

129. Metzger R, Leichman CG, Danenberg KD, Danenberg PV, Lenz HJ, Hayashi K, et al. ERCC1 mRNA

levels complement thymidylate synthase mRNA levels in predicting response and survival for

gastric cancer patients receiving combination cisplatin and fluorouracil chemotherapy. J Clin

Oncol 1998;16:309-316

130. Yeh KH, Shun CT, Chen CL, Lin JT, Lee WJ, Lee PH, et al. High expression of thymidylate synthase

is associated with the drug resistance of gastric carcinoma to high dose 5-fluorouracil-based

systemic chemotherapy. Cancer 1998;82:1626-1631

131. Boku N, Chin K, Hosokawa K, Ohtsu A, Tajiri H, Yoshida S, et al. Biological markers as a predictor for

response and prognosis of unresectable gastric cancer patients treated with 5-fluorouracil and

cis-platinum. Clin Cancer Res 1998;4:1469-1474

132. Johnston PG, Mick R, Recant W, Behan KA, Dolan ME, Ratain MJ, et al. Thymidylate synthase ex-

pression and response to neoadjuvant chemotherapy in patients with advanced head and neck

cancer. J Natl Cancer Inst 1997;89:308-13

133. Lizard-Nacol S, Genne P, Coudert B, Riedinger JM, Arnal M, Sancy C, et al. MRD1 and thymidylate

synthase (TS) gene expressions in advanced breast cancer: relationship to drug exposure, p53

mutations, and clinical outcome in the patients. Anticancer Res 1999;19:3575-3582

134. Hu YC, Komorowski RA, Graewin S, Hostetter G, Kallioniemi OP, Pitt HA, et al. Thymidylate synthase

expression predicts the response to 5-fluorouracil-based adjuvant therapy in pancreatic cancer.

Clin Cancer Res 2003;9:4165-4171

135. Peters GJ, Backus HH, Freemantle S, van Triest B, Codacci-Pisanelli G, van der Wilt CL, et al. Induc-

tion of thymidylate synthase as a 5-fluorouracil resistance mechanism. Biochim Biophys Acta

2002;1587:194-205

136. Van Triest B, Pinedo HM, Giaccone G, Peters GJ. Downstream molecular determinants of response

to 5-fluorouracil and antifolate thymidylate synthase inhibitors. Ann Oncol 2000;11:385-391

137. Canman CE, Tang HY, Normolle DP, Lawrence TS, Maybaum J. Variations in patterns of DNA dam-

age induced in human colorectal tumour cells by 5-fluorodeoxyuridine: implications for mecha-

nisms of resistance and cytotoxicity. Proc Natl Acad Sci 1992;89:10474-10478

Chapter 2

46


47

138. Canman CE, Radany EH, Parsels LA, Davis MA, Lawrence TS, Maybaum J. Induction of resistance

to fluorodeoxyuridine cytotoxicity and DNA damage in human tumour cells by expression of

Escherichia coli deoxyuridinetriphophatease. Cancer Res 1994;54:2296-2298

139. Ladner RD, Lynch FJ, Groshen S, Xiong YP, Sherrod A, Caradonna SJ, et al. dUPT nucleotidohydro-

lase isoform expression in normal and neoplasmic tissues: association with survival and response

to 5-fluorouracil in colorectal cancer. Cancer Res 2000;60:3493-3503

140. Schroder JK, Kirch C, Flasshove M, Kalweit H, Seidelmann M, Hilger R, et al. Constitutive over-

expression of the cytidine deaminase gene confers resistance to cytosine arabinoside in vitro.

Leukemia 1996;10:1919-1924

141. Jahns-streubel G, Reuter C, Auf der Landwehr U, Unterhalt M, Schleyer E, Wormann B, et al. Ac-

tivity of thymidine kinase and of polymerase alpha as well as activity and gene expression of

deoxycytidine deaminase in leukemic blasts are correlated with clinical response in the setting

of granulocyte-macrophage colony-stimulating factor-based priming before and during TAD-9

induction therapy in acute myeloid leukemia. Blood 1998;90:1968-1976

142. Schroder JK, Kirch C, Seeber S, Schutte J. Structural and functional analysis of the cytidine deami-

nase gene in patients with acute myeloid leukaemia. Br J Haematol 1998;103:1096-1103

143. Owens JK, Shewach DS, Ullman B, Mitchell BS. Resistance to 1-beta-D-arabinofuranosylcytosine

in human T-lymphoblasts mediated by mutations within the deoxycytidine kinase gene. Cancer

Res 1992;52:2389-2393

144. Kobayashi T, Kakihara T, Uchiyama M, Fukuda T, Kishi K, Shibata A. Low expression of the deoxycy-

tidine kinase (dCK) gene in a 1-beta-D-arabinofuranosylcytosine-resistant human leukemic cell

line KY-Ra. Leuk Lymphoma 1994;15:503-505

145. Colly LP, Peters WG, Richel D, Arentsen-Honders MW, Starrenburg CW, Willemze R. Deoxycytidine

kinase and deoxycytidine deaminase values correspond closely to clinical response to cytosine

arabinoside remission induction therapy in patients with acute myelogenous leukemia. Semin

Oncol 1987;14:257-261

146. Flasshove M, Strumberg D, Ayscue L, Mitchell BS, Tirier C, Heit W, et al. Structural analysis of the

deoxycytidine kinase gene in patients with acute myeloid leukemia and resistance to cytosine

arabinoside. Leukemia 1994;8:780-785

147. Van den Heuvel-Eibrink MM, Wiemer EAC, Kuijpers M, Pieters R, Sonneveld P. Absence of muta-

tions in the deoxycytidine kinase (dCK) gene in patients with relapsed and/or refractory acute

myeloid leukemia (AML). Leukemia 2001;15:855-867

148. Veuger MJ, Honders MW, Landegent JE, Willemze R, Barge RM. High incidence of alternatively

spliced forms of deoxycytidine kinase in patients with resistant acute myeloid leukemia. Blood

2000;96:1517-1524

149. Veuger MJT, Heemskerk MHM, Honders W, Willemze R, Berge RMY. Functional role of alternatively

spliced deoxycytidine kinase in sensitivity to cytarabine of acute myeloid leukemic cells. Blood

2002;99:1373-1380

150. Galmarini CM, Graham K, Thomas X, Calvo F, Rousselot P, El Jafaari A, et al. Expression of high Km

5’-nucleotidase in leukemic blasts is an independent prognostic factor in adults with acute my-

Chapter 2

48


49

eloid leukemia. Blood 2001;98:1922-1926

151. Dumontet C, Fabianowska-Majewska K, Mantincic D, Callet Bauchu E, Tigaud I, Gandhi V, et al.

Common resistance mechanisms to deoxynucleoside analogues in variants of the human eryth-

roleukaemic line K562. Br J Haematol 1999;106:78-85

152. Davidson JD, Ma L, Iverson PW, Lesoon A, Jin S, Horwitz L, et al. Human multidrug resistance pro-

tein 5 (MRP5) confers resistance to gemcitabine. Proc AACR 2002; abstract 3868

153. Mirjolet JF, Barberi-Heyob M, Didelot C, Peyrat JP, Abecassis J, Millon R, et al. Bcl-2/Bax protein ratio

predicts 5-fluorouracil sensitivity independently of p53 status. Br J Cancer 2000;83:1380-1386

154. Yang QF, Sakurai T, Yoshimura G, Shan L, Suzuma T, Tamaki T, et al. Expression of Bcl-2 but not

Bax or p53 correlates with in vitro resistance to a series of anticancer drugs in breast carcinoma.

Breast Cancer Res Treat 2000;61:211-216

155. Keith FJ, Bradbury DA, Zhu YM, Russell NH. Inhibition of bcl-2 with antisense oligonucleotides in-

duces apoptosis and increases the sensitivity of AML blasts to Ara-C. Leukemia 1995;9:131-138

156. Ahmed N, Sammons J, Hassan HT. Bcl-2 protein in human myeloid leukaemia cells and its down-

regulation during chemotherapy-induced apoptosis. Oncol Rep 1999;6:403-407

157. Balkham SE, Sargent JM, Elgie AW, Williamson CJ, Taylor CG. Comparison of BCL-2 and BAX protein

expression with in vitro sensitivity to ARA-C and 6TG in AML. Adv Exp Med Biol 1999;457:335-

340

158. Bold RJ, Chandra J, McConkey DJ. Gemcitabine-induced programmed cell death (apoptosis) of

human pancreatic carcinoma is determined by Bcl-2 content. Ann Surg Oncol 1999;6:279-285

159. Van Slooten HJ, Clahsen PC, van Dierendonck JH, Duval C, Pallud C, Mandard AM, et al. Expression

of Bcl-2 in node-negative breast cancer is associated with various prognostic factors, but does

not predict response to one course of perioperative chemotherapy. Br J Cancer 1996;74:78-85

160. Schneider HJ, Sampson SA, Cunningham D, Norman AR, Andreyev HJ, Tilsed JV, et al. Bcl-2 expres-

sion and response to chemotherapy in colorectal adenocarcinomas. Br J Cancer 1997;75:427-

431

161. Nabeya Y, Loganzo F Jr, Maslak P, Lai L, de Oliveira AR, Schwartz GK, et al. The mutational status of

p53 protein in gastric and esophageal adenocarcinoma cell lines predicts sensitivity to chemo-

therapeutic agents. Int J Cancer 1995;64:37-46

162. Zheng M, Wang H, Zhang H, Ou Q, Shen B, Li N, et al. The influence of the p53 gene on the in vitro

chemosensitivity of colorectal cancer cells. J Cancer Res Clin Oncol 1999;125:357-360

163. Petak I, Tillman DM, Houghton JA. P53 dependence of Fas induction and acute apoptosis in re-

sponse to 5-fluorouracil-leucovorin in human colon carcinoma cell lines. Clin Cancer Res 2000;6:

4432-4441

164. Benhattar J, Cerottini JP, Saraga E, Metthez G, Givel JC. P53 mutations as a possible predictor of

response to chemotherapy in metastatic colorectal carcinomas. Int J Cancer 1996;69:190-192

165. Ahnen DJ, Feigl P, Quan G, Fenoglio-Preiser C, Lovato LC, Bunn PA, et al. Ki-ras mutation and p53

overexpression predict the clinical behavior of colorectal cancer: a Southwest Oncology Group

Study. Cancer Res 1998;58:1149-1158

166. Backus HHJ, Van Riel JMGH, Van Groeningen CJ, Vos W, Dukers DF, Bloemena E, et al. Rb, mcl-1 and

Chapter 2

48


49

p53 expression correlate with clinical outcome in patients with liver metastases from colorectal

cancer. Ann Oncol 2001;12:779-785

167. Liang JT, Huang KC, Cheng YM, Hsu HC, Cheng AL, Hsu CH, et al. P53 overexpression predicts poor

chemosensitivity to high-dose 5-fluorouracil plus leucovorin chemotherapy for stage IV colorec-

tal cancers after palliative bowel resection. Int J Cancer 2002;97:451-457

168. Cabelguenne A, Blons H, de Waziers I, Carnot F, Houllier AM, Soussi T, et al. P53 alterations predict

tumour response to neoadjuvant chemotherapy in head and neck squamous cell carcinoma: a

prospective series. J Clin Oncol 2000;18:1465-73

169. Temam S, Flahault A, Perie S, Monceaux G, Coulet F, Callard P, et al. P53 gene status as a predictor

of tumour response to induction chemotherapy of patients with locoregionally advanced squa-

mous cell carcinomas of the head and neck. J Clin Oncol 2000;18:385-394

170. Kandioler-Eckersberger D, Ludwig C, Rudas M, Kappel S, Janschek E, Wenzel C, et al. TP53 mutation

and p53 overexpression for prediction of response to neoadjuvant treatment in breast cancer

patients. Clin Cancer Res 2000;6:50-56

171. Elsaleh H, Powell B, Soontrapornchai P, Joseph D, Goria F, Spry N, et al. P53 gene mutation, micro-

satellite instability and adjuvant chemotherapy: impact on survival of 388 patients with Dukes C

carcinoma. Oncology 2000;58:52-59

172. Rosty C, Chazal M, Etienne MC, Letoublon C, Bourgeon A, Delpero JR, et al. Determination of

microsatellite instability, p53 and K-RAS mutations in hepatic metastases from patients with

colorectal cancer: relationship with response to 5-fluorouracil and survival. Int J Cancer 2001;95:

162-167

173. Arango D, Corner GA, Wadler S, Catalano PJ. Augenlicht LH. C-myc/p53 interaction determines

sensitivity of human colon carcinoma cells to 5-fluorouracil in vitro and in vivo. Cancer Res

2001;61:4910-4915

174. Lenz HJ, Danenberg KD, Leichman CG, Florentine B, Johnston PG, Groshen S, et al. P53 and thymi-

dylate synthase expression in untreated stage II colon cancer: association with recurrence, sur-

vival and site. Clin Cancer Res 1998;4:1227-1234

175. Peters GJ, Van Triest B, Backus HHJ, Kuiper CM, Van der Wilt CL, Pinedo HM. Molecular downstream

events and induction of thymidylate synthase in mutant and wild-type p53 colon cancer cell

lines after treatment with 5-fluorouracil and the thymidylate synthase inhibitor raltitrexed. Eur J

Cancer 2000;36:916-924

176. McKay RA, Lloret C, Murray GI, Johnston PG, Bicknell R, Ahmed FY, et al. Application of the enrich-

ment approach to identify putative markers of reponse to 5-fluorouracil therapy in advanced

colorectal carcinomas. Int J Oncol 2000;17:153-158

177. Ichikawa W, Uetake H, Shirota Y, Yamada H, Nishi N, Nihei Z, et al. Combination of dihydropyrimi-

dine dehydrogenase and thymidylate synthase gene expressions in primary tumors as predic-

tive parameters for the efficacy of fluoropyrimidine-based chemotherapy for metastatic colorec-

tal cancer. Clin Cancer Res 2003;9:786-791

178. Ichikawa W, Takahashi T, Suto K, Hirayama R. Gene expressions for thymidylate synthase (TS),

orotate phosphoribosyl transferase (OPRT), and thymidine phosphorylase (TP), not dihydropyri-

Chapter 2

50

dimine dehydrogenase (DPD), influence outcome of patients treated with S-1 for gastric cancer.

Proc Am Soc Clin Oncol 2004; abstract 4050

179. Smorenburg CH, Peters GJ, Van Groeningen CJ, Noordhuis P, Van Riel JM, Pinedo HM, et al. First

line tailored chemotherapy in advanced colorectal cancer with 5-fluorouracil/leucovorin or

oxaliplatin/irinotecan chosen by the expression of thymidylate synthase (TS) and dihydropyrim-

inde dehydrogenase (DPD). Proc Am Soc Clin Oncol 2004; abstract 3624

180. Leichman CG, Lyman GH, Remedios P, Leichman L, Litwin A, Loud P, et al. Molecular biologic corre-

lates with continuous infusion 5-FU (CIFU) or capecitabine (C) in disseminated colorectal cancer

(CRC). Proc Am Soc Clin Oncol 2002; abstract 1720

181. Johnston PG, Liang CM, Henry S, Chabner BA, Allegra CJ. Production and characterization of

monoclonal antibodies that localize human thymidylate synthase in the cytoplasm of human

cells and tissue. Cancer Res 1991;51:6668-6676

182. website: http://www.pharmacogenetics.org

Focus on fluorouracil

A simple and sensitive fully validated HPLC-UV method for the determination of 5-fluorouracil and its metabolite 5,6-dihydrofluorouracil in plasma

Jan Gerard Maring1, Leonie Schouten2, Ben Greijdanus3, Elisabeth G.E. de Vries4, Donald

R.A. Uges3


Hoogeveen; 2University Centre for Pharmacy, Groningen; Departments of 3Pharmacy and 4Medical Oncology, University Hospital Groningen, The Netherlands

Therapeutic Drug Monitoring, in press

Chapter 3

54

HPLC-UV analysis of 5-fluorouracil

55

Column of light. Nørre Lyngvig. Danmark 2002.

Chapter 3

54


55

Abstract

Aim The authors developed a simple and sensitive, fully validated HPLC-UV method for

the determination of both 5-FU and its metabolite DHFU in small volume plasma samples.

Methods The analytes were separated on a 4.6 X 250 mm I.D. Atlantis dC18 5 µm column,

with isocratic elution at room temperature. Chlorouracil was used as internal standard. The

analytes were detected with an UV diode array detector. DHFU was detected at 205 nm,

5-FU at 266 nm and chlorouracil at both wavelengths.

Results The limits of quantification in plasma were 0.040 µg /mL for 5-FU and 0.075 µg/

mL for DHFU. Linearity, accuracy, precision, recovery, dilution, freeze-thaw stability and

stability in the sample compartment were evaluated. The method appeared linear over a

range from 0.04-15.90 µg/mL for 5-FU, and from 0.075-3.84 µg/mL for DHFU.

Conclusions The method appeared very suitable for therapeutic drug monitoring and

pharmacokinetic studies of 5-FU, due to the simple extraction and the small sample

volume. Problems in earlier published methods with interfering peaks and variable

retention times were overcome. The method appeared also suitable for detection of uracil

and its metabolite dihydrouracil in plasma.

Introduction

5-Fluorouracil (5-FU) is a fluoropyrimidine anti-cancer agent that was introduced more

than 40 years ago [1]. It belongs to the class of antimetabolites and is still widely used in

the treatment of gastrointestinal-, breast- and head and neck cancer [2]. Before 5-FU can

exert its cytotoxic effects, intracellular metabolic activation is a prerequisite. The principal

cytotoxic metabolite of 5-FU is 5-fluoro-2’-deoxyuridine monophosphate (FdUMP), which

inhibits thymidylate synthase. This results in inhibition of DNA-synthesis due to depletion

of thymidine nucleotides [1,3]. The cytotoxicity, though, is caused by only a small part of

the 5-FU dose, since the majority of 5-FU is rapidly metabolized into inactive metabolites.

The initial and rate-limiting step in the catabolism of 5-FU is the reduction of 5-FU into

5,6-dihydrofluorouracil (DHFU) by the enzyme dihydropyrimidine dehydrogenase (DPD)

[1,3]. As a result, the pharmacokinetic profile of 5-FU displays rapid distribution and rapid

elimination [3,4]. Reported half-lifes range from 6 to 22 min [1,3,4-7]. This large variation

in 5-FU clearance is thought to be due to interindividual differences in DPD activity. Un-

fortunately, DPD activity is largely reduced in 1-2% of the Caucasian population due to a

mutation in the gene encoding DPD [8-11]. When these people are treated with 5-FU, they

risk extreme toxicity due to a largely reduced 5-FU clearance. Since 5-FU based chemo-

therapy is one of the cornerstones of colorectal cancer treatment, combined with the fact

that relatively high 5-FU dosages are applied in this cancer, extreme 5-FU toxicity due to

DPD deficiency most frequently is encountered in colorectal cancer patients.

Chapter 3

56


57

Today, DPD deficiency is recognized as a serious contraindication for 5-FU treatment, and

as a result, several methods so far have been evaluated for early detection of DPD deficien-

cy. DPD activity measured in peripheral blood mononuclear cells (PBMC-DPD) has been

proposed as screening tool to detect DPD deficiency, but the correlation between PBMC-

DPD activity and 5-FU clearance seems to be rather weak [10,12,13]. Alternatively, moni-

toring of the 5-FU/DHFU ratio in plasma might be a reliable predictor for 5-FU clearance,

although this requires the administration of at least one 5-FU dose and the availability

of a rapid screening method for 5-FU plasma levels to guarantee reporting on aberrant

pharmacokinetics before the second gift is administered [13-16].

Several methods for 5-FU and DHFU detection in plasma have been published [4,7,17-

21]. To date various HPLC methods with UV detection have been developed, but most of

these methods lack adequate sensitivity for pharmacokinetic studies or therapeutic drug

monitoring, since 5-FU plasma levels during 5-FU protracted infusion or after administra-

tion of oral 5-FU analogues are generally low [19,21]. Difficulties in the determination

of 5-FU and DHFU in plasma with HPLC-UV are mainly due to the hydrophilicity of the

analytes, causing variable retention on C18-columns, and due to the limited UV-absorp-

tion of DHFU. The HPLC method most suitable for drug level monitoring, published up to

now is, the method of Ackland et al., because of its low limits of quantification (LLQ) [17].

It requires, however, a relatively large sample volume and the method has some analytical

interference. Therefore we developed an analytical method for the simultaneous determi-

nation of 5-FU and DHFU in small volume plasma samples, with sufficiently low limits of

quantification for both substances.

Materials and methods

Chemicals

5-Fluoro 5,6-dihydrouracil (95%) was provided by Roche (Basel, Switzerland).

5-Fluorouracil and the internal standard 5-chlorouracil were obtained from Sigma

(Zwijndrecht, The Netherlands). Methanol (HPLC grade), ethylacetate and acetonitrile

(HPLC grade) were purchased from Merck (Darmstadt, Germany). Ultra pure water was

used in all preparations (Milli-Q water purification system, Millipore Benelux; Etten-Leur,

The Netherlands). All other chemicals were of analytical grade. Human EDTA-plasma for

standard and control samples was provided by the Red Cross Bloodbank (Groningen, The

Netherlands).

Chromatographic equipment

Analysis of 5-FU and DHFU was performed on a HPLC-system consisting of a Merck Hitachi

L-7110 isocratic pump (Merck, Darmstadt, Germany), a Merck Hitachi L-7200 autosampler

and a Merck Hitachi L-7450 UV PDA detector. Integration was performed by Merck Hitachi

Chapter 3

56


57

Model D7000 HPLC System Manager version 3.1.1 (1994-1999). The system and column

operated at room temperature (19-22 oC). The separations were performed on a Atlantis

dC18 (4,6 x 250 mm I.D.) 5 µm column (Waters, Etten-Luer, The Netherlands), equipped

with a Phenomenex C18 (5 µm, 4,0 x 3.0 mm) SecurityGuard guard column (Bester, Am-

stelveen, The Netherlands). The mobile phase consisted of 990 mL 1.5 mM phosphate

buffer (pH 5.8) mixed with 10 mL methanol. The flow during the analysis was 0.8 mL/min.

Spectra were acquired in the 200-300 nm range up to 23 min after injection. The time

between the injections was 22 min, to allow the elution of strongly retained endogenous

compounds. The injection volume was 50 µL.

Preparation of the plasma standards and controls

For each compound, except chlorouracil (internal standard), two independent stock

solutions were prepared in water. One was used for the preparation of the calibration

samples, the second for the preparation of the validation samples.

The 5-FU stock solution contained 100 µg/mL, the DHFU stock solution 25 µg/mL. The

concentration of the chlorouracil internal standard stock solution was 200 µg/mL. An

internal standard working solution (2 µg/mL) was freshly prepared on the day of analysis

by diluting the stock solution 100 times with water. Calibration samples were prepared by

adding the required amount of stock solution to human plasma to obtain concentrations

of 0.04; 0.08; 0.20; 0.32; 0.40; 0.80; 1.60; 4.80 and 15.90 µg/mL 5-FU, and concentrations of

0.08; 0.10; 0.20; 0.40; 0.80; 1.00; 1.20; 2.00 and 3.84 µg/mL DHFU. Calibration samples of 5-

FU and DHFU were combined.

Validation samples were prepared at low, medium and high concentration levels and

contained at low level 0.092 µg/mL 5-FU plus 0.132 µg/mL DHFU, at medium level 0.80

µg/mL 5-FU plus 0.48 µg/mL DHFU, and at high level 4.00 µg/mL 5-FU plus 0.96 µg/mL

DHFU. All standards, controls and stock solutions were stored at –20 oC until use.

Sample preparation

An aliquot of 200 µl plasma sample was mixed with 50 µl internal standard working

solution in an Eppendorf microfuge tube. Subsequently, 150 µl acetonitril was added,

followed by vortex mixing for 10 s. The samples were centrifuged at 11,000 g for 5 min at

room temperature. The supernatant was transferred into a glass centrifuge tube and 7 mL

of ethylacetate was added. The samples were extracted during 15 min in a rotary mixer.

Subsequently, the samples were centrifuged at 3,000 g for 5 min. The organic upper layer

was transferred into a conical tube and evaporated to dryness under a gentle stream of

nitrogen at ambient temperature. The samples were reconstituted in 100 µL mobile phase

and transferred into a glass insert for auto-sampler vials. A 50 µL aliquot was injected into

the HPLC.

Chapter 3

58


59

5-FU pharmacokinetics

A plasma sample was obtained from a colorectal cancer patient who was evaluated for

DPD deficiency. The patient had experienced more than expected toxicity during the first

cycle of a 5-day 5-FU/LV Mayo Clinics schedule. The clearance of 5-FU was evaluated on

the first day of the second cycle. A single blood sample was collected at t=60 min after a

5 min intravenous infusion of 380 mg/m2 5-FU (80% from normal 425 mg/m2 dose). The

samples were placed on ice immediately after collection. Analysis of the plasma sample

was performed on the same day.

Validation procedure

The method was validated on linearity, accuracy, recovery, freeze-thaw stability, sample

compartment stability and sample dilution. On day one, the linearity of the calibration

curves and the stability in the sample compartment were determined. On the days two

to six, precision and accuracy, recovery, freeze/thaw stability and dilution of samples were

tested. During validation, six blank samples obtained from six different human volunteers

were tested to demonstrate that there were no interfering components. The results of the

tests were evaluated against international used acceptance criteria described by Shah et

al [22].

Linearity, Accuracy, and Recovery

To evaluate linearity of the calibration curves three calibration curves were prepared and

analyzed. The curves were judged linear if the correlation coefficient r was better than 0.99

as calculated by weighted linear regression. The goodness of fit and the lack of fit were

determined by ANOVA calculations.

To assess the accuracy and precision of the method, the samples LLQ, low, medium and

high were analyzed three times a day, during five days.

To determine the accuracy, the average bias was calculated. The Relative Standard

Deviation (RSD%) was estimated by ANOVA, and used to determine the within-run and

between-run precision. Relative standard deviations and biases of less then 15% were

accepted, except for the LLQ. For the LLQ relative standard deviations and biases of less

than 20% were accepted.

Accuracy was calculated from the mean of the amount observed and the theoretical con-

centrations at a particular level. The method was considered accurate when the deviation

from the theoretical concentration (bias) was less than 20 % at the LLQ level and less than

15 % at the remaining levels [22].

The recoveries were determined by comparing the peak heights of the validation samples

low, medium and high with the peak heights of analyzed solutions containing all the

compounds of interest at a concentration corresponding with 100 % recovery.

Chapter 3

58


59

Freezing and Thawing

To assess freezing and thawing stability samples with a low concentration and samples

with a high concentration were prepared. The same sample was frozen and thawed each

day for five days. After each freeze/thaw cycle the samples were analyzed in triplicate. Bias

was calculated in the same way as with precision and accuracy. Samples were considered

stable if bias was below 10 % after five freeze/thaw cycles.

Dilution

Because some samples of clinical patients can have concentrations above the higher

limit of quantification (HLQ), these samples have to be diluted to obtain concentrations

within the calibration range. The effect of sample dilution was tested with plasma control

samples spiked with 20.00 µg/mL 5-FU plus 4.80 µg/mL DHFU. These samples were diluted

5 times in triplicate on 5 different days. Blank human plasma was used as diluting agent.

A bias of less then 10% between the measured undiluted concentration and nominal

undiluted concentration was accepted.

Stability during storage in sample compartment

Stability during storage in sample compartment was determined by analyzing samples

with low and high concentration over a period of 30 h. The calculated response at t = 30

h was compared to the calculated response at t = 0 h. Samples were judged stable over a

period of 30 h if the decrease in response was less than 10 %.

Results

Retention times

The retention time of DHFU was approximately 8.2 min. 5-FU and chlorouracil eluted at

approximately 10.1 and 19.9 min respectively. Interfering peaks were found in none of six

different blank plasma samples, except for a small peak at approximately 19.8 min, close

to the peak of the internal standard. Since this small matrix peak turned out to be always

at least 30 times smaller than the internal standard peak, it was considered negligible.

One other matrix peak could potentially interfere with the DHFU peak (see figure 1 in

lower chromatogram at approximately 7.3 min), but this problem was easily overcome

as only the retention time of this interfering substance and not that of DHFU appeared

dependent on the pH of the mobile phase. The pH can at least vary from 5.7 through 6.3,

without affecting the retention times of the peaks of interest. Interference from strongly

retained matrix components in subsequent chromatograms was prevented by introduc-

tion of a 22 min delay after each injection. We recommend to flush the column with 50%

methanol in water for 30 minutes every 3 series of samples, as the column may retain

matrix components.

Chapter 3

60


61

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

�

��

�

��

�

��

��

��

��

�

Figure 1 Representative chromatograms of patient plasma sample at t=60 min after the start of a 5 min infusion of 380 mg/m2 5-FU. The upper chromatogram was recorded at 266 nm, the lower at 205 nm. The retention time of DHFU was 8.11 min, the retention time of 5-FU 10.21 min and chlorouracil (internal standard) eluted at 20.17 min.

Chapter 3

60


61

Linearity, Accuracy and Recovery

The correlation coefficient of the calibration curves was always better than 0.99 for both

components . All curves showed no significant lack of fit and for all calibration curves

the Goodness of Fit was significant. Table 1 lists the with-in and between-run relative

standard deviations and the biases of 5-FU and DHFU. All results were within validation

limits. The mean recoveries of 5-FU at low, medium and high concentrations were 75.3%,

77.6% and 81.1% respectively (n=15). For DHFU the values were 65.5%, 68.3% and 70.5%.

For chlorouracil a recovery of 74.2% was found.

Dilution

Bias was below 10% for both 5-FU and DHFU. Detailed results are listed in table 2.

Table 1 Accuracy and within-run and between-run precision of 5-FU and DHFU in plasma in different concentrations (n=15).

Nominal concen-

tration (µg/mL)

Measured concen-

tration (µg/mL)

Mean bias (%) Within-run

RSD (%)

Between-run

RSD (%)

5-FU 0.040 0.043 +6.3 3.7 3.5

0.092 0.099 +7.9 2.9 4.3

0.802 0.831 +3.7 2.7 7.7

4.090 4.260 +4.2 0.8 1.0

DHFU 0.075 0.087 +15.6 3.2 2.4

0.132 0.134 +1.5 2.2 2.5

0.480 0.478 –0.3 3.4 6.7

0.959 0.967 +0.8 1.2 2.5

Table 2 Biases for the dilution test

Analyte Nominal undiluted

concentration

(µg/mL)

Measured concen-

tration (µg/mL)

Bias

(%)

Within-run

RSD (%)

Between-run

RSD (%)

n

5-FU 20.00 20.80 +4 2.3 4.4 15

DHFU 4.80 4.63 –4 3.6 4.4 15

Chapter 3

62


63

Freeze-thaw stability

Figure 2 depicts the results of the freeze-thaw stability test. The biases for 5-FU were less

than 10% during all cycles at both concentration levels. For DHFU, at the 0.142 µg/mL con-

centration level, the bias exceeded 10% after four freeze-thaw cycles. At the 0.921 µg/mL

level, bias overstepped 10 % after three freeze-thaw cycles. This implicates that DHFU is

only stable for two freeze-thaw cycles.

Stability in the sample compartment.

For 5-FU, in low concentration (0.092 µg/mL), the peak height ratio is stable during 20

hours, but at 30 hours this ratio dropped 31.2%. At 8.19 µg/mL 5-FU the peak height ratio

increased linearly 2.3% during 30 hours. For DHFU a linear decrease in peak height ratio

was observed at both concentration levels. After 30 hours, the decrease was 11.6% at the

0.132 µg/mL level, and 2.7% at 1.92 µg /mL.

Human plasma samples

Figure 1 depicts the chromatograms of a plasma sample at t = 60 min after an intravenous

dose of 380 mg/m2 5-FU. The calculated amounts were 0.45 µg/mL for 5-FU and 3.43 µg/

mL for DHFU. These values are within the normal range. The patient was not considered

DPD deficient.

Figure 2 Freeze-thaw characteristics of 5-FU and DHFU during 5 cycles. The 5-FU concentrations at the start of the experiment at low (0.097 µg/mL) and high (4.07 µg/mL) concentration levels were not affected after 5 freeze-thaw cycles. However, the DHFU concentrations at both low (0.142 µg/mL) and high (0.921 µg/mL) concentration levels were largely decreased by freeze-thawing.

��

��

��

��

�

��

� � � � �

��

��

��

��

��

��

��

Chapter 3

62


63

Discussion

In this paper, we present a fully validated, relatively simple method for sensitive detection

of 5-FU and its metabolite DHFU in small volume plasma samples.

The assay procedure was based on a method previously described by Ackland et al. for

extraction of 5-FU and DHFU from 1 mL plasma samples [17]. We wished to improve this

method with regard to extraction procedure and sample size. We discovered that the pH

of the aqueous layer can vary freely between 2 and 8 without affecting the extraction ef-

ficiency. Therefore pH stabilization with an extraction buffer was considered unnecessary.

We managed to simplify the extraction procedure by using acetonitril in stead of trichlo-

roacetic acid 50% for protein denaturation. That disposed of the need for a neutralization

step and, as a result, kept the volume of aqueous phase relatively small, around 350 µL.

In the Ackland method, the aqueous phase comprises about 2 mL after acid neutraliza-

tion with sodium acetate. Because of this relatively large volume of aqueous layer, they

needed to perform a double extraction procedure with twice 5 ml ethylacetate to obtain

recoveries above 70%. The 7 mL ethylacetate used in our procedure is 20-fold in excess

of aqueous material and this resulted in recoveries above 75% in a single extraction step.

Evidently, the ratio of the volumes of aqueous and ethylacetate layers during extraction

appears to be a determinant factor with large impact on the recovery. This is confirmed

by data of Loos et.al. who applied an ethylacetate : aqueous layer ratio above 25 in their

assay for 5-FU and thus gained recoveries of about 90% [23]. They could, however, omit

a deproteinization step, as the dihydrofluorouracil metabolite was not included in their

assay. Due to a deproteinization step, our aqueous layer is somewhat larger. We decided

not to increase the amount of ethylacetate above 7 mL, in order to maintain the extraction

as single-step procedure. Our validation results show that a recovery of about 70% is large

enough to obtain accurate and precise results.

5-FU turned out to be stable for at least five freeze-thaw cycles. DHFU however appeared

stable for only 2 freeze-thaw cycles. Previous reports confirm the observed instability of

DHFU in plasma at room temperature [24]. Therefore, it has been recommended to place

blood samples on ice and to centrifuge blood shortly after collection. If reanalysis of a

plasma sample is needed, it has been proposed to use only once-thawed samples. The

observed freeze-thaw instability has also implications for the conditions during transport:

it is important to transport plasma samples on dry ice, to prevent thawing.

The instability of DHFU also has consequences for the storage of samples in the autosam-

pler compartment. At low concentrations 5-FU and DHFU appeared stable for no longer

than 20 hours at ambient temperature. This implicates that sample runs may not last

longer than 20 hours. Moreover, samples expected to have a low concentration of 5-FU or

DHFU should be placed more forwards in the autosampler compartment. Cooling of the

autosampler compartment is recommended if available on the equipment. The cause of

the non-linear decrease of the 5-FU concentration that we observed during storage in the

Chapter 3

64


65

autosampler is unknown. It could be the result of auto-inducible deterioration or adsorp-

tion to the wall of the vials, but we couldn’t prove these hypotheses.

Our method so far has been applied to clinical research samples and therapeutic drug

monitoring of 5-FU in colorectal cancer patients. A very common colorectal cancer

treatment implies the administration of a bolus dose of 425 mg/m2 5-FU plus 20 mg/m2

folinic acid on 5 consecutive days (total 5-FU dose 2125 mg/m2) in a 28 day cycle (Mayo

Clinic schedule). A large proportion of all colorectal cancer patients is treated this way, at

least in most Anglo-Saxon countries . From previous work we learned that the 5-FU plasma

concentration 5 min after a 5-FU bolus dose of 425 mg/m2 can range from 30 to 60 µg/mL

[25]. With linearity demonstrated up to 15.9 µg/mL and five times dilution possible these

concentrations are covered with the current method. The peak plasma concentration of

DHFU after the same dose of 5-FU normally ranges from 2-6 µg/mL [25]. This concentra-

tion range is also covered by our method with linearity of DHFU demonstrated up to

3.84 µg/mL. The low LLQ values (0.04 µg/mL for 5-FU and 0.075 µg/mL for DHFU) make

it even possible to measure plasma levels during 9-10 half-lifes after 5-FU administration.

As the plasma half-life of 5-FU is about 10 min, blood levels can be monitored until 90-

100 min after administration of a typical 5-FU dose of 425 mg/m2, which is convenient for

most research purposes. Moreover, the current method also appeared very suitable for

therapeutic drug monitoring of 5-FU. In an earlier study in 33 clinical patients, we showed

that the 5-FU plasma levels at t=1 h after an intravenous bolus dose of 425 mg/m2 5-FU

ranges from 0.1 – 2.5 µg/mL (mean value 0.6 µg/ml) [25]. The upper level of 2.5 µg /ml

corresponds with the mean + 3SD value. Thus, in 99% of all individuals with normal DPD

activity, 5-FU levels below this value can be expected. Based on these calculations we

consider levels above 2.5 µg/mL at t=1 h after a standard 425 mg/m2 5-FU bolus dose as

atypical and suspect DPD deficiency in such patients. Previously we have shown that in a

patient with heterozygosity for a IVS14+1G→A splice site mutation in the DPD encoding

gene, the 5-FU level at t=1 h was 10.0 µg/mL, which is indeed higher than our proposed

cut-off level of 2.5 µg/mL [11]. This particular patient suffered from extreme toxicity after

a normal 5-FU treatment.

We acknowledge that the major drawback of our approach is the fact that it implies a ret-

rospective evaluation of DPD activity status. Unfortunately, good alternatives are lacking

at this moment.

Mattison et al. developed a simple, however expensive, uracil breath test for DPD pheno-

typing, based on the release of 13CO2 from 2-13C uracil in the presence of intact DPD [26].

Expired air was collected 5-90 min after oral ingestion of 6 mg/kg 2-13C uracil. Partially

deficient DPD breath profiles were well differentiated from normal profiles. An oral

challenge with uracil, prior to chemotherapy, with subsequent measurement of the uracil

clearance in plasma, might be an alternative approach for DPD phenotyping. Therefore,

we are currently testing the applicability of our method for uracil detection. More research

Chapter 3

64


65

is needed to explore, optimize and validate this approach.

The current method has further proven its suitability and stability in a phase II pharma-

cokinetic study of a new investigational cytotoxic agent tested in combination with 5-FU

and folinic acid.

Chapter 3

66


67

References

1. Grem JL. 5-Fluorouracil: forty-plus and still ticking. A review of its preclinical and clinical develop-

ment. Invest New Drugs 2000;18:299-313.

2. Lokich J. Infusional 5-FU: Historical evolution, rationale, end clinical experience. Oncology

1998;12:19-22.

3. Pinedo HM, Peters GFJ. Fluorouracil: Biochemistry and Pharmacology. J Clin Oncol 1988;6:1653-

1664.

4. Heggie GD, Sommadossi JP, Cross DS, et al. Clinical pharmacokinetics of 5-fluorouracil and its

main metabolites in plasma, urine and bile. Cancer Res 1987;47:2203-2206.

5. Young AM, Daryanani S, Kerr DJ. Can pharmacokinetic monitoring improve clinical use of fluoro-

uracil. Clin Pharmacokinet 1999;36:391-398.

6. Lennard L. Therapeutic drug monitoring of antimetabolic cytotoxic drugs. Br J Clin Pharmacol

1999;47:131-143.

7. Bocci G, Danesi R, Di Paolo A, et al. Comparative pharmacokinetic analysis of 5-Fluorouracil and its

major metabolite 5-fluoro-5,6-dihydrouracil after conventional and reduced test dose in cancer

patients. Clin Cancer Res 2000;6:3032-3037.

8. Van Kuilenburg AB, Haasjes J, Richel DJ, et al. Clinical implications of dihydropyrimidine dehydro-

genase (DPD) deficiency in patients with severe 5-fluorouracil-associated toxicity: identification

of new mutations in the DPD gene. Clin Cancer Res 2000;6:4705-12

9. Collie-Duguid ES, Etienne MC, Milano G, et al. Known variant DPYD alleles do not explain DPD

deficiency in cancer patients. Pharmacogenetics 2000;10:217-23

10. Milano G, Etienne MC. Individualizing therapy with 5-fluorouracil related to dihydropyrimidine

dehydrogenase: theory and limits. Ther Drug Monit 1996;18:335-340.

11. Maring JG, van Kuilenburg AB, Haasjes J, et al. Recuced 5-FU clearance in a patient with low DPD

activity due to heterozygosity for a mutant allele of the DPYD gene. Br J Cancer 2002;86:1028-

33

12. Fleming A, Milano G, Thyss A, et al. Correlation between dihydropyrimidine dehydrogenase ac-

tivity in peripheral mononuclear cells and systemic clearance of fluorouracil in cancer patients.

Cancer Res 1992;52:2899-2902.

13. Di Paolo A, Danesi R, Falcone A, et al. Relationship between 5-fluorouracil disposition, toxicity and

dihydropyrimidine dehydrogenase activity in cancer patients. Ann Oncol 2001;12:1301-1306.

14. Di Paolo A, Ibrahim T, Danesi R, et al. Relationship between plasma concentrations of 5-fluoroura-

cil and 5-fluoro-5,6-dihydrouracil and toxicity of 5-fluorouracil infusions in cancer patients. Ther

Drug Monit 2002;24: 588-593.

15. Santini J, Milano G, Thyss A, et al. 5-FU therapeutic monitoring with dose adjustment leads to an

inproved therapeutic index in head and neck cancer. Br J Cancer 1989;59:287-290.

16. Milano G, Etienne MC, Renee N, et al. Relationship between fluorouracil systemic exposure and

tumor response and patient survival. J Clin Oncol 1994;12:1291-1295.

17. Ackland SP, Garg MB, Dunstan RH. Simultaneous determination of DHFU and 5-fluorouracil in

Chapter 3

66


67

plasma by high-performance liquid chromatography. Anal Biochem 1997;246:79-85.

18. Déporte-Féty A, Picot M, Amiand M, et al. High-performance liquid chromatography assay with

ultraviolet detection for quantification of dihydrofluorouracil in human lymphocytes: applica-

tion to measurment of dihydropyrimidine dehydrogenase activity. J Chromatogr B 2001;762:

203-209.

19. Del Nozal MJ, Bernal JL, Pampliega A, et al. Determination of the concentrations of 5-fluorouracil

and its metabolites in rabbit plasma and tissues by high-performance liquid chromatography. J

Chromatogr B 1994;656:397-405.

20. De Bruijn EA, Driessen O, van den Bosch N, et al. A gas chromatographic assay for the determina-

tion of 5,6-dihydrofluorouracil and 5-fluorouracil in human plasma. J Chromatogr B 1983;278:

283-289.

21. Casale F, Canaparo R, Muntoni E, et al. Simultaneous HPLC determination of 5-fluorouracil and its

metabolites in plasma of cancer patients. Biomed Chromatogr 2002;16:446-452.

22. Shah VP, Midha KK, Dighe S, et al. Analytical methods validation: bioavailability, bioequivalence,

and pharmacokinetic studies. J Pharm Sci 1992;81:309-312.

23. Loos WJ, de Bruijn P, van Zuylen L, et al. Determination of 5-fluorouracil in microvolumes of hu-

man plasma by solvent extraction and high-performance liquid chromatography. J Chromatogr

B Biomed Sci Appl. 1999;735:293-297.

24. Van den Bosch N, Driessen O, Van der Velde EA, et al. The stability of 5,6-dihydrofluorouracil in

plasma and the consequences for its analysis. Ther Drug Mon 1987;9:443-447

25. Maring JG, Piersma H, Van Dalen A, et al. Extensive hepatic replacement due to liver metastases

has no effect on 5-fluorouracil pharmacokinetics. Cancer Chemother Pharmacol 2003;51:167-

173

26. Mattison LK, Ezzeldin H, Carpenter M, et al. Rapid identification of dihydropyrimidine dehydroge-

nase deficiency by using a novel 2-13C-uracil breath test. Clin Cancer Res 2004;10:2652-2658

Extensive hepatic replacement due to liver metastases has no effect on 5-fluorouracil pharmacokinetics

Jan Gerard Maring1, Henk Piersma2, Albert van Dalen3, Harry J.M. Groen4, Donald R.A.

Uges5, Elisabeth G.E. De Vries6


Hoogeveen; 2Department of Internal Medicine, Martini Hospital Groningen; 3Department of Radiology, Diaconessen Hospital Meppel; Departments of 4Pulmonary

Diseases, 5Pharmacy and 6Medical Oncology, University Hospital Groningen, The Nether-

lands

Cancer Chemother Pharmacol 2003;51:167-173

Chapter 4.1

70

Influence of liver metastases on 5-fluorouracil pharmacokinetics

71

Erosion at work. Zabriskie point. Death Valley USA 1995.

Chapter 4.1

70


71

Abstract

Aim The influence of liver metastases on the pharmacokinetics of 5-fluorouracil (5-FU)

and its metabolite 5,6-dihydrofluorouracil (DHFU) was studied in patients with liver me-

tastases from gastrointestinal cancer and compared with a control group of patients with

non-metastatic gastrointestinal cancer.

Methods Patients were assigned to two different groups based on the presence of liver

metastases. The percentage of hepatic replacement was determined with CT and ultra-

sonography and classified as <25 %, 25-50 or > 50% from the total liver volume. Chemo-

therapy consisted of leucovorin 20 mg/m2/day plus 5-FU 425 mg/m2/day, both during 5

days. Blood sampling was carried out on the first day of the first chemotherapy cycle. 5-FU

and DHFU were quantified by HPLC in plasma. A four compartment parent drug - metabo-

lite model with non-linear Michaelis-Menten elimination from the central compartment

of the parent drug (5-FU) was applied to describe 5-FU and DHFU pharmacokinetics.

Results No effect of liver metastases on 5-FU clearance was observed between the two

groups. The effect of 18 covariables on pharmacokinetic parameters was also studied in

univariate correlation analyses. Body surface area was positively correlated with the dis-

tribution volume of 5-FU in the central compartment and with Vmax

(r = 0.65 and r = 0.54

respectively).

Conclusions There is no need for dose adjustment of 5-FU as standard procedure in

patients with liver metastases and mild to moderate elevations in liver function tests.

Introduction

Fluorouracil (5-FU) is widely used in chemotherapeutic regimens for the treatment

of breast-, colorectal- and head and neck cancer. The cytotoxic mechanism of 5-FU is

complex, requiring intracellular bioconversion of 5-FU into cytotoxic nucleotides. Inhibi-

tion of thymidylate synthase by the metabolite 5-fluoro-2’-deoxyuridine-5’-monophos-

phate (FdUMP) is thought to be the main mechanism of cytotoxicity [1]. The cytotoxicity

is caused by only a small part of the administered 5-FU dose, as the majority of 5-FU is

rapidly metabolised into inactive metabolites (see figure 1). The initial and rate-limiting

enzyme in the catabolism of 5-FU is dihydropyrimidine dehydrogenase (DPD), catalysing

a reduction of 5-FU into 5,6-dihydrofluorouracil (DHFU). Subsequently DHFU is degraded

into fluoro-β-ureidopropionic acid (FUPA) and fluoro-β-alanine (FBAL) [2]. Several groups

have suggested a major role of DPD in the regulation of 5-FU metabolism and thus in the

amount of 5-FU available for cytotoxicity [3-7]. DPD is present in many tissues, but the

highest activity is found in the liver and, since liver blood flow is relatively high, this organ

is considered as major site for 5-FU degradation [2,8]. In the last decades the role of liver

metastases and liver function impairment on 5-FU pharmacokinetics has been subject to

Chapter 4.1

72


73

debate.

The effects of liver dysfunction on the pharmacokinetics of drugs are generally difficult to

predict. Liver dysfunction is usually diagnosed on the basis of liver function tests, but for

most drugs the correlation between test values and drug metabolism is only weak. Liver

dysfunction due to liver metastases is an even more complicated issue. Liver metastases

displace healthy liver tissue and this may directly affect the liver metabolic capacity due

to tissue loss, but also indirectly due to tissue damage caused by cholestasis as a result of

compression of surrounding structures including bileducts. Furthermore, liver dysfunc-

tion may affect plasma volume, serum albumin, drug protein binding, and hepatic blood

flow, all of which can influence pharmacokinetic parameters in complex ways.

In the last decade, several groups have studied the effects of liver metastases on 5-FU

clearance, in particular during continuous infusion. In an early small study, a reduction of

clearance of continuously infused 5-FU was reported in four patients with gastrointesti-

nal carcinoma and hepatic metastases [9]. Contrary to this, others found no correlation

between drug clearance and hepatic function tests in a larger study with 187 patients

��

��

��

��

��

��

��

Figure 1 Metabolism of 5-FU. 5-Fluoro-2’-deoxyuridine-5’-monophosphate (FdUMP) is the cytotoxic product resulting from a multi-step 5-FU activation route . FdUMP inhibits the enzyme thymidylate synthase (TS), which leads to intracellular accumulation of deoxy-uridine-monophospate (dUMP) and depletion of deoxy-thymidine-monophospate (dTMP). This causes arrest of DNA synthesis. The initial and rate-limiting enzyme in the catabolism of 5-FU is dihydropyrimidine dehydrogenase (DPD), catalys-ing the reduction of 5-FU into 5,6-dihydrofluorouracil (DHFU). Subsequently, DHFU is degraded into fluoro-β-ureidopropionic acid (FUPA) and fluoro-β-alanine (FBAL).

Chapter 4.1

72


73

receiving 5-FU as continuous infusion [10]. More recently, Etienne et al. studied several co-

variables affecting 5-FU clearance during continuous infusion in 104 patients with various

cancers [11]. They found no effect of liver metastases in a subgroup of seven patients,

but did not further specify the involvement of concurrent liver dysfunction. Although

these studies suggest that liver metastases do not affect 5-FU clearance during continu-

ous infusion, it is important to realise that the pharmacokinetic behaviour of 5-FU after

bolus injection or short time infusion differs from that during continuous infusion. After

rapid infusion, 5-FU displays non-linear pharmacokinetic behaviour [12-15], probably due

to saturation of the DPD enzyme at higher plasma levels, although the exact mechanism

is still unclear [16]. Thus, data on 5-FU clearance obtained during continuous infusion do

not necessarily predict the situation after bolus injection. So far, however, only few reports

have been published regarding the effects of liver metastases and/or liver dysfunction on

the pharmacokinetics of bolus injected 5-FU [12,17,18].

Christophidis et al. studied the bioavailability of 5-FU after oral and intravenous drug ad-

ministration in 12 patients with liver metastases, and concluded that the bioavailability

was not related to liver function test abnormalities or metastatic deposits [12]. Nowa-

kowska-Dulawa also found no effect of liver metastases on 5-FU clearance in 20 patients

with colorectal cancer (compared to 8 controls) [17]. Unfortunately, in both studies patient

characteristics and liver function test results were not further specified. More recently,

Terret et al. studied the dose and time dependencies of 5-FU pharmacokinetics in 21

patients and also included some liver function parameters in their analysis [18]. Their data

suggest that 5-FU clearance might increase with the volume of hepatic replacement.

Since in most studies information regarding the extent of liver metastatic involvement is

concise or lacking, we decided to design a protocol to study the effects of this parameter

on the pharmacokinetics of 5-FU and DHFU after bolus injection. This study should provide

more insight in potential interactions between liver function and 5-FU pharmacokinetics.

Patients and Methods

Patients

Patients, aged 18 years and older, scheduled to receive adjuvant or palliative 5-FU treatment

for gastrointestinal cancer, and formerly chemotherapy naive, were included. Patients with

anaemia (Hb < 6 mmol/l), known disorders of hemostasis (e.g. haemophilia), severe renal

failure (GFR < 30 ml/min) or a history of alcohol or drug abuse were excluded. Patients

were assigned to two different groups based on the presence of liver metastases, that were

identified and measured with ultrasound and/or CT imaging. Other pre-treatment meas-

urements were body weight, height, blood cell counts, standard liver function tests (ALT,

AST, LDH, ALP, bilirubin) and markers for the liver synthesis function (pseudocholineste-

rase, albumin and antithrombin-III). Chemotherapy consisted of leucovorin 20 mg/m2/day,

Chapter 4.1

74


75

administered as short time infusion, followed by 5-FU 425 mg/m2/day, administered as

bolus intravenous injection during 2 min. Both drugs were given on 5 consecutive days,

in a 28-day cycle (Mayo regimen). On the day of blood sampling, leucovorin was infused

after the last sample. On the following 4 days, the same 5-FU dose was administered as

short time infusion (10-15 min), after the administration of leucovorin. During the first

chemotherapy cycle, toxicity was scored according to the Common Toxicity Criteria. The

study was approved by the Institutional Medical Ethics Review Board in the participating

hospitals and written informed consent was obtained from all patients.

Quantification of liver metastatic involvement

The diameter of the metastases was measured with standard CT and ultrasound imaging

software. From each lesion the maximum diameter was measured. This diameter was

used to calculate the volume of the metastatic lesions in relation to the total liver volume.

Four levels were defined for semi-quantification of the extent of liver metastatic disease,

according to Hunt et al. [19]. Absence of liver metastases was classified as level 0 (control

group), less than 25 % liver metastatic involvement as level 1, 25-50 % as level 2, and more

than 50% as level 3.

Collection of blood samples

For pharmacokinetic sampling, a canule was placed intravenously in the arm of the

patient contralateral to the side of drug administration. Blood samples of 5 ml were

collected in heparinised tubes just before, and 2, 5, 10, 20, 30, 45, 60, 80, 100, 120, 150 and

180 min after 5-FU injection. Collected samples were immediately placed on ice and sub-

sequently centrifuged at 2,500 g for 10 min at 4°C and stored at –80 °C till analysis. The

plasma samples were analysed for 5-FU and DHFU concentrations by high-performance

liquid chromatography (HPLC).

Chemicals

5-FU and chlorouracil were obtained from Sigma Chemical Co (Zwijndrecht, the

Netherlands). 5,6-dihydro-5-fluorouracil was kindly provided by Roche Laboratories

(Basel, Switzerland). Human heparinised plasma was obtained from the Red Cross Blood

Bank (Groningen, the Netherlands). All other chemicals were of analytical grade.

Reversed phase HPLC analysis

5-FU and DHFU concentrations were measured by HPLC analysis using a modification of

the method described by Ackland et al. [20]. Briefly, 100 µl chlorouracil internal standard

solution (80 mg/l in water) was added to 1 ml plasma sample, and this mixture was

vortexed and subsequently deproteinated with 50 µl of a 50% (w/v) trichloracetic acid

solution. After centrifugation at 8,000 g for 2 min the supernatant was transferred into a

20 ml centrifuge tube and neutralised with 1 ml 1 M sodium acetate solution. Then 5 ml

Chapter 4.1

74


75

ethylacetate was added and the mixture was vortexed during 10 min. After separation of

the organic and aqueous layers by centrifugation at 5,000 g for 5 min, the ethylacetate

layer was transferred into a 10 ml tube and evaporated under a stream of nitrogen at 25 °C.

The residue was dissolved in 100 µl ultrapure water and 20 µl was injected. 5-FU and DHFU

standards ranging from 0.5 to 20 mg/l were prepared in human plasma. The chromato-

graphic system consisted of a Waters 616 pump equipped with a Waters 717+ autosam-

pler. The separation of 5-FU and DHFU was accomplished by gradient elution at ambient

temperature on a Phenomenex Prodigy ODS 3 column (I.D. 250 x 4.6 mm, 5µm) equipped

with a guard column (30 x 4.6 mm) of the same material (both purchased from Bester,

Amstelveen, The Netherlands). Mobile phase A consisted of 1.5 mM K3PO

4 and 1% (v/v)

methanol in water (pH=6.0) and mobile phase B of 1.5 mM K3PO

4 and 5% (v/v) methanol

in water (pH=6.0). The gradient was programmed as follows: 100% A during 2 min; 100%

A → 100% B in 0.5 min; 100% B during 7 min; 100% B → 100% A in 0.5 min; 100% A during

10 min. Drug detection was performed using a Waters 996 Photo Diode Array UV detector

interfaced with a Millenium 2010 Chromatography Manager Workstation. Spectra were

acquired in the 201-300 nm range. 5-FU was monitored at 266 nm and DHFU at 205 nm.

The internal standard chlorouracil was monitored at both wavelengths. The limit of quan-

tification in plasma was 0.1 mg/l for both 5-FU and DHFU.

Pharmacokinetic analysis

The pharmacokinetic analyses were performed in the ADAPT II Maximum Likelihood

Parameter Estimation program (version 4.0; University of Southern California, Los Angeles,

Ca). The pharmacokinetic data of the first 15 patients were tested in 8 different parent drug-

metabolite pharmacokinetic models, characterised by linear or non-linear (Michaelis-Menten)

parent drug (5-FU) elimination from a central compartment and distribution of 5-FU and me-

tabolite (DHFU) over one or two compartments. Variance for the observations was assumed to

be proportional to the measured values and set at 10%. In each model the patient’s data were

fitted individually and for each data set the Akaike Information Criterion (AIC) was calculated

[21]. The model with the lowest summarised AIC value was selected as the better one. The

area under the curve (AUC 0→3h

) of 5-FU and DHFU was calculated using the trapezoidal

rule. The total clearance of 5-FU was calculated by dividing the administered dose by the

AUC.

Statistical analysis

Patient data were analysed as two groups, based on the presence of liver metastases.

Clinical chemistry and pharmacokinetic data in both groups were compared with a two

sided Student’s t-test. In case of unequal variances as indicated by the Kolmogorov-

Smirnov test, the log transformed data were used, or data were tested with the non-para-

metric Mann-Whitney U-test. The study was powered (>80%) to detect a 25% difference in

population means, assuming a standard deviation in pharmacokinetic parameters of 35%.

Chapter 4.1

76


77

Correlations between clinical chemistry, demographic and pharmacokinetic data were

tested by Spearman correlation analysis. Statistical significance was at p<0.05. Analyses

were performed with the SYSTAT 7.0 statistical program (SPSS inc. 1997).

Results

Patients

Patients in this study were treated in the Martini Hospital Groningen, the Bethesda

Hospital Hoogeveen or the Diaconessen Hospital Meppel. Between December 1997 and

January 2001, 18 patients were included in the control group and 16 in the liver metas-

tases group. In one patient belonging to the control group, largely reduced clearance of

5-FU was observed. DNA sequence analysis of the gene encoding DPD revealed that this

patient was heterozygous for a G→A point mutation in the DPYD gene. The resulting

protein from the mutated allele is inactive and total DPD activity in this patient was

low. Data on this patient were published elsewhere [22]. The statistical analyses were

performed both with and without inclusion of this patient in the control group. The liver

metastatic involvement of 9 patients in the metastases group was classified as level 1, that

of 4 patients as level 2 and that of 3 patients as level 3. An overview of the patient char-

acteristics is represented in table 1. An overview of treatment related toxicity, observed

during the first cycle, is shown in table 2.

Pharmacokinetics

The mean pharmacokinetic curves of 5-FU and DHFU as measured in both treatment

groups are represented in figure 2. The model, selected for calculating 5-FU and DHFU phar-

macokinetics of the patients in this study, is a four-compartment parent drug-metabolite

model with Michaelis-Menten elimination from the first towards the third compartment

(see figure 3). The model is described by four differential equations:

��

� ��

�

��

��

�

��

��

��

��

��

��

� ��

�

��

��

�

��

�

��

��

��

Chapter 4.1

76


77

live

r m

etas

tase

sco

ntr

ols

Su

bg

rou

ps

on

per

cen

tag

e o

f li

ver

met

asta

tic

invo

lvem

ent

< 2

5%

25

-50

%>

50

%

par

amet

er(n

orm

al r

ang

e)n

=1

6n

=1

8(n

=9)

(n=

4)(n

=3)

gen

der

M/F

9/7

13/5

4/5

4/0

1/2

age

(yr)

45-

78

(64)

4

5-80

(66)

57-

78(6

4) 4

5-76

(64)

47-

70(6

4)

wei

gh

t(k

g)

60-

94(7

8)

56-

85(7

3) 6

3-90

(78)

60-

94(7

9) 7

5-79

(76)

S-cr

eati

nin

e(4

0-10

0 µm

mo

l/l)

53

-131

(77)

62-1

84(7

7)

53-

131

(75)

71-

94(8

8) 6

1-81

(71)

AST

(<48

U/l

)

12-2

01(4

2) §

1

3-24

(20)

12-

60(3

4) §

26

-137

(59)

§

89-2

01(1

11) §

ALT

(<42

U/l

)

8-

234

(56)

§

5-

44(3

1)

8-58

(37)

§

38-2

02(7

4) §

50

-234

(66)

§

LDH

(200

-500

U/l

)

234-

2662

(5

54) §

17

3-39

6(2

72)

2

34-1

035

(449

) §

348-

1165

(689

) §

839-

2662

(235

7) §

ALP

(<12

5 U

/l)

65-1

221

(146

) §

54

-108

(79)

6

5-16

3(1

07) §

121

-266

(1

81) §

34

4-12

21

(454

) §

Bili

rub

in to

tal

(<17

µm

mo

l/l)

3-29

3(1

3)

5-

14(9

)

3-1

3(1

1)

8-59

(13)

31

-293

(40)

§

alb

um

in(3

5-55

g/l

) 2

4-39

(36)

2

5-43

(36)

31-

39(3

7) 3

6-38

(37)

24-

30(2

6) §

Ach

E-as

e(5

.4-1

3.2

x103 U

/l)

1.2

-8.3

(4.4

)

1.9-

6.5

(3.9

) 3

.0-8

.3(4

.9) §

1.2

-6.3

(3.7

) 1

.5-2

.8(2

.1)

AT-3

(80-

120

%)

5

2-13

7(9

2)

82

-126

(96)

83

-137

(96)

81

-100

(90)

52

-119

(57)

§ Sta

tistic

ally

diff

eren

t fro

m co

ntro

ls at

p<0

.05

(Man

n W

hitn

ey U

test

)

Tabl

e 1

Patie

nt C

hara

cter

istic

s

Data

are

pre

sent

ed a

s ran

ge. T

he m

edia

n va

lue

is pl

aced

bet

wee

n br

acke

ts.

Chapter 4.1

78


79

The compartments 1 and 2 represent the central and peripheral compartment for 5-FU

(parent drug) pharmacokinetics, compartments 3 and 4 are the central and peripheral

compartment for DHFU (metabolite) pharmacokinetics. The X values indicate the amount

of drug in each compartment respectively. Data are imported in the model as plasma drug

concentrations, measured in compartment 1 (5-FU) and compartment 3 (DHFU) respec-

tively. The volume of compartment 1 and 3 is calculated by dividing the drug amount

by drug concentration. The k-values represent linear distribution- and elimination rate

constants, and the Vmax

and Km

values represent Michaelis-Menten constants for non-linear

elimination from the first compartment. The Km

value was kept constant during fitting of

patient data. To determine the best fitting value, this parameter was varied between 0.5

and 15 mg/l. Km

=5 mg/l was selected as most optimal value, based upon the lowest sum-

marised AIC. Rinf

represents the infusion rate of 5-FU in mg/h. No differences existed in

model parameters between the 2 treatment groups and no correlations were measured

between individual model parameters and patient characteristics. Therefore, the calcu-

lated model parameters are listed in table 3 as mean values obtained from all 33 patients

in this study. The interindividual variation in 5-FU clearance was considerable, resulting in

metastases (n=15) no metastases (n=18)

CTC grade I II III IV I II III IV

gastrointestinal

nausea 6 0 0 0 5 0 0 0

vomiting 3 0 0 0 2 0 0 0

diarrhea 1 0 0 0 4 2 0 0

mucositis 3 4 0 0 2 3 0 0

Flu-like symptoms

fever 1 1 0 0 1 0 1 0

malaise 1 1 0 0 6 1 0

Others

dermatological 1 0 0 0 2 0 0 0

eyes 1 0 0 0 2 0 0 0

Toxicity of any kindb 10 (66%) 13 (72%)

aThe figures represent the number of patients suffering from a particular type of toxicity (graded ac-cording to the Common Toxicity Criteria version 2.0) bTotal number of patients suffering from toxicity of any kind at any grade.

Table 2 Overview of side effects during the first cyclea.

Chapter 4.1

78


79

� ��

��

��

��

��

��

��

��

��

��

�

��

��

� ��

��

��

�

��

��

��

��

Figure 2 Pharmacokinetics of 5-FU. Shown are 5-FU ( ) and DHFU ( ) plasma levels observed in control patients (n=18) and 5-FU ( ) and DHFU ( ) plasma levels observed in patients with liver metastases (n=16). All values are depicted as mean ± SD.

Figure 3 Four compartiment parent drug - metabolite pharmacokinetic model describing 5-FU and DHFU pharmacokinetics.

Chapter 4.1

80


81

5-FU AUCs ranging from the lowest to the highest value over a factor 3 (not including the

patient with DPD deficiency).

Correlation between patient covariables and pharmacokinetic parameters

We identified 18 patient covariables that were each tested in a univariate Spearman cor-

relation analysis. Tested covariables were sex, age, height, weight, body surface area (BSA),

lean body mass (LBM), creatinine, urea, level of liver metastatic involvement, AST, ALT, ALP,

LDH, bilirubin, albumin, AT-III, pseudocholinesterase and 5-FU dose. Positive correlations

were found between the BSA and the Vmax

and V1 values, regardless the level of liver meta-

static involvement (r = 0.65 and r = 0.54 respectively)

Discussion

The persistent uncertainty regarding the effects of liver metastases and liver dysfunction

on the pharmacokinetics of bolus injected 5-FU- made us to design the current study. We

decided to target the study on the extent of liver metastatic involvement and also decided

to include a detailed characterisation of the liver function in the study design.

We eventually included 34 patients from which 16 had liver metastases. We choose to

classify the extent of liver metastatic involvement in these patients as categorical rather

than continuous variable, according to Hunt et al.[19], since accurate measurement of the

percentage hepatic replacement is difficult to perform. More subtle differences between

patients cannot be detected in this approach, but this was not considered disadvanta-

Model parameter mean (SD)

Vmax (h-1) 1472 (356)

V1 (l) 15.5 (5.3)

K12 (h-1) 7.73 (4.13)

K21 (h-1) 6.24 (2.77)

V3 (l) 97 (42)

K34 (h-1) 6.18 (12.83)

K43 (h-1) 4.91 (7.38)

K30 (h-1) 1.80 (1.71)

AUC 5-FU (mg.h/l) 10.1 (3.7)

Cl 5-FU (ml/min) 1485 (537)

AUC DHFU (mg.h/l) 5.6 (2.0)

Table 3 Pharmacokinetic parameters

Chapter 4.1

80


81

geous, since small differences will probably be clinically irrelevant.

All patients received treatment according to the Mayo Clinics scheme. The 5-FU dose was

administered as short-time infusion (5-10 min), according to common practice in the

participating hospitals, but on the day of blood sampling, 5-FU was given as 2 min bolus

injection to warrant precise and standardised drug administration. The short half-life of

5-FU necessitated this standardisation, since uncertainty in this parameter can hamper

pharmacokinetic calculations.

To describe the non-linear pharmacokinetics, we applied a relatively complex model

with Michaelis-Menten elimination from the central compartment, based on the model

proposed by Collins et al [13]. Our model was selected on the basis of ‘best fit’ (objectified

by the Akaike Information Criterion) from a series of 8 different variants on the Collins

model. The final model that we used is almost identical to the model proposed by Terret et

al. [18] in their analysis of 5-FU pharmacokinetics. We also included the metabolite DHFU

in our model, but the additional value of this seemed limited, since large 95% confidence

intervals were found around the calculated K34

, K43

and K30

values.

The consequences of non-linear Michaelis-Menten pharmacokinetics are most profound

at plasma levels exceeding the Km

value. In the case of 5-FU, such plasma levels are

reached after bolus injection but not during continuous infusion. A reduction of liver DPD

capacity, due to liver metastases and/or liver dysfunction, might result in lower Vmax

values

and, thus, in a lower 5-FU clearance immediately after bolus injection. Our results do not

confirm this, as patients in both treatment groups displayed similar pharmacokinetics.

No significant correlations were found between pharmacokinetic parameters, including

overall 5-FU clearance, and liver function parameters.

The fact that most patients with liver metastases had mild to moderate liver dysfunction

might explain our observations. However, in three patients with extensive (level 3) meta-

static disease, attended by cholestase as indicated by high bilirubin and ALP levels, 5-FU

clearance also was unchanged. These patients further displayed high transaminase levels

(indicating cell damage) and low albumin and AT-III levels (indicating loss of function).

This observation suggests that the influence of extensive liver metastatic disease,

including liver damage, on 5-FU pharmacokinetics is at leas not dramatic. Recently, Terret

et al. performed a NONMEM analysis to identify covariables that affect 5-FU model pa-

rameters and they observed that their Vmax

values tended to increase with the volume of

liver metastatic involvement [18]. In our study this correlation was only weak (r = 0.21, see

figure 4) and at least clinically irrelevant. These results suggest that the metabolism of 5-

FU in metastatic tumour tissue at least equals that in healthy liver tissue. Extensive 5-FU

uptake in metastatic tissue indeed has been demonstrated during 18F-fluorouracil labelled

positron emission tomography in patients with liver metastases from colorectal cancer

[23]. Although the DPD activity in liver metastases from colon cancer seems to be lower

than in adjacent normal liver tissue [24], hepatic arterial blood flow is generally increased

in liver metastatic disease [19,25]. Since the elimination rate of drugs with a very large

Chapter 4.1

82


83

extraction ratio is strongly depending on the hepatic blood flow, an increase of liver blood

flow in metastatic disease might compensate for a reduced DPD activity in parts of the

liver replaced by metastases.

More or less expected on the basis of the almost identical pharmacokinetic profiles,

treatment related toxicity was comparable in both treatment groups. The incidence of

diarrhoea and malaise was somewhat higher in the control group, but this is probably

accidental. One patient in the control group experienced excessive toxicity as a result of

decreased 5-FU clearance due to DPD deficiency. A full description of the pharmacoki-

netics of 5-FU in this patient was published elsewhere [22]. Interestingly, we found that

irrespective of metastatic status 5-FU clearance was significantly lower in patients experi-

encing mucositis (1696 ± 640 vs. 1209 ± 290 ml/min, p<0.05, see figure 5). Such a trend was

not observed for nausea. This finding might be a coincidence, but it might also be possible

that late toxic effects such as mucositis are more related to pharmacokinetics than direct

toxic effects such as nausea. It has been shown that the extent of salivary excretion is a

predictor for the development of mucositis and salivary excretion is generally higher in

patients with low drug clearance [26].

Based on current data we conclude that there is no need for dose adjustment of 5-FU in

patients with liver metastases and mild to moderate elevations in liver function tests. Both

the extent of liver metastatic involvement and liver function parameters were included

�

��

��

��

��

��

� � � �

��

��

Figure 4 Correlation between level of hepatic replacement and calculated Vmax (h-1) value.

Chapter 4.1

82


83

as parameters in this study to this allowed a more comprehensive evaluation of liver

metastatic disease on 5-FU pharmacokinetics. We believe that there is no reason to expect

increased 5-FU toxicity in patients with liver metastases due to a reduced 5-FU clearance.

Therefore we do not recommend 5-FU dose reduction as standard procedure in these

patients.

Acknowledgement

We would like to thank Roche Basel for providing dihydrofluorouracil chemical standard, Dr.

Hans Proost (Department of Pharmacokinetics and Drug Delivery, University Groningen,

NL) for his advice on pharmacokinetic modelling, Barbara Bong and Dr. Robert de Jong

��

�

��

��

��

��

��

��

��

��

��

��

��

�

��

�

��

��

��

��

��

��

��

��

��

��

��

�

��

��

��

��

Figure 5 Correlation between 5-FU clearance (ml/min) and the occurrence of mucositis (upper panel) and nausea (lower panel).

Chapter 4.1

84


85

(Martini Hospital Groningen, NL), Henk de Korte (Diaconessen Hospital Meppel, NL) and

Janny Haasjes (Bethesda Hospital Hoogeveen, NL) for patient inclusions, the departments

of radiology of the participating hospitals for help on calculations regarding the extent of

liver metastatic involvement, and last but not least all nurses of the oncology wards of the

participating hospitals for their assistance during blood sampling.

Chapter 4.1

84


85

References


1664

2. Heggie GD, Sommadosi JP, Cross DS, Huster WJ, Diasio RB. Clinical pharmacokinetics of 5-fluoro-

uracil and its metabolites in plasma, urine and bile. Cancer Res 1987;47:2203-2206

3. Chazal M, Etienne MC, Renee N, Bourgeon A, Richelme H, Milano G. Link between dihydropy-

rimidine dehydrogenase activity in peripheral blood mononuclear cells and liver. Clin Cancer Res

1996;2: 506-510

4. Etienne MC, Lagrange JL, Dassonville O, Fleming R, Thyss A, Renee N, Schneider M, Demard F,

Milano G. Population study of dihydropyrimidine dehydrogenase in cancer patients. J Clin Oncol

1994;12:2248-2253

5. Fleming RA, Milano G, Thyss A, Etienne MC, Renee N, Schneider M, Demard F. Correlation between

dihydropyrimidine dehydrogenase activity in peripheral mononuclear cells and systemic clear-

ance of fluorouracil in cancer patients. Cancer Res 1992;52: 2899-2902

6. Harris BE, Song R, Soong SJ, Diasio RB. Relationship between dihydropyrimidine dehydrogenase

activity and plasma 5-fluorouracil levels with evidence for circadian variation of enzyme activity

and plasma drug levels in cancer patients receiving 5-fluorouracil by protracted continuous infu-

sion. Cancer Res 1991;50:197-201

7. Lu Z, Zhang R, Diasio RB. Population characteristics of hepatic dihydropyrimidine dehydrogenase

activity, a key metabolic enzyme in 5-fluorouracil chemotherapy. Clin Pharmacol Ther 1995;58:

512-522

8. Ho DH, Townsend L, Luna MA, Bodey GP. Distribution and inhibition of dihydrouracil dehydroge-

nase activities in human tissues using 5-fluorouracil as substrate. Anticancer Res 1986;6:781-784

9. Floyd RA, Hornbeck CL, Byfield JE, Griffiths JC, Frankel SS. Clearance of continuously infused 5-flu-

orouracil in adults having lung or gastrointestinal carcinoma with or without hepatic metastases.

Drug Intell Clin Pharm 1982;16: 665-667

10. Fleming RA, Milano GA, Etienne MC, Renee N, Thyss A, Schneider M, Demard F. No effect of dose,

hepatic function, or nutritional status on 5-FU clearance following continuous (5-day) 5FU infu-

sion. Br J Cancer 1992;6: 668-672

11. Etienne MC, Chatelut E, Pivot X, Lavit M, Pujol A, Canal P, Milano G. Co-variables influencing 5-fluo-

rouracil clearance during continuous venous infusion. A NONMEM analysis. Eur J Cancer 1998;34:

92-97

12. Christophidis N, Vajda FJE, Lucas I, Drummer O, Moon WJ, Louis WJ. Fluorouracil therapy in pa-

tients with carcinoma in the large bowel: a pharmacokinetic comparison of various rates and

routes of administration. Clin Pharmacokinet 1978;3:330-336

13. Collins JM, Dedrick RL, King FG, Speyer JL, Myers CE. Nonlinear pharmacokinetic models for 5-flu-

orouracil in man: intravenous and intraperitoneal routes. Clin Pharmacol Ther 1980;28:235-246

14. McDermot BJ, van den Berg HW, Murphy RF.Nonlinear pharmacokinetics for the elimination of

5-fluorouracil after intravenous administration in cancer patients. Cancer Chemother Pharmacol

Chapter 4.1

86

1982;9:173-178

15. Van Groeningen CJ, Pinedo HM, Heddes J, Kok RM, De Jong AP, Wattel E, Peters GJ, Lankelma J.

Pharmacokinetics of 5-fluorouracil assessed with a sensitive mass spectrometric method in pa-

tients on a dose escalation schedule. Cancer Res 1988;48:6956-6961

16. Gamelin E, Boisdron-Celle M. Dose monitoring of 5-fluorouracil in patients with colorectal or

head and neck cancer - status of the art. Crit Rev Oncol Hematol 1999;30: 71-79

17. Nowakowska-Dulawa E. Circadian rhythm of 5-fluorouracil pharmacokinetics and tolerance.

Chronobiologica 1990;17:27-35

18. Terret C, Erdociain E, Guimbaud R, Boisdron-Celle M, McLeod HL, Fety-Deporte R, Lafond T, Game-

lin E, Bugat R, Canal P, Chatelut E. Dose and time dependencies of 5-fluorouracil pharmacokinet-

ics. Clin Pharmacol Ther 2000;68:270-279

19. Hunt TM, Flowerdew ADS, Britten AJ, Fleming JS, Karran SJ, Taylor I. An association between

parameters of liver blood flow and percentage hepatic replacement with tumour. Br J Cancer

1989;59:410-414

20. Ackland SP, Garg MB, Dunstan RH. Simultaneous determination of dihydrofluorouracil and 5-

fluorouracil in plasma by high-performance liquid chromatography. Anal Biochem 1997;246:

79-85

21. Bourne DWA. Evaluation of program output. In: Bourne DWA (ed) Mathematical modelling of

pharmacokinetic data. Technomic publishing Co inc. 1995 Lancaster Basel p.107-109

22. Maring JG, Van Kuilenburg ABP, Piersma H, Groen HJM, Uges, DRA, De Vries EGE. Reduced 5-FU


DPYD gene. Br J Cancer 2002;86;1028-1033

23. Moehler M, Dimitrakopoulou-Strauss A, Gutzler F, Raeth U, Strauss LG, Stremmel W.18F-labeled

fluorouracil positron emission tomography and the prognoses of colorectal carcinoma patients

with metastases to the liver treated with 5-fluorouracil. Cancer 1998;83:245-253

24. Johnston SJ, Ridge SA, Cassidy J, McLeod HL. Regulation of dihydropyrimidine dehydrogenase in

colorectal cancer. Clin Cancer Res 1999;5:2566-2570

25. Leen E, Goldberg JA, Robertson J, Angerson WJ, Sutherland GR, Cooke TG, McArdle CS. Early de-

tection of occult colorectal hepatic metastases using duplex colour Doppler sonography. Br J

Surg 1993; 80:1249-1251

26. Joulia JM, Pinguet F, Ychou M, Duffour J, Astra C, Bresolle F. Plasma and salivary pharmacokinetics

of 5-fluorouracil (5-FU) in patients with metastatic colorectal cancer receiving 5-FU bolus plus

continuous infusion with high-dose folinic acid. Eur J Cancer 1999;35:296-301

Reduced 5-FU clearance in a patient with low DPD activity due to heterozygosity for a mutant allele of the DPYD gene

Jan Gerard Maring1, André B.P. van Kuilenburg2, Janet Haasjes2, Henk Piersma3, Harry J.M.

Groen4, Donald R.A. Uges5, Albert H. van Gennip2, Elisabeth G.E. de Vries6


Hoogeveen; 2Department of Clinical Chemistry, Academic Medical Center Amsterdam; 3Department of Internal Medicine, Martini Hospital Groningen; Departments of 4Pulmonary Diseases, 5Pharmacy and 6Medical Oncology, University Hospital Groningen,

The Netherlands

Br J Cancer 2002;86;1028-1033

Chapter 4.2

88

Influence of DPD deficiency on 5-fluorouracil pharmacokinetics

89

One out of billions. Lago di Garda. Italy 2000.

Chapter 4.2

88


89

Abstract

Aim 5-FU pharmacokinetics, DPD-activity and DNA sequence analysis were compared

between a patient with extreme 5-FU induced toxicity and six control patients with

normal 5-FU related symptoms.

Methods Patients were treated for colorectal cancer and received chemotherapy consist-

ing of folinic acid 20 mg/m2 plus 5-FU 425 mg/m2 . Blood sampling was carried out on day

1 of the first cycle.

Results The 5-FU AUC in the index patient was 24.1 mg.h/l compared to 9.8 ± 3.6 (range

5.4-15.3) mg.h/l in control patients. The 5-FU clearance was 520 ml/min versus 1293 ± 302

(range 980-1780) ml/min in controls. The activity of DPD in mononuclear cells was lower

in the index patient (5.5 nmol/mg/h) compared to the 6 controls (10.3 ± 1.6, range 8.0-

11.7 nmol/mg/h). Sequence analysis of the DPD gene revealed that the index patient was

heterozygous for a IVS14+1G>A point mutation.

Conclusions Our results indicate that the inactivation of one DPYD allele can result in a

strong reduction in 5-FU clearance, causing severe 5-FU induced toxicity.

Introduction

Fluorouracil (5-FU) is widely used in chemotherapeutic regimens for the treatment

of breast-, colorectal- and head- and neck cancer. The cytotoxic mechanism of 5-FU is

complex, requiring intracellular bioconversion of 5-FU into cytotoxic nucleotides (see

figure 1). Inhibition of thymidylate synthase by the metabolite 5-fluoro-2’-deoxyuridine-

5’-monophosphate is thought to be the main mechanism of cytotoxicity [1]. The cytotox-

icity is caused by only a small part of the administered 5-FU dose, as the majority of 5-FU is

rapidly metabolised into inactive metabolites. The initial and rate-limiting enzyme in the

catabolism of 5-FU is dihydropyrimidine dehydrogenase (DPD), catalysing the reduction

of 5-FU into 5,6-dihydrofluorouracil (DHFU). Several groups have suggested a major role

of DPD in the regulation of 5-FU metabolism and thus in the amount of 5-FU available for

cytotoxicity [2-5]. Indeed, in patients with DPD enzyme deficiency, 5-FU chemotherapy

is associated with severe, life-threatening toxicity [6]. Moreover, a markedly prolonged

elimination half-life of 5-FU has been observed in a patient with complete deficiency

of DPD enzyme activity [7]. Several mutations in the dihydropyrimidine dehydrogenase

gene (DPYD), which encodes for the DPD enzyme have recently been identified [6,8].

Furthermore, the frequency of DPD deficiency has been estimated to be as high as 2-3%

[5,9,10]. To date, a direct correlation between DPD gene mutation and decreased 5-FU

clearance has only been suggested but never been proven. In this study, we provide the

first detailed analysis of 5-FU pharmacokinetics in a patient with low DPD-activity due to

heterozygosity for a mutant allele of the gene encoding DPD.

Chapter 4.2

90


91

Methods

Chemicals

5-FU was obtained from Sigma Chemical Co. (Zwijndrecht, the Netherlands). 5,6-dihydro-

5-fluorouracil was kindly provided by Roche Laboratories (Basel, Switzerland). AmpliTaq

Taq polymerase and BigDye-Terminator-Cycle-Sequencing-Ready-Reaction kit were

supplied by Perkin Elmer (San Jose, CA, USA). A Quaquik Gel Extraction kit was obtained

from Qiagen (Hilden, Germany). Human heparinised plasma was obtained from the Red

Cross Blood Bank (Groningen, the Netherlands). [4-14C ]Thymine (1.85-2.22 GBq/mmol) was

obtained from Moravek Biochemicals (CA, USA) and Lymphoprep (spec.gravity 1.077 g/ml,

280 mOsm) was from Nycomed Pharma AS (Oslo, Norway). Leucosep tubes were supplied

by Greiner (Frickenhausen, Germany). All other chemicals were of analytical grade.

Patient and controls

All patients were treated for colorectal cancer and participated in a protocol that had

been designed to study 5-FU and DHFU pharmacokinetics. The protocol was approved

��

��

��

��

��

��

��

Figure 1 Metabolism of 5-FU. 5-Fluoro-2’-deoxyuridine-5’-monophosphate (FdUMP) is the cytotoxic product resulting from a multi-step 5-FU activation route . FdUMP inhibits the enzyme thymidylate synthase (TS), which leads to intracellular accumulation of deoxy-uridine-monophospate (dUTP) and depletion of deoxy-thymidine-monophospate (dTMP). This causes arrest of DNA synthesis. The initial and rate-limiting enzyme in the catabolism of 5-FU is dihydropyrimidine dehydrogenase (DPD), catalys-ing the reduction of 5-FU into 5,6-dihydrofluorouracil (DHFU). Subsequently, DHFU is degraded into fluoro-β-ureidopropionic acid (FUPA) and fluoro-β-alanine (FBAL).

Chapter 4.2

90


91

by the Medical Ethics Review Committee of the Martini Hospital Groningen and written

informed consent was obtained from all patients. All patients who entered this protocol

were chemotherapy naive. Chemotherapy consisted of folinic acid 20 mg/m2 combined

with 5-FU 425 mg/m2 , both on 5 successive days, in a 28-day cycle. Blood sampling was

carried out on the first day of the first chemotherapy cycle immediately following the 5-FU

dose, administered as bolus intravenous injection over 2 min. Folinic acid was infused after

the end of blood sampling. On the following 4 days, the same 5-FU dose was administered

as short time infusion, after folinic acid administration.

One patient experienced severe toxicity during the first chemotherapy cycle and,

therefore, a screening on DPD deficiency was initiated. Data from seventeen patients who

participated in the same study protocol were analysed for reference pharmacokinetics.

Six patients, who showed no signs of severe toxicity, were randomly selected for reference

DPYD genotyping and DPD enzyme activity. These patients served as controls.


For pharmacokinetic sampling, a canule was placed in the arm of the patient contralateral

from drug administration. Blood samples (5 ml) were collected in heparinised tubes just

before, and 2, 5, 10, 20, 30, 45, 60, 80, 100, 120, 150 and 180 min postinjection. Collected

samples were immediately placed on ice and subsequently centrifuged at 2,500 g for 10

min. The plasma samples were analysed for 5-FU and DHFU concentrations by high-per-

formance liquid chromatography (HPLC) on the day of collection.

Blood samples for DPD analysis were collected 5 to 23 months after blood sampling for

5-FU pharmacokinetics, which corresponds to intervals ranging from 2 to 17 months after

the last 5-FU dose. None of the patients received chemotherapy at that moment.


5-FU and DHFU concentrations were measured by HPLC analysis using a modification of

the method described by Ackland et al [11]. Briefly, 100 µl chlorouracil internal standard

solution (80 mg/l in water) was added to 1 ml plasma sample, and this mixture was

vortexed and subsequently deproteinated with 50 µl of a 50% (w/v) trichloracetic acid

solution. After centrifugation at 8,000 g for 2 min the supernatant was transferred into a

20 ml centrifuge tube and neutralised with 1 ml 1M sodium acetate solution. Then 5 ml

ethylacetate was added and the mixture was vortexed during 10 min. After separation of

the organic and aqueous layers by centrifugation at 5,000 g for 5 min, the ethylacetate

layer was transferred into a 10 ml tube and evaporated under a stream of nitrogen at 25

°C. The residue was dissolved in 100 µl ultrapure water and 20 µl was injected. 5-FU and

DHFU standards ranging from 0.5 to 20 mg/l were prepared in human plasma.

The chromatographic system consisted of a Waters 616 pump equipped with a Waters

717+ autosampler. The separation of 5-FU and DHFU was accomplished by gradient

elution at ambient temperature on a Phenomenex Prodigy ODS 3 column (I.D. 250x4.6

Chapter 4.2

92


93

mm, 5µm) equipped with a guard column (30x4.6 mm) of the same material. Mobile phase

A consisted of 1.5 mM K3PO

4 and 1% (v/v) methanol (pH=6.0) and mobile phase B of 1.5

mM K3PO

4 and 5% methanol (pH=6.0).

The gradient was programmed as follows: 100% A during 2 min; 100% A → 100% B in 0.5

min; 100% B during 7 min; 100% B → 100% A in 0.5 min; 100% A during 10 min. Detection

was performed using a Waters 996 Photo Diode Array UV detector interfaced with a

Millenium 2010 Chromatography Manager Workstation. Spectra were acquired in the 201-

300 nm range. 5-FU was monitored at 266 nm and DHFU at 205 nm. The internal standard

chlorouracil was monitored at both wavelengths.


The pharmacokinetic analyses were performed in the ADAPT II computer program (version

4.0; USC Los Angeles). The pharmacokinetic data of both the index patient and seventeen

reference patients (among which the six controls) were tested in 8 different models. In each

model the patient’s data were fitted individually and for each data set the Akaike Information

Criterion (AIC) was calculated. The model with the lowest summarised AIC value was selected

as the better one (data not shown). The model used for calculating 5-FU pharmacokinetics is a

two-compartment model with Michaelis-Menten elimination from the first compartment

and is described by two differential equations:

��

� ��

�

��

��

�

��

��

��

��

��

X1

and X2

indicate the amount of drug in each compartment, respectively. The k-values

represent linear distribution- and elimination rate constants, and the Vmax

and Km

values

represent Michaelis-Menten constants for non-linear elimination from the first compartment.

Rinf

represents the infusion rate of 5-FU.

The area under the curve of 5-FU and DHFU was calculated using the trapezoid rule. The

average systemic clearance of 5-FU was calculated by dividing the administered dose by the

area under the curve (AUC).

Determination of dihydropyrimidine dehydrogenase activity

To investigate whether the 5-FU toxicity might have been caused by a partial deficiency of

DPD, we determined the activity of DPD in peripheral blood mononuclear (PBM) cells.

Therefore PBM cells were isolated from 15 ml EDTA anticoagulated blood and the activity

of DPD was determined according previously decribed methods [12]. In brief, the sample

was incubated in a reaction mixture containing 35mM potassium phosphate pH 7.4, 1mM

dithiothreitol, 2.5mM magnesium chloride, 250µM NADPH and 25 µM [4-14C] thymine.

Chapter 4.2

92


93

After an appropriate incubation time, the reaction catalysed by DPD was terminated by

adding 10 % (v/v) perchloric acid. The reaction mixture was centrifuged at 11,000 g for 5

min to remove protein. The separation of radiolabelled thymine and the reaction products

was performed by reversed phase HPLC. Protein concentrations were determined with a

copper-reduction method using bicinchoninic acid, as decribed by Smith et al. [13].

PCR amplification of coding exons

The DNA from the index and control patients was isolated from PBM cells as previously

described [14]. PCR amplification of exon 14 and flanking intronic regions was carried out

according to Van Kuilenburg et al. [6]. PCR products were separated on 1% agarose gels,

visualised with ethidium bromide and purified using a Qiaquick Gel Extraction kit and

used for direct sequencing.

Sequence analysis

Sequence analysis was carried out on a Applied Biosystems model 377 automated DNA

sequencer using Dye-Terminator method for the DPD cDNA and genomic fragments.


Each value, measured in the index patient, was compared to the mean ± 2 SD range of the

corresponding parameter in the control group . Values outside this range were considered

abnormal (p<0.05). We did not match our control patients for age and gender.

Results

Clinical evaluation

Patient characteristics from the index and control patients, as measured before 5-FU ad-

ministration on the first day of the first chemotherapy cycle, are listed in table 1. The index

patient is a 60-year-old white female who received adjuvant chemotherapy for Dukes C

colon carcinoma. She was known with a chronic moderate renal function impairment as

a result of a double sided nephrolithotomy at age 40. The first two injections with a total

dose of 800 mg 5-FU/day were tolerated well by the patient without complications. On the

third day of chemotherapy she experienced nausea and cold shivers. The nausea was suc-

cessfully treated with metoclopramide. The cold shivers remained on days 4 and 5. Twelve

days after administration of the first 5-FU injection, leukopenia (1.5x109 leukocytes/l) and

thrombocytopenia (26x109 platelets/l) developed along with nausea, diarrhoea, stomati-

tis, fever and hair loss. The next day leukocytes and platelets decreased to 0.5x109/l and

12x109/l (both nadir values respectively). During this period the patient developed leuko-

penic fever (40 °C) for which antibiotics were administered. Until day 20 the leucocytes

and platelets remained low (1x109/l and 13x109/l respectively). During the subsequent

Chapter 4.2

94


95

��

�

��

��

� ��

��

��

��

��

��

��

��

Figure 2 Pharmacokinetics of 5-FU. Shown are 5-FU plasma levels observed in a patient with a IVS14+1G→A mutation in the DPYD gene ( ) and the 5-FU plasma levels resulting from simulation of a normal renal function in the same patient. 5-FU plasma levels from control patients are depicted as mean ± SD ( ; n=6).

Index patient Controls (n=6)

mean ± 2 SD

Gender M/F F 4/2

Age (yr) 60 64 ± 12

Weight (kg) 73 77 ± 12

Serum creatinine (µmmol/L) 184 § 81 ± 30

Aspartate aminotransferase (U/L) 23 18 ± 8

Alanine aminotransferase (U/L) 41 29 ± 26

LDH (U/L) 379 302 ± 152

Alkaline phosphatase (U/L) 95 72 ± 24

Bilirubin total (µmmol/L) 7 10 ± 6

Albumin (g/L) 32 37 ± 8

§ outside 95% control range, p<0.05

Table 1 Patient Characteristics

Chapter 4.2

94


95

week the clinical picture and hematological parameters gradually improved and normal-

ised. On day 34 the patient was discharged from the hospital.

The toxicity observed in the six control patients was limited to mild nausea (n=4), vomiting

(n=2) and CTC grade 1 stomatitis (n=1).


The clearance of 5-FU was considerable slower in the index patient than in the six control

patients. In all control patients the plasma level at t=90 min was below 0.1 mg/l, whereas

in the index patient the plasma level was still 3.8 mg/l at this time point (see figure 2).

The AUC in the patient suffering from toxicity was 24.1 mg.h/l compared to 15.3 mg.h/l

as highest AUC value in control patients. We calculated an average systemic clearance of

only 520 ml/min versus 980-1780 ml/min in controls. The Vmax value, calculated by phar-

macokinetic modelling was 548 mg/h, while the Vmax values of control patients ranged

from 984 to 1772 mg/h (see table 2). The pharmacokinetic data of the six control patients

did statistically not differ from data of the reference group. The effect of the impaired

renal function of the index patient on 5-FU clearance was studied by pharmacokinetic

modelling.

The excretion of 5-FU in urine was measured in five patients of the reference group

(including two control patients) and kurine

was estimated 0.5 ± 0.08 h-1. This kurine

value, in-

dividually normalised on calculated GFR, was used during subsequent modelling of other

patient data. A normal renal function was simulated in the index patient by replacing the

GFR related kurine

by kurine

=0.6. Renal function impairment appeared to have only a slight

effect on 5-FU clearance. In the index patient, we estimated an additional 18% increase of

Index patient Index patient

kurine

=0.6

simulated data

Controls

(n=6)

Controls

Kurine

=0

simulated data

Dose (mg/m2) 447 431 ± 64

AUC 5-FU (mg.h/L) 24.1 § 20.4 § 10.0 ± 6.6 § 11.8 ± 8.6 §

Cl 5-FU (mL/min) 553 § 637 § 1493 ± 840 § 1306 ± 886

Vmax (1/h) 548 § 1329 ± 680 §

V1 /kg (L) 0.25 0.23 ± 0.06

K12 (1/h) 9.0 5.1 ± 7.6

K21 (1/h) 7.5 5.2 ± 6.6

§ data of index patient outside 95% control range, p<0.05

Table 2 Overview of pharmacokinetic parameters. Data are presented as single observation or as mean ± 2 SD

Chapter 4.2

96


97

the AUC due to the renal insufficiency upon a 108% higher AUC due to partial DPD defi-

ciency. Simulation of anuria in the control group (Kurine

= 0), revealed a 16 ± 4% increase of

the 5-FU AUC. In the reference group, the estimated increase was 15 ± 5 %.

Activity of DPD in PBM cells

The activity of DPD in PBM cells was lower in the patient experiencing severe toxicity (5.5

nmol/mg/h) compared to the 6 control patients (8.0-11.7 nmol/mg/h; mean 9.6).

Genomic sequence analysis

Sequence analysis of the DPD gene showed that the patient was heterozygous for a G→A

point mutation in the invariant GT splice donor site (IVS14+1G>A), leading to the skipping

of exon 14 directly upstream of the mutated splice donor site during DPD pre-mRNA

splicing. Sequence analysis of the DPD gene of the six control patients revealed no gene

mutations.

Discussion

5-FU remains the major drug in the treatment of advanced colorectal cancer. DPD is the

key metabolic enzyme in 5-FU degradation and since more than 80% of the dose is meta-

bolised by this enzyme, DPD activity is one of the main factors determining drug exposure

[2-5]. It is generally accepted that DPD activity in the liver is responsible for the majority of

5-FU catabolism [15,16], but PBM cells are often used as a surrogate for liver DPD activity,

since these cells are better accessible [2-5]. Several groups have suggested that markedly

diminished DPD activity in PBM cells is strongly related to the risk of developing severe

5-FU toxicity due to reduced 5-FU clearance [4-6]. Although total DPD deficiency is rare in

adults, about 2-3% of the population has a low PBM-DPD enzyme level and, thus, is at risk

to develop severe toxicity when treated with 5-FU [5,9,10]. In only few reports however,

the effect of DPD-deficiency on 5-FU clearance has been objectively quantified. Diasio

et al. administered a test dose of 25 mg/m2 5-FU to a patient with non-detectable DPD-

activity in PBM cells and found a very low 5-FU clearance rate [7]. This patient was probably

homozygous for a mutant DPD allele, although the genetic cause was never elucidated.

Stephan et al. reported severe toxicity in a female patient after treatment comprising

folinic acid 500 mg/m2 as 2 h intravenous infusion plus 125 mg orally followed by 5-FU

2 g/m2 as a 24 h continuous infusion [17]. They found a 5-FU plasma level of 0.3 mg/l on

day 15 after administration, which implies a dramatic overexposure to 5-FU. This patient

could not have been homozygous deficient because the DPD activity in lymphocytes was

within the normal range. The role of PBM-DPD activity as an indicator for 5-FU clearance

is, however, questionable. Lu et al. found a correlation between PBM-DPD activity and

DPD activity measured in the liver [9], but others reported a weak, non-significant rela-

Chapter 4.2

96


97

tionship [10]. Both Harris et al. and Fleming et al. initially reported a correlation between

PBM-DPD activity and 5-FU clearance but re-examination of this relationship in a larger

set of patients revealed a markedly weakened correlation [2,3,5]. These data indicate that

PBM-DPD activity is not a strong and reliable indicator of 5-FU clearance. To some extent,

the variability in DPD activity might have been caused by the composition of the isolated

PBM cells [12]. Another important factor is the timing of cell sampling in relation to 5-FU

administration, since McLeod et al. showed that 5-FU is able to inhibit DPD-activity [18].

In this paper, we report a combined pharmacokinetic and genetic analysis of the DPD

gene and demonstrate that a single G→A point mutation in the invariant splice donor site

IVS14+1 of the DPD gene has profound impact on the clearance of 5-FU. We also found a

lower PBM-DPD activity in the index patient compared to 6 controls. The DPD activity was

comparable to the activity observed in obligate heterozygotes (5.5 ± 2.1 nmol/mg/h, n=8)

in previous work, but the measured value also fits within the range for normal controls

(10.0 ± 3.4 nmol/mg/h, range 3.4-18 nmol/mg/h, n=22) [6]. This might indicate that not

only obligate heterozygotes, but also low normal homozygotes are at risk for developing

severe toxicity when treated with 5-FU. It is however as yet unclear whether the pharma-

cokinetic profile of 5-FU is identical in both groups. Unfortunately, we did not measure

DPD activity and 5-FU pharmacokinetics on the same day. DPD activity was measured at

least two months after completing chemotherapy and might have been changed since

the first chemotherapy cycle as a result of chemotherapy itself or disease state. Although

5-FU has a direct inhibitory effect on DPD activity, as was shown by McLeod et al., we

believe that it is not likely that this effect will continue until two months after the last

dose [18]. Furthermore, it has been shown that DPD activity is lower in (breast-) cancer

patients compared to healthy persons, suggesting an effect of disease state [19]. We tried

to minimise this effect by matching index patient and controls for this variable (all Dukes

C, with no signs of disease progression at time of blood sampling for DPD). Finally, timing

of blood sampling is an important parameter in relation to DPD activity, since the activity

of DPD exhibits a circadian pattern, with lowest activity around 1 p.m. [2]. All our patients

received chemotherapy between 10 a.m. and 3 p.m. and blood samples for DPD analysis

were collected between 11 a.m. and 2 p.m. to minimise the effect of circadian variation.

Thus, unless unfortunate late DPD sample collection, we believe our results to be repre-

sentative for DPD activity during pharmacokinetic sampling.

The structural organization of the DPD gene has recently been described. It is 150 kb

in length and consists of 23 exons ranging in size from 69 to 1404 bp [20]. The G→A

mutation changes an invariant GT splice donor site into AT which leads to skipping of a

165 bp exon immediately upstream of the mutated spice donor site during the splicing of

DPD pre-mRNA. As a consequence, a 165 bp fragment encoding the amino acid residues

581-635 of the primary sequence of the DPD protein is lacking in the mature DPD mRNA,

which results in an enzyme without catalytic activity [14,21]. Analysis of the prevalence of

the various mutations among cancer patients with partial DPD deficiency showed that the

Chapter 4.2

98


99

G→A mutation in the invariant splice donor site is the most common one (43%) [6].

We believe that in our patient the IVS14+1G>A mutation explains the dramatic reduction

in 5-FU clearance compared to controls. This is in line with the observation that at least

80% of the 5-FU dose is catabolised by DPD. Although our patient had a moderately

impaired renal function, we analysed that the effect of renal function on 5-FU clearance is

only limited. This was expected, as only about 10% of the 5-FU dose is excreted in urine.

It is important, however, to realise that in patients with reduced DPD capacity, the con-

tribution of renal excretion to total clearance is relatively increased. As a consequence,

the impact of renal insufficiency on the AUC is larger in DPD deficient than in DPD pro-

ficient patients. Thus, in the index patient, the impaired renal function might have been

contributed to development of more severe toxicity, additionally to that caused by DPD

deficiency.

Development of rapid assays to detect mutations in the DPYD gene makes it possible to

carry out a genetic screening prior to the start of chemotherapy containing 5-FU. However

it is important to identify those mutations that result in a defect DPD protein.

So far, 19 molecular defects in the DPYD gene such as point mutations and deletions due

to exon skipping have been reported, but not all mutations result in a DPD enzyme de-

ficiency [6]. Incomplete correlation between DPD phenotype and genotype is clinically

important and suggests that DPD polymorphisms are likely to be complex [8].

Our results indicate that low DPD activity, due to the inactivation of one DPYD allele

results in a strong reduction in 5-FU clearance, measured on day 1 of chemotherapy. In-

hibition of the yet reduced DPD activity by 5-FU itself during subsequent days may lead

to further reduction of 5-FU clearance and this may further add to the development of

severe toxicity. In order to identify those mutations that result in reduced 5-FU clearance,

monitoring of 5-FU plasma levels using a limited sampling strategy can be helpful in

patient selection. This requires, however, rapid plasma level analysis, because results from

the first 5-FU infusion must be available before the second dose is administered. Unfor-

tunately, no rapid 5-FU (immuno-)assay is available yet, and therefore in most hospitals

therapeutic drug monitoring of 5-FU is probably not feasible.

Alternatively, the use of DPD inhibitors such as eniluracil in combination with a reduced

5-FU dose might eliminate the problem of DPD-related variable clearance of 5-FU. Clinical

trials are in progress to evaluate such combinations as an alternative for standard 5-FU

therapy.

Acknowledgements

We thank Dr. J.H. Proost (Department of Pharmacokinetics and Drug Delivery, University

Groningen) for advice on pharmacokinetic modelling. We thank Roche Basel for providing

dihydrofluorouracil chemical standard.

Chapter 4.2

98


99

References

1. Pinedo HM and Peters GF. Fluorouracil: biochemistry and pharmacology. J Clin Oncol 1988;6:

1653-1664

2. Harris BE, Song R, Soong SJ and Diasio RB. Relationship between dihydropyrimidine dehydroge-

nase activity and plasma 5-fluorouracil levels with evidence for circadian variation of enzyme

activity and plasma drug levels in cancer patients receiving 5-fluorouracil by protracted continu-

ous infusion. Cancer Res 1990;50:197-201

3. Fleming RA, Milano G, Thyss A, Etienne MC, Renee N, Schneider M and Demard F. Correlation be-

tween dihydropyrimidine dehydrogenase activity in peripheral mononuclear cells and systemic

clearance of fluorouracil in cancer patients. Cancer Res 1992;52:2899-2902

4. Lu Z, Zhang R and Diasio RB. Dihydropyrimine dehydrogenase activity in human peripheral

blood mononuclear cells and liver: population characteristics, newly identified patients, and

clinical implication in 5-fluorouracil chemotherapy. Cancer Res 1993;53: 5433-5438

5. Etienne MC, Lagrange JL, Dassonville O, Fleming R, Thyss A, Renee N, Schneider M, Demard F and

Milano G. Population study of dihydropyrimidine dehydrogenase in cancer patients. J Clin Oncol

1994;12: 2248-2253

6. Van Kuilenburg ABP, Haasjes J, Richel DJ, Zoetekouw L, Van Lenthe H, Waterham HR, De Abreu RA,

Maring JG, Vreken P and Van Gennip AH. Clinical implications of dihydropyrimidine dehydroge-

nase (DPD) deficiency in patients with severe 5-fluorouracil associated toxicity. Identification of

new mutations in the DPD gene. Clin Cancer Res 2000;6:4705-4712

7. Diasio RB, Beavers TL and Carpenter JT. Familial deficiency of dihydropyrimine dehydrogenase.

Biochemical basis for familial pyrimidinemia and severe 5-fluorouracil induced toxicity. J Clin

Invest 1988;81:47-51

8. Collie-Duguid ES, Etienne MC, Milano G and McLeod HL. Known variant DPYD alleles do not ex-

plain DPD deficiency in cancer patients. Pharmacogenetics 2000;10:217-223

9. Lu Z, Zhang R and Diasio RB. Population characteristics of hepatic dihydropyrimidine dehydro-

genase activity, a key metabolic enzyme in 5-fluorouracil chemotherapy. Clin Pharmacol Ther

1995;58:512-522

10. Chazal M, Etienne MC, Renee N, Bourgeon A, Richelme H, Milano G Link between dihydropy-

rimidine dehydrogenase activity in peripheral blood mononuclear cells and liver. Clin Cancer Res

1996;2:506-510

11. Ackland SP, Garg MB, Dunstan RH. Simultaneous determination of dihydrofluorouracil and 5-fluo-

rouracil in plasma by high-performance liquid chromatography. Anal Biochem 1997; 246:79-85

12. Van Kuilenburg ABP, Van Lenthe H, Tromp A, Veldman PC, Van Gennip AH. Pitfalls in the diagnosis

of patients with partial dihydropyrimidine dehydrogenase deficiency. Clin Chem 2000:46:9-17.

13. Smith PK, Krohn RI, Hermanson GT, Mallia AK, Gartner FH, Provenzano MD, Fujimoto EK, Goeke NM,

Olson BJ, Klenk DC. Measurement of protein using bicinchoninic acid. Anal Biochem 1985;150:76-

85

14. Van Kuilenburg ABP, Vreken P, Beex LV, Meinsma R, Van Lenthe H, De Abreu RA and Van Gennip

Chapter 4.2

100

AH. Heterozygosity for a point mutation in an invariant splice donor site of dihydropyrimine de-

hydrogenase and severe 5-fluorouracil related toxicity. Eur J Cancer 1997;33:2258-2264

15. Fleming RA, Milano GA, Etienne MC, Renee N, Thyss A, Schneider M, Demard F. No effect of dose,

hepatic function, or nutrional status on 5-FU clearance following continuous (5-day) 5-FU infu-

sion. Br J Cancer 1992;66:668-672

16. Ho DH, Townsend L, Luna M and Bodey GP. Distribution and inhibition of dihydrouracil dehy-

drogenase activities in human tissues using 5-fluorouracil as substrate. Anticancer Res 1986;6:

781-784

17. Stephan F, Etienne MC, Wallays C, Milano G and Clergue F. Depressed hepatic dihydropyrimidine

dehydrogenase activity and fluorouracil related toxicities. Am J Med 1995;99:685-688

18. McLeod HL, Sludden J, Hardy SC, Lock RE, Hawksworth GM and Cassidy J. Autoregulation of 5-

fluorouracil metabolism. Eur J Cancer 1998;34:623-1627

19. Lu Z, Zhang R, Carpenter JT and Diasio RB. Decreased dihydropyrimine dehydrogenase activity in

a population of patients with breast cancer: implication for 5-fluorouracil-based chemotherapy.

Clin Cancer Res 1998;4:325-329

20. Johnson MR, Wang K, Tillmanns S, Albin N and Diasio RB. Structural organization of the human

dihydropyrimidine dehydrogenase gene. Cancer Res 1997;57:1660-1663

21. Wei X, McLeod HL, McMurrough J, Gonzalez FJ and Fernandez-Salguero P. Molecular basis of

the human dihydropyrimidine dehydrogenase deficiency and 5-fluorouracil toxicity. J Clin Invest

1996;98:610-615

Dihydropyrimidine dehydrogenase phenotyping in human volunteers and a DPD deficient patient by assessing uracil pharmacokinetics after an oral uracil test dose. A preliminary report

Jan Gerard Maring1, Barbara N. Theeuwes-Oonk1 , André B.P. van Kuilenburg2, Donald R.A.

Uges3, Elisabeth G.E. de Vries4, Geke A.P. Hospers4


Hoogeveen; 2Department of Clinical Chemistry, Academic Medical Center Amsterdam;

Departments of 3Pharmacy and 4Medical Oncology, University Hospital Groningen, The

Netherlands

Chapter 5

102

DPD phenotyping with an oral uracil test dose

103

Health Prevention. NY City. USA 1995.

Chapter 5

102


103

Abstract

Aim Objective To develop an oral Uracil Challenge Test for dihydropyrimidine dehydroge-

nase (DPD) phenotyping in patients scheduled to receive 5-fluorouracil (5-FU).

Methods The pharmacokinetics of uracil and its metabolite 5,6-dihydrouracil (DHU) were

studied after oral administration of an uracil challenge dose in 12 human volunteers and

1 patient with DPD deficiency. All subjects ingested 500 mg/m2 uracil as an oral solution

on an empty stomach. Blood sampling was carried out during 4 h after oral intake. Plasma

uracil and DHU levels were quantified by high performance liquid chromatography. DPD

activity in peripheral blood mononuclear (PBM) cells was measured by the conversion rate

of radiolabeled thymine. The DPD deficiency in the patient was proven by DNA sequenc-

ing of the dihydropyrimidine dehydrogenase gene (DPYD).

Results All volunteers (6 male and 6 female, age 27-53) had DPD activities within normal

range (mean ± SD; 7.0 ± 1.3 nmol/mg/h). The DPD activity in the patient (female, age 72)

was reduced (2.1 nmol/mg/h) due to heterozygosity for missense mutation D949V in

exon 22 and I543V polymorphism in exon 13 of the DPYD gene. All subjects had normal

liver and renal function parameters. Uracil plasma concentrations at 1 and 2 h were 17.20

and 6.94 mg/L in the patient and increased (P<0.05) compared to concentrations (mean

± 2SD) of respectively 8.07 ± 4.78 and 1.74 ± 3.16 mg/L in the volunteers. The AUC was

30.77 mg.h/L in the patient and higher compared to mean 15.72 ± 10.08 mg.h/L in the

volunteers.

Conclusions The clearance of uracil was reduced in the DPD deficient patient. Plasma

levels at 1 and 2 h were discriminating between normal and DPD deficient. The oral Uracil

Challenge Test needs to be further investigated in a larger number of previously charac-

terized, DPD deficient patients to determine its use in pre-chemotherapy DPD-phenotyp-

ing for early detection of DPD deficiency.

Introduction

Fluorouracil (5-FU) is widely used in chemotherapeutic regimens for the treatment of

breast-, colorectal- and head and neck cancer. The cytotoxic mechanism of 5-FU is complex,

requiring intracellular bioconversion of 5-FU into cytotoxic nucleotides. The cytotoxicity,

however, is caused by only a small part of the administered 5-FU dose, as the majority

of 5-FU is rapidly metabolized into inactive metabolites [1]. The initial and rate-limiting

enzyme in the catabolism of 5-FU is dihydropyrimidine dehydrogenase (DPD), catalyzing

a reduction of 5-FU into 5,6-dihydrofluorouracil (DHFU). Unfortunately, in patients with

DPD enzyme deficiency, 5-FU chemotherapy is associated with severe, life-threatening

toxicity [2]. A markedly prolonged elimination half-life of 5-FU has been observed in

patients with partial and complete deficiency of DPD enzyme activity [3,4]. The frequency

Chapter 5

104


105

of DPD deficiency has been estimated to be as high as 1-2% [5,6]. So far, more than 31

mutations in the DPYD gene have been described. The most common mutation is the

IVS14+1G→A splice site mutation, comprising around 40% of all detected mutations in

patients experiencing excessive 5-FU toxicity [7].

Several methods have been proposed for detection of DPD deficiency [7]. High-through-

put DNA sequencing procedures have been developed, but only about 60% of patients

with a deficient phenotype appear to have a molecular basis for their reduced DPD

activity [2, 8-10]. Thus, measuring the DPD activity in pheripheral blood mononuclear cells

is currently considered as “the reference method”, but less suitable for screening of large

sample volumes on a routine basis [7]. Furthermore, the analysis of the uracil/dihydrouracil

ratio in plasma has been suggested as a diagnostic tool, but the sensitivity of this test

remains to be established [11]. Monitoring of 5-FU plasma levels using a limited sampling

strategy may be helpful in early detection of DPD deficiency, but requires rapid analysis

immediately after the first 5-FU administration and is therefore not feasible [4]. Thus, a

cheap, fast, and easy screening method for DPD deficiency is not yet available.

Uracil and 5-FU are chemically almost alike and both substances are substrates for

DPD. Uracil is an endogenous pyrimidine involved in RNA synthesis and, accordingly, an

excellent candidate for DPD phenotyping. Uracil is part of the commercial preparation

UFT®, which contains the 5-FU prodrug tegafur combined with uracil in a molar propor-

tion of 1: 4. Its role in UFT® is to diminish 5-FU catabolism by DPD. To our knowledge a

detailed description of uracil pharmacokinetics has never been published before.

The current preliminary pharmacokinetic study was performed with the aim to develop

an oral Uracil Challenge Test for DPD phenotyping in patients scheduled to receive 5-FU.

The study was performed in human volunteers to assess uracil pharmacokinetics after

oral ingestion. These values were compared to the pharmacokinetic data of uracil in a DPD

deficient patient.

Materials and Methods

Study subjects

Healty human volunteers, aged 18 years and older, and a patient with previously diagnosed

DPD deficiency were asked to participate. Creatinine, ALAT and gamma-GT levels had to

be below 1.5 times the upper limit of normal (ULN), which corresponded to <150 µmol/L

creatinine, < 73 U/L ALT and < 75 U/L gamma GT. Volunteers were not allowed to take any

medication in the week preceding the experiment (an exception was made for oral con-

traceptives). All subjects had to abstain food during the entire experiment. Uracil (purity

>99.9%; Sigma Chemicals Co, Zwijndrecht, The Netherlands) was administered as an oral

solution in a dose of 500 mg/m2 and ingested on an empty stomach (last food intake > 8

h earlier) between 9.00 and 10.00 am. This standardization was introduced to diminish the

Chapter 5

104


105

influence of circadian fluctuations in DPD activity on uracil pharmacokinetics. The study

was approved by the Medical Ethics Review Boards of the Diaconessen Hospital Meppel

and the University Hospital Groningen and written informed consent was obtained from

all subjects.


For pharmacokinetic sampling, a canule was placed intravenously in one arm of the

subject. Blood samples of 5 mL were collected in EDTA containing tubes just before, and

15, 30, 45, 60, 80, 100, 120, 150, 180, and 220 min after uracil ingestion. Collected samples

were immediately placed on ice and subsequently centrifuged at 2,500 g for 10 min at

4 °C and stored at –20 °C analysis. The plasma samples were analyzed for uracil and DHU

concentrations by high-performance liquid chromatography (HPLC) within 1 week after

sample collection.


Uracil and DHU concentrations were measured by HPLC analysis using a modification of

the method described by Ackland et al. [12]. In a plastic Eppendorf microfuge cup 200 µL

of plasma sample was mixed with 100 µL chlorouracil (Sigma Chemical Co, Zwijndrecht,

The Netherlands) solution (80 mg/L) as internal standard. Then 200 µL of acetonitril was

added, followed by vortex mixing. At 11,000 g the samples were centrifuged for 5 min. The

supernatant was transferred into a glass centrifuge tube and 1.5 mL of a 0.1 M phosphate

buffer pH 5.5 was added. After vortex mixing 5 mL ethyl acetate was added and the

samples were mixed for 15 min in a rotary mixer. The samples were then centrifuged at

3,000 g for 5 min. The organic upper layer was transferred into a conical tube and evapo-

rated to dryness under a gentle stream of nitrogen at ambient temperature. The samples

were reconstituted in 100 µL mobile phase and transferred into a glass insert for auto-

sampler vials. 50 µL of sample was injected into the chromatographic system. Calibration

samples were prepared by spiking human heparinized plasma (Red Cross Blood Bank,

Groningen, the Netherlands) with appropriate amounts of

uracil and 5,6-dihydrouracil (Sigma Chemical Co, Zwijndrecht, the Netherlands).

The chromatographic system consisted of a Waters 616 pump equipped with a Waters

717+ autosampler. The separations were performed on an Atlantis dC18 (5 µm, 4.6 x 250

mm) column (Waters, Etten-Leur, the Netherlands), equipped with a Phenomenex C18

(5 µm, 4.0 x 3.0 mm) Security Guard column (Bester, Amstelveen, The Netherlands). The

column was used at ambient temperature. The mobile phase consisted of 990 mL 1.5 mM

phosphate buffer (pH 5.8) mixed with 10 mL of methanol. The flow during the analysis

was 0.8 mL/min. Drug detection was performed using a Waters 996 Photo Diode Array

UV detector interfaced with a Millenium 2010 Chromatography Manager Workstation.

Spectra were acquired in the 201-300 nm range. Uracil was monitored at 266 nm and DHU

at 205 nm. The internal standard chlorouracil was monitored at both wavelengths. The

Chapter 5

106


107

limit of quantification in plasma was 0.04 mg/L for both uracil and DHU.


The pharmacokinetic analyses were performed in both the MW\Pharm (version 3.5, Mediware,

Groningen, The Netherlands) and ADAPT II (version 4.0; University of Southern California, Los

Angeles, CA) packages. Variance for the observations was assumed to be proportional to the

measured values and set at 10%. The area under the curve (AUC 0→220min

) of uracil and DHU

were calculated using the trapezoidal rule. The terminal elimination half-life of DHU was

determined by non-compartimental analysis in MW\Pharm.

Determination of dihydropyrimidine dehydrogenase activity

The activity of DPD was determined in peripheral blood mononuclear (PBM) cells.

PBM cells were isolated from 15 mL EDTA anticoagulated blood and the activity of DPD

was determined according previously described methods [13]. In brief, the sample was

incubated in a reaction mixture containing 35 mM potassium phosphate pH 7.4, 1 mM di-

thiothreitol, 2.5 mM magnesium chloride, 250 µM NADPH and 25 µM [4-14C] thymine. After

an appropriate incubation time, the reaction catalyzed by DPD was terminated by adding

10 % (v/v) perchloric acid. The reaction mixture was centrifuged at 11,000 g for 5 min to

remove protein. The separation of radiolabeled thymine and the reaction products was

performed by reversed phase HPLC.


Subject data were analyzed for descriptive statistics in the SYSTAT 7.0 statistical program

(SPSS inc. 1997). Each value, measured in the DPD deficient patient, was compared to the

mean ± 2 S.D. range of the corresponding parameters in the volunteers control group.

Values outside this range, which comprises 95% of all individuals in a normal distribution,

were considered abnormal (p<0.05).

Results

Patients

Between March 2003 and February 2004, 12 volunteers and 1 DPD deficient patient were

included. All volunteers (6 male and 6 female, age 27-53) had DPD activities within normal

range (mean±SD; 7.0±1.3 nmol/mg/h). The DPD activity in the patient (female, age 72) was

reduced (2.1 nmol/mg/h) due to heterozygosity for missense mutation D949V in exon 22

and I543V polymorphism in exon 13 of the DPYD gene. All subjects had normal liver and

renal function parameters. An overview of patient and volunteers characteristics is repre-

sented in table 1.

Chapter 5

106


107

Pharmacokinetics

The mean pharmacokinetic curves of uracil and DHU are represented in figure 1. The

model, used for calculating uracil and DHU pharmacokinetics was similar to the model that

was previously described for 5-FU pharmacokinetics [14]. A three compartiment model was

applied with absorption from a peripheral (gut) compartiment after bolus administration and

subsequent distribution over a central and deep peripheral compartiment. Michaelis-Menten

elimination was modelled from the central compartiment. The calculated model parameters

Volunteers (n=12) Patient

Age 39 ± 9 72

Sex (male/female) 6/6 female

Weight (kg) 74 ± 10 77

Height (cm) 178 ± 9 170

Body surface area (m2) 1.91 ± 0.16 1.88

PBMC DPD (nmol/mg/h) 7.0 ± 1.3 2.1

Serum-creatinine (µmol/L) 82 ± 12 106

Serum-ALT (U/L) 20 ± 8 23

Serum-gamma-GT (U/L) 16 ± 6 21

Values are depicted as mean ± SD

Tabel 1 Characteristics of human volunteers and the DPD deficient patient, participating in the study.

Figure 1 Mean (± s.d) concentration-time profiles of uracil and DHU in human volunteers (n=12) and the individual concentration-time curves of uracil and DHU in a patient with DPD deficiency after oral intake of 500 mg/m2 uracil solution.

�

�

�

�

�

��

��

��

��

��

��

� ��

��

��

��

��

��

��

��

��

��

��

Chapter 5

108


109

are listed in table 2. The interindividual variation in uracil clearance was considerable,

resulting in uracil AUCs ranging from the lowest to the highest value over a factor 4.

However, despite this variation, the uracil AUC of the DPD deficient patient was still larger

than the mean plus two times the standard deviation AUC value of the reference popula-

tion.

Discussion

This preliminary study shows that low DPD activity, due to a mutation in the DPYD gene,

results in an increased uracil plasma AUC after oral intake of uracil. Current data suggest

that further development of a Uracil Challenge Test is at least warranted. We applied an

uracil dose of 500 mg/m2. Enzyme saturation is a prerequisite for adequate discrimina-

tion between normal and deficient subjects. A comparable dose of 672 mg/m2 uracil is

employed for DPD enzyme saturation in the commercial preparation UFT (in combination

with 300 mg/m2 of the 5-FU analogue tegafur) for treatment of colorectal cancer [15]. Our

uracil dose is also in the range of commonly applied 5-FU bolus doses of 400-600 mg/m2

in the treatment of colorectal and breast cancer [16-19].

The uracil pharmacokinetics was described in a three compartiment Michaelis-Menten

model. Michaelis-Menten pharmacokinetics is characterized by first-order elimination at

low substrate concentrations, and gradually transforms into zero-order elimination when

substrate concentrations rise above levels causing enzyme saturation. This pattern is

distinct in the concentration-time plasma curve of the DPD deficient patient compared to

the mean curve of the volunteers in figure 1. During the first 2 h, the uracil plasma levels

in the DPD deficient patient rise above 2 SD from the mean in volunteers, due to reduced

elimination. After 2 h, plasma levels appear to drop below the enzyme saturation level,

since the terminal elimination half-lifes are almost equal in both groups. As a result, uracil

Volunteers (n=12) Patient

C uracil t=1 h

(mg/L) 8.07 ± 4.78 17.20#

C uracil t=2 h

(mg/L) 1.74 ± 3.16 6.94#

Ratio C uracil/DHU t=1 h

4.44 ± 5.98 8.56

Ratio C uracil/DHU t=2 h

0.69 ± 1.56 2.31#

AUC uracil 0→220 min

(mg.h/L) 15.72 ± 10.08 30.77#

Vmax

(1/h) 815 ± 370 472

T1/2 elimination

(h) 0.42 ± 0.32 0.50

The values are depicted as mean ± 2. SD # outside 95% confidence interval, P<0.05

Table 2. Pharmacokinetic parameters of uracil and DHU in volunteers and the DPD deficient patient.

Chapter 5

108


109

plasma levels at 1 and 2 h are most discriminating between normal and deficient, whereas

later levels are not. Fortunately, early discriminating time points favor the applicability of

a Uracil Challenge Test in clinical practice.

Based on the pharmacokinetic parameters, derived from the Michaelis-Menten model, we

also analyzed whether the sensitivity of the test should improve when higher uracil doses

are administered. Simulations showed that a higher uracil dose might indeed increase

the sensitivity, however also results in a prolonged absorption phase and therefore indi-

rectly leads to a shift in optimal sampling times to later moments. Recently, Mattisson et

al. developed a simple, uracil breath test for DPD phenotyping, based on the release of 13CO

2 from 2-13C uracil in the presence of intact DPD [20]. Expired air was collected 5-90

min after oral ingestion of 6 mg/kg 2-13C uracil. Partially deficient DPD breath profiles were

well differentiated from normal profiles. This approach is very interesting. Unfortunately

2-13C uracil is a very expensive compound, making costs a major drawback for routine

implementation of this test. The price of commercially available 2-13C uracil is about 1 US$

per mg, which implies that a routine test in a 70 kg adult costs at least 420 US$. Addition-

ally, IR spectroscopic breath analyzers are not generally available in most hospitals. The

analysis of a single plasma sample by HPLC after ingestion of normal uracil may be more

cost-efficient, as the price of 1000 mg uracil is only about 1US$. HPLC equipment is also

quite common in most hospitals for therapeutic drug monitoring purposes.

The reduced DPD activity in the patient appeared to be due to heterozygosity for missense

mutation D949V in exon 22 and I543V polymorphism in exon 13 of the DPYD gene. Both

mutations have been observed previously in partially DPD deficient patients and were

both related to increased 5-FU toxicity [2,7,21].

The current method has to be tested in a larger panel of DPD deficient patients, including

deficiencies due to different kinds of gene mutations, to establish the predictive value of

our test.

We conclude that preliminary results of the oral Uracil Challenge Test are very interesting,

but that more research is needed to establish the full potential of this cheap and easy

test.

Chapter 5

110


111

References

1. Pinedo HM, Peters GFJ. Fluorouracil: biochemistry and pharmacology. J Clin Oncol 1988;6:1653-

1664.

2. Van Kuilenburg AB, Haasjes J, Richel DJ, Zoetekouw L, Van Lenthe H, Waterham HR, et al. Clinical

implications of dihydropyrimidine dehydrogenase (DPD) deficiency in patients with severe 5-

fluorouracil-associated toxicity: identification of new mutations in the DPD gene. Clin Cancer Res

2000;6:4705-4712

3. Diasio RB, Beavers TL, Carpenter JT. Familial deficiency of dihydropyrimidine dehydrogenase. Bio-

chemical basis for familial pyrimidinemia and severe 5-fluorouracil-induced toxicity. J Clin Invest

1988;81:47-51

4. Maring JG, van Kuilenburg ABP, Haasjes J, Piersma H, Groen HJM, Uges DRA, et al. Reduced 5-FU


DPYD gene. Br J Cancer 2002;86:1028-103

5. Lu Z, Zhang R, Diasio RB. Dihydropyrimidine dehydrogenase activity in human peripheral blood

mononuclear cells and liver: population characteristics, newly identified deficient patients, and

clinical implication in 5-fluorouracil chemotherapy. Cancer Res 1993;53:5433-5438

6. Etienne MC, Lagrange JL, Dassonville O, Fleming R, Thyss A, Renee N, et al. Population study of

dihydropyrimidine dehydrogenase in cancer patients. J Clin Oncol 1994;12:2248-53

7. Van Kuilenburg ABP. Dihydropyrimidine dehydrogenase and the efficacy and toxicity of 5-fluoro-

uracil. Eur J Cancer 2004;40:939-950

8. Ezzeldin H, Okamoto Y, Johnson MR, Diasio RB. A high-throughput denaturing high-performance

liquid chromatography method for the identification of variant alleles associated with dihydro-

pyrimidine dehydrogenase deficiency. Anal Biochem 2002;306:63-73

9. Fisscher J, Schwab M, Eichelbaum M, Zanger UM. Mutational analysis of the human dihydropy-

rimidine dehydrogenase gene by denaturing high-performance liquid chromatography. Genet

Test 2003;7:97-105

10. Gross E, Seck K, Neubauer S, et al. High throughput genotyping by DHPLC of the dihydropyrimi-

dine dehydrogenase gene implicated in (fluoro)pyrimidine catabolism. Int J Oncol 2003;22:325-

33

11. Gamelin E, Boisdron-Celle M, Guerin-Meyer V, et al. Correlation between uracil and dihydrouracil

plasma ratio, fluorouracil (5-FU) pharmacokinetic parameters, and tolerance in patients with ad-

vanced colorectal cancer: a potential interest for predicting 5-FU toxicity and determining the

optimal 5-FU dosage. J Clin Oncol 1999;17:1105-1110

12. Ackland SP, Garg MB, Dunstan RH. Simultaneous determination of dihydrofluorouracil and 5-

fluorouracil in plasma by high-performance liquid chromatography. Anal Biochem 1997;246:

79-85

13. Van Kuilenburg APB, Van Lenthe H, Tromp A, Veldman PC, Van Gennip AH. Pitfalls in the diagnosis

of patients with partial dihydropyrimidine dehydrogenase deficiency. Clin Chem 2000;46:9-17

14. Maring JG, Piersma H, Van Dalen A, Groen HJM, Uges DRA, De Vries EGE. Extensive hepatic re-

Chapter 5

110


111

placement due to liver metastases has no effect on 5-flourouracil pharmacokinetics. Cancer

Chemother Pharmacol 2003;51:167-173

15. Hoff PM, Pazdur R. UFT plus oral leucovorin: a new oral treatment for colorectal cancer. Oncologist

1998;3:155-164

16. O’Connell MJ. A phase III trial of 5-fluorouracil and leucovorin in the treatment of advanced

colorectal cancer. A Mayo Clinic/North Central Cancer Treatment Group study. Cancer 1989;63:

1026-1030

17. Rothenberg ML, Oza AM, Bigelow RH, Berlin JD, Marshall JL, Ramanathan RK, et al. Superiority of

oxaliplatin and fluorouracil-leucovorin compared with either therapy alone in patients with pro-

gressive colorectal cancer after irinotecan and fluorouracil-leucovorin: interim results of a phase

III trial. J Clin Oncol 2003;21:2059-2069

18. Stewart DJ, Evans WK, Shepard FA, Wilson KS, Pritchard KI, Trudeau MF, et al. Cyclophosphamide

and fluorouracil combined with mitoxantrone versus doxorubicin for breast cancer:superiority

of doxorubicin. J Clin Oncol 1997;15:1897-1905

19. Amadori D, Nanni O, Marangolo M, Pacini P, Ravaioli A, Rossi A, et al. Disease-free survival advan-

tage of adjuvant cyclophosphamide, methotrexate, and fluorouracil in patients with node-nega-

tive, rapidly proliferating breast cancer: a randomized multicenter study. J Clin Oncol 2000;18:

3125-3134

20. Mattison LK, Ezzeldin H, Carpenter M, Modak A, Johnson MR, Diasio RB. Rapid identification of

dihydropyrimidine dehydrogenase deficiency by using a novel 2-13C-uracil breath test. Clin

Cancer Res 2004;10:2652-2658

21. Van Kuilenburg AB, De Abreu RA, van Gennip AH. Pharmacogenetic and clinical aspects of dihy-

dropyrimidine dehydrogenase deficiency. Ann Clin Biochem 2003;40:41-45

Focus on gemcitabine

Selective targeting of homologous DNA recombi-nation repair by Gemcitabine.

Floris M. Wachters1, John W.G. van Putten1, Jan Gerard Maring2, Malgorzata Z. Zdzienicka3,

Harry J.M. Groen1, Harm H. Kampinga4

1Department of Pulmonary Diseases, University Hospital Groningen; 2Department of

Pharmacy, Diaconessenhuis Meppel and Bethesda Hospital Hoogeveen; 3Department

of Toxicogenetics, Leiden University Medical Center and Ludwik Rydygier University of

Medical Sciences, Bydgoszcz, Poland, 4Department of Radiation and Stress Cell Biology,

University of Groningen, The Netherlands

Int J Radiat Oncol Biol Phys 2003;57:553-562

Chapter 6

116

Selective targeting of HR-DNA repair by gemcitabine

117

Radiation Imaging. Westerbork. The Netherlands 1996.

Chapter 6

116


117

Abstract

Aim Gemcitabine (2’,2’-difluoro-2’-deoxycytidine, dFdC) is a potent radiosensitizer. The

mechanism of dFdC-mediated radiosensitization is yet poorly understood. We recently

excluded inhibition of DNA double-strand break (DSB) repair by nonhomologous end-

joining (NHEJ) as a means of radiosensitization. In the current study, we addressed the

possibility that dFdC might affect homologous recombination (HR)-mediated DSB repair

or base excision repair (BER).

Methods dFdC-mediated radiosensitization in cell lines deficient in BER and in HR was

compared to that in their BER-proficient and HR-proficient parental counterparts. Sensiti-

zation to mitomycine C (MMC) was also investigated in cell lines deficient and proficient in

HR. Additionally, the effect of dFdC on Rad51 foci formation after irradiation was studied.

Results dFdC did induce radiosensitization in BER-deficient cells; however, the respective

mutant cells deficient in HR did not show dFdC-mediated radiosensitization. In HR-pro-

ficient, but not in HR-deficient cells dFdC also induced substantial enhancement of the

cytotoxic effect of MMC. Finally, we found that dFdC interferes with Rad51 foci formation

after irradiation.

Conclusion dFdC causes radiosensitization by specific interference with HR.

Introduction

Gemcitabine (2’,2’-difluoro-2’-deoxycytidine, dFdC) is a deoxycytidine analogue with anti-

tumor activity in different tumor types. It is also one of the more effective drugs to sensitize

cells to radiation, an effect that has been demonstrated in vitro under non-cytotoxic

conditions for human tumor cell lines [1, 2] and in vivo in tumor-bearing mice [3, 4]. The

interaction of dFdC and radiation has not been elucidated yet. It has been shown that

dFdC enhances radiation-induced chromosomal aberrations [5], which suggests that it

interferes with the repair of radiation-induced DNA damage, particularly the repair of DNA

double-strand breaks (DSBs). Nonhomologous end-joining (NHEJ) is the most prominent

cellular DNA repair pathway of radiation-induced DNA DSBs in mammals [6]. In recent

experiments, however we have shown that the NHEJ pathway is not the target for dFdC-

mediated radiosensitization because a radiosensitizing effect of dFdC is also observed in

cells lacking the functional parts of the NHEJ pathway e.g., the DNA-dependent protein

kinase catalytic subunit (DNA-PKcs) or Ku80 [7]. It has been suggested that a decline in

deoxyadenosine triphosphate is crucial in the induction of radiosensitization by dFdC [1,

8]. If correct, this would be consistent with the noninvolvement of a short-patch repair

pathway like NHEJ. Rather long-patch repair pathways such as nucleotide excision repair

or homologous recombination (HR) may be involved in dFdC-induced radiosensitization.

Indeed, data suggest that dFdC can interfere with nucleotide excision repair [9]. However,

Chapter 6

118


119

because nucleotide excision repair plays no (major) role in the repair of ionizing radiation-

induced DNA damage, the most likely pathway remaining as a target for dFdC-mediated

radiosensitization would be HR.

However, whereas HR plays a major role in DNA DSB repair in yeast, its role in higher eu-

karyotes is less clear. The irs1 and irs1SF hamster cell lines deficient in HR due to mutations

in respectively the Rad51 homologues XRCC2 (X-ray repair cross complementing group

2) and XRCC3 show increased radiosensitivity [10-18]. Also in Drosophila melanogaster,

HR-deficiency (Rad54 homolog DmRad54) leads to increased radiosensitivity. In a HR

and NHEJ double mutant (DmRad54 and DmKu70) a strong synergistic increase in radio-

sensitivity is observed compared to both single mutants [19]. Adult mice deficient in HR,

however, do not show hypersensitivity to ionizing radiation, and the impact of HR-defi-

ciency only becomes apparent in a NHEJ-deficient background [20, 21]. Radiosensitivity

testing of embryonic stem cells from HR-deficient mice reveals moderate sensitivity [21].

So, although NHEJ may be the dominant pathway to repair radiation-induced DSB in

higher eukaryotes, HR does play a role under certain conditions.

From these data, a picture emerges that HR plays only a minor role in the repair of DSBs

in maturated, differentiated cells. In undifferentiated cells or cells in culture, however, HR

may contribute to DSB repair and hence to cellular radiosensitivity and herein it could be a

target for dFdC-mediated radiosensitization. An alternative target could be base excision

repair (BER). This repair pathway is also crucial for the repair of DNA damage induced by

ionizing radiation [22, 23] and BER-mutants like the XRCC1 mutant Chinese hamster ovary

cell line EM-C11 show an increased sensitivity to radiation and mitomycin C (MMC) [24,

25]. However, BER is thought to be a short patch repair pathway and can be expected to

be insensitive to a dFdC-mediated drop in nucleotide level. Hence, it seems an unlikely

target for dFdC-mediated radiosensitization; however, this has not been established ex-

perimentally.

In the current study, we therefore tested the possibility that dFdC-mediated radiosensi-

tization may be due to interference of dFdC with the BER or HR pathway, using BER- and

HR-deficient cell lines and assessment of radiation-induced Rad51 foci formation.

Methods and Materials

Cell culturing procedures

The rodent cell lines were grown as monolayers at 5% CO2 in a humidified 37 °C incubator

in plastic flasks (Nunc, Roskilde, Denmark). The Chinese hamster cell lines CHO-9 (parental

cell line of EM-C11), AA8 (parental cell line of irs1SF), irs1 (XRCC2-deficient mutant) and

irs1SF (XRCC3-deficient mutant) were grown on Ham’s F12 medium (Gibco, Paisley, UK).

The EM-C11 cell line (XRCC1-deficient mutant) was grown on Ham’s F10 medium (Gibco,

Paisley, UK). The V79 cell line (parental cell line of irs1) was maintained in Dulbecco’s modi-

Chapter 6

118


119

fication of Eagle’s medium (Gibco, Paisley, UK). All media were supplemented with 10%

bovine calf serum (Gibco, Paisley, UK). Media of CHO-9, EM-C11, AA8, irs1 and irs1SF cells

were also supplemented with penicillin and streptomycin. All our standard laboratory

chemicals were purchased from Sigma (St Louis, MO) or Merck (Darmstadt, Germany).

Treatment of cells

Exponentially growing cells were incubated with 0.5 and 5 µM Gemcitabine (dFdC; Eli

Lilly, Nieuwegein, the Netherlands) for 4 h. We choose such short incubation time to avoid

major effects on cell cycle distributions. By DNA flow cytometric analysis we previously

found no significant alterations in cell cycle distribution of CHO-K1 and xrs5+huKu80

cells after 4 h incubation with dFdC [7]. Shewach and Lawrence found that the effect of

gemcitabine on the viability of HT-29 cell was highly dependent on the length of incuba-

tion [8]. Minimizing the cytotoxic effect of dFdC was another argument for choosing a

short incubation period. After dFdC-treatment cells were trypsinized, and diluted in fresh

complete medium to a density of 106 cells/mL. Cells were irradiated, using a 137Cs γ-ray

machine (IBL 637; CIS Biointernational, Gif-sur-Yvette, France) at a dose rate of 0.9 Gy/min.

The dosimetry was performed with an ionization chamber (Philips 37489/19; Eindhoven,

the Netherlands) calibrated with a 90Sr source (Philips 2011/00).

For experiments with dFdC and mitomycin C (MMC; Christiaens, Breda, the Netherlands)

cells were first incubated with 5 µM dFdC for 4 h. After centrifugation of the medium (5

min, 1000 rpm) the cell pellet was added to the cell culture flask. Thereafter cells were

incubated with MMC in different concentrations for 1 h. Cells were subsequently tryp-

sinized and the removed medium was centrifuged (5 min, 1000 rpm). The remaining cell

pellet was added to the trypsinized cells. Cell suspensions were diluted in fresh complete

medium to a density of 106 cells/mL.

To study the effects of hyperthermia, growing cells were trypsinized and diluted with

fresh complete medium to a density of 106 cells/mL. Thereafter cells were exposed to

hyperthermia (43 oC) in precision waterbaths (± 0.1°C) for 30 min immediately followed

by irradiation.

Cell survival

Cell survival was assessed with clonogenic assay by plating 100 µl of an appropriately

diluted sample to triplicate plastic Petri dishes (Nunc, Roskilde, Denmark), containing 5 mL

of growth medium. After 6-8 days of incubation, colonies (containing >50 cells) were fixed

with 70% ethanol and stained with 0.5% crystal violet.

dFdCTP determination by high-performance liquid chromatography (HPLC). For determi-

nation of 2’,2’-difluoro-2’-deoxycytidine triphosphate (dFdCTP) concentrations, exponen-

tially growing cells were incubated with 5 µM dFdC for 4 h. After trypsinization cells were

twice washed with phosphate-buffered saline (PBS; Gibco, Paisley, UK), centrifuged and

Chapter 6

120


121

resuspended in 100 µl water, 50 µl of 50% trichloroacetic acid, and 50 µl of 1 µM internal

standard solution of inosine-5’-triphosphate. Cells were chilled on ice for 20 min and cen-

trifuged for 3 min at 10,000 g and 500 µl of freshly prepared trioctylamine and 1,1,2-trichlo-

rotrifluoroethane (1:4) was added. After centrifugation for 2 min at 10,000 g, the cellular

dFdCTP concentrations in the supernatant were determined by anion-exchange HPLC

analysis (Waters, Milford, MA) using a Partisphere SAX anion exchange column (internal

diameter 125 x 4.6 mm, particle size 5 µm; Whatman, Maidstone, UK). A linear gradient was

running from 100% buffer A (5 mM NH4H

2PO

4, pH 2.80) to 100% buffer B (0.5 M NH

4H

2PO

4

and 0.25 M KCl, pH 3.00) in 40 min with a flow of 2 mL/min. Re-equilibration to 100%

buffer A was achieved in 20 min. Calibration was performed with 2-20 µM dFdCTP (Eli Lilly,

Nieuwegein, the Netherlands). Detection was performed using a model 996 photograph-

diode array detector (Waters, Milford, MA) at 266 nm. Cellular dFdCTP concentrations were

calculated using the ratio peak-area dFdCTP versus peak-area internal standard.

Rad51 foci formation

Cells grown on coverslips were incubated with 5 µM dFdC for 4 h at 37 oC. To induce DNA

DSBs, cells were exposed to a dose of 10 Gy. Because Raderschall et al. found a dose-

dependent relation of Rad51 foci formation between 0.5 – 10 Gy [26], we used 10 Gy to

induce Rad51 foci in a high percentage of cells. At different time intervals after irradiation

cells were fixed using 3.7% formaldehyde solution and washed with 0.2% Triton-X100,

glycine-PBS (50 mM glycine in PBS) and PBG (0.5% bovine serum albumin and 0.1%

glycine in PBS). Subsequently, cells were incubated with a rabbit polyclonal antibody

against Rad51 (H-92; Santa Cruz Biotechnology) at a concentration of 4 µg/mL for 2 h

and with fluorescein isothiocyanate (FITC)-conjugated swine anti-rabbit immunoglobu-

lins (Dako, Glostrup, Denmark) at a concentration of 24 µg/mL for 1 h. After washing with

0.1% Tween-20 and incubation with 2 µg/mL 4’,6-diamidino-2-phenylindole (DAPI) for 10

min, samples were analyzed with a laser scanning confocal microscope (Leica microsys-

tems, Rijswijk, the Netherlands). For analysis, 6 to 10 slices made through cell nuclei were

compressed into one overlay projection. When two or more foci were observed, cells were

scored as positive.

Results

Radiosensitization by dFdC in cells proficient and deficient in BER

The XRCC1 mutant EM-C11 is partially defective in the ligation step of BER [25]. Consis-

tent with other experiments [24] we found this cell line to be hyperradiosensitive (Fig

1A). Like its parental CHO-9 cell line, also the EM-C11 cells could be clearly radiosensitized

when pretreated with dFdC (Fig. 1, C and D). However, it should be mentioned that the

magnitude of the enhancement was somewhat less in the EM-C11 cells compared to the

Chapter 6

120


121

CHO-9 cells. This may be explained, though, by the fact that the EM-C11 cells also appeared

less sensitive to the direct toxic action of dFdC (figure 1B). In any case, our data suggest

that full BER-proficiency is not a prerequisite for radiosensitization by dFdC.

��

�

��

��

� � � �

��

��

��

��

��

�

��

��

� � � �

��

��

��

��

��

��

��

�

�

�

�

��

��

��

��

��

��

��

�

��

��

� � � �

��

��

��

��

��

�

��

��

� � � �

��

��

��

��

��

��

��

��

Figure 1 Comparison of the effect of dFdC on radiosensitivity of the parental CHO-9 cell line and the BER-deficient cell line EM-C11. Cells (106/mL) were exposed to radiation with or without a 4-h preincubation with either 0.5 or 5 µM dFdC. Cell survival was assessed with clonogenic assay. Each point represents mean and standard error of three experiments. A Comparison of radiosensitivity of the parental CHO-9 ( ) cell line, and the EM-C11 ( ) cell line (mutated for the XRCC1 gene and therefore deficient in BER). B Cytotoxic effect of 0.5 and 5 µM dFdC on the CHO-9 ( ) and EM-C11 ( ) cell lines. C, D Effect of preincubation without ( ) or with either 0.5 ( ) or 5 µM ( ) dFdC on radiosensitivity of the BER-proficient CHO-9 C cell line or on the BER-deficient EM-C11 D cell line.

Chapter 6

122


123

� �

��

� �

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

�

��

��

� � � �

��

��

��

��

��

�

��

��

� � � �

��

��

��

��

�

��

��

� � � �

��

��

��

��

��

�

��

��

� � � �

��

��

��

��

��

�

��

��

� � � �

��

��

��

��

��

�

��

��

� � � �

��

��

��

��

Figure 2 see next page for legenda

Chapter 6

122


123

Radiosensitization by dFdC in cells proficient and deficient in HR

Irs1 and irs1SF cell lines are mutated for, respectively, the Rad51 homologues XRCC2

and XRCC3 and therefore deficient in HR, which explains their increased radiosensitivity

compared to the wild-type parental cell lines V79 and AA8 [11-18] (Fig. 2A). The cytotoxic

effect of dFdC (no irradiation) was similar in all cell lines (Fig. 2B). However, whereas V79

and AA8 cells showed clear-cut radiosensitization when pretreated with 0.5 or 5 µM dFdC

for 4 h (Figs. 2C and 2E), dFdC cause no radiosensitization in either HR-deficient cell line

(Figs. 2D and 2F). To exclude the possibility that the HR-deficient cell lines were affected

in metabolizing dFdC, cellular levels of dFdCTP, the major intracellular metabolite of

dFdC [27], were determined. HR-proficient (V79 and AA8) as well as HR-deficient (irs1

and irs1SF) cell lines were both able to phosphorylate dFdC to dFdCTP (Table 1). Only

irs1 showed a decreased dFdCTP level compared to the other three cell lines tested. Still,

a substantial amount of dFdCTP was found in irs1, yet dFdC-mediated radiosensitization

was completely absent in these cells. Moreover, dFdCTP concentrations in irs1SF cells

were comparable with dFdCTP concentrations in HR-proficient cell lines, and also in this

cell line no radiosensitization was observed. Therefore, defects in drug accumulation and

metabolism are not expected to be responsible for the absence of radiosensitization by

dFdC in HR-deficient cells. In fact, the absence of dFdC-mediated radiosensitization in two

independent HR-deficient cell lines clearly shows that HR may exert its radiosensitizing

effect through interference with the process of HR.

Figure 2 (opposite page) Effect of dFdC on radiosensitivity of the parental V79 and AA8 cell lines and their HR-deficient counterparts (irs1 and irs1SF). Cells (106/mL) were exposed to radiation with or with-out a 4-h preincubation with either 0.5 or 5 µM dFdC. Cell survival was assessed with clonogenic assay. Each point represents mean and standard error of four experiments. A Comparison of radiosensitivity of the V79 ( ) and AA8 ( ) cell lines, and the irs1 ( ) and irs1SF ( ) cell lines (respectively mutated for the XRCC2 and XRCC3 genes and therefore deficient in HR). B Plotted are the cytotoxic effect before irradiation (represented by percentage survival) and the concentration of dFdC for the V79 ( ), AA8 ( ), irs1 ( ) and irs1SF ( ) cell lines. C-F Effect of preincubation without ( ) or with either 0.5 ( ) or 5 µM ( ) dFdC on radiosensitivity of the HR-proficient V79 C and AA8 E cell lines or on the HR-deficient irs1 D and irs1SF F cell lines.

Cell lines dFdCTP p†

V79 2.37 ± 0.30

Irs1 1.46 ± 0.03 0.050

AA8 2.60 ± 0.31

Irs1SF 2.44 ± 0.46 0.513

*dFdCTP concentration per 106 cells in µM. Data are the mean (± SE) of at least 3 individual experiments. (HR = homologous recombination). †Differences between HR-proficient and HR-deficient cell lines were tested by the Mann-Whitney test (two sided).

Table 1 DFdCTP concentrations in cell lines proficient and deficient in HR*

Chapter 6

124


125

��

��

��

�

� �

�

��

��

��

��

��

��

��

��

��

��

��

��

��

��

�

��

��

� ��

��

��

��

��

� ��

��

�

��

��

� ��

��

��

��

��

� ��

�

��

�

��

��

� ��

��

��

��

��

��

��

�

��

��

� ��

��

��

��

��

��

��

�

��

��

� ��

��

��

��

��

� ��

Figure 3 see next page for legenda

Chapter 6

124


125

MMC-sensitization by dFdC in cells proficient and deficient in HR

To further substantiate that HR interferes with the process of HR, we next investigated

whether dFdC can cause sensitization to MMC in a manner depending on HR proficiency.

MMC introduces DNA DSBs by interstrand cross-links in DNA. Repair of MMC-induced

interstrand cross-links is especially dependent on HR [28]. This is also illustrated by the

extreme sensitivity to MMC of the HR-deficient irs1 and irs1SF cells (Fig. 3A) [12, 29]. In V79

and AA8 cells, dFdC before treatment with MMC induced significant sensitization to MMC

(Figs. 3B and 3D). In contrast, irs1 and irs1SF cells did not show sensitization to MMC when

pretreated with dFdC (Figs. 3C and 3E). These data further support our suggestion that the

HR pathway is targeted by dFdC.

HR-deficient cells can be radiosensitized by hyperthermia

In order to demonstrate that HR-deficient cells are not in general unable to respond to

radiosensitizers, we pretreated cells with hyperthermia, a potent radiosensitizer, likely

through effects on BER [30]. V79 and AA8 cells as well as irs1 and irs1SF cells were equally

sensitized when exposed to hyperthermia (43 oC) prior to irradiation (Fig. 4). These data

demonstrate that irs1 and irs1SF cells can be radiosensitized by means other than dFdC,

via effects on repair pathways other than HR. They also support the idea that HR is not a

target for heat-induced radiosensitization in accordance with earlier suggestions [30].

Rad51 foci formation after irradiation and dFdC

Next, we tested the effect of dFdC on the radiation-induced formation of Rad51 foci which

are thought to represent sites of HR [31, 32]. In nontreated, cultured mammalian cells, the

Rad51 protein is detected by immunofluorescent antibodies in a small number of discrete

foci in the nucleoplasm of a small fraction of cells [26, 33]. After DNA damage the number

of foci as well as the percentage of cells with focally concentrated Rad51 protein increases

in a time- and dose-dependent manner, suggesting activation of HR [26]. In experiments

by Haaf et al. [33] the highest number of nuclei showing Rad51 foci and the strongest im-

munofluorescence was observed starting from 3 h after irradiation with doses above 3 Gy.

In this study an obvious relation between irradiation-dose and foci formation was found

6 h after irradiation [33].

We found that untreated V79 cells showed a normal pattern of small Rad51 foci scattered

Figure 3 (opposite page) Effect of dFdC on sensitivity to MMC of the parental V79 and AA8 cell lines as compared with cell lines deficient in HR (irs1 and irs1SF). Cells (106/mL) were exposed to graded doses of MMC with ( ) or without ( ) a 4-h preincubation with 5 µM dFdC. Cell survival was assessed with clonogenic assay. Each point represents mean and standard error of three experiments. A Com-parison of the MMC-sensitivity of V79 ( ) and AA8 ( ) cell lines, and the irs1 ( ) and irs1SF ( ) cell lines (respectively mutated for the XRCC2 and XRCC3 genes and therefore deficient in HR). B-E Effect of dFdC on sensitivity to MMC of the HR-proficient V79 B and AA8 D cell lines or on the HR-deficient irs1 C and irs1SF E cell lines.

Chapter 6

126


127

in the nucleus (Fig. 5A). In 14% of these cells foci were observed. Positively scored cells

(two or more foci per cell) generally contained less then 5 foci per cell. Irradiation (10 Gy)

induced formation of multiple small Rad51 foci within 3 h after irradiation in about 70%

of the cells (Fig. 5B), which subsequently condensed into large and bulky conglomerates

in about 67% of the cells (observed 6 h after irradiation). About 16% of the cells contained

only small foci 6 h after irradiation (Fig. 5C). These data are consistent with other reports

on Rad51 foci formation [26, 29]. Incubation with dFdC alone induced an increase in

Rad51 foci positive cells (small foci in about 51% of the cells) compared to untreated cells

A

C

B

D

��

��

��

��

��

��

��

�

��

��

� � � �

��

�

��

��

�

��

��

� � � �

��

�

��

��

�

��

��

� � � �

��

�

��

��

�

��

��

� � � �

��

�

��

Figure 4 Effect of hyperthermia on radiosensitivity of the parental V79 and AA8 cell lines as compared with cell lines deficient in HR (irs1 and irs1SF). Cells (106/mL) were exposed to radiation with ( ) or with-out ( ) prior treatment with hyperthermia (30 min, 43oC). Cell survival was assessed with clonogenic assay. Each point represents mean and standard error of three experiments. In all cell lines radiosensiti-vity is increased by hyperthermia.

Chapter 6

126


127

(Fig. 5D). At 3 h after irradiation small foci were observed in about 59% of V79 cells pre-

treated with 5 µM dFdC (Fig. 5E). However, at 6 h after irradiation reduced maturation into

large foci was observed in dFdC-pretreated cells, whereas 59% of these cells contained

a multitude of small foci and only 10% contained large and bulky conglomerates (Fig.

5F). These data indicate that dFdC indeed affects the HR and support our data that dFdC

causes radiosensitization by targeting the pathway.

Rad51 foci formation was also assessed in the XRCC2 deficient, irs1 cells. Consistent with

experiments of O’Regan et al. [29], we found little foci formation both before and after irra-

diation in these cells consistent with their HR deficiency and consistent with the absence

of an effect of dFdC on the radiosensitivity of these cells (data not shown).

Figure 5 Effect of dFdC on radiation-induced Rad51 foci formation. V79 cells were incubated with or without 5 µM dFdC for 4 h prior to either immediate fixation or irradiation (10 Gy) followed by fixation after a 3-h or 6-h incubation period. Subsequently cells were successively incubated with a rabbit polyclonal antibody against Rad51, FITC-conjugated swine anti-rabbit immunoglobulins and DAPI. Shown are overlay projections of the FITC- and DAPI-signal made by a confocal laser microscope. The pictures represent a typical pattern of Rad51 foci in the nuclei of V79 cells. A Immunofluorescent visualization of Rad51 foci formation in nuclei of control cells. B) Rad51 foci formation in cells fixated 3 h after irradiation. C Rad51 foci formation in cells fixated 6 h after irradiation. D Rad51 foci formation after a 4 h incubation period with dFdC. E Rad51 foci formation in cells after a 4-h pre-incubation with dFdC, followed by irradiation and 3 h time of repair before fixation. F Rad51 foci formation in cells after a 4-h pre-incubation with dFdC, followed by irradiation and 6 h time of repair before fixation.

Chapter 6

128


129

Discussion

Our data reveal that sensitization to radiation and MMC by dFdC did not occur in cells

mutated in the XRCC2 and XRCC3 genes, associated with a defective DNA DSB repair by

HR [11]. This implicates that a functional HR pathway is essential to cause dFdC-mediated

radiosensitization. This is supported by the observation that dFdC interferes with the

formation of Rad51 foci in HR-proficient cells, strongly indicating that HR is a target for

dFdC-mediated sensitization to ionizing radiation. In contrast, it was found that BER pro-

ficiency is not required for dFdC-mediated radiosensitization, because cells defective in

XRCC1 could be radiosensitized by the drug. One must realize though that BER consists of

several parallel, partially overlapping and likely redundant pathways [34]. Hence, it cannot

be totally ruled out that other non-XRCC1 dependent pathways are not affected by dFdC.

If relevant to the radiosensitizing effect of dFdC, however, this should also have caused

sensitization in the HR-deficient cells, which was not the case. Moreover, this would also

not be consistent with the cell cycle specificity of the dFdC radiosensitization effect (see

also below).

Previously, we already excluded NHEJ as being a target for dFdC, because the radiosen-

sitizing effect of dFdC was also observed in cells lacking either functional DNA-PKcs or

Ku80 [7]. In fact, the extent of dFdC-mediated radiosensitization was even larger in the

NHEJ-deficient mutants. This is quite intriguing given the fact that the relative impact of

HR-deficiency on radiosensitivity is larger when NHEJ is also defective as demonstrated

by Essers et al. [21]. In the latter studies mRad54-/- HR-deficient adult mice were only

hypersensitive to ionizing radiation in a NHEJ-deficient background. In other words, the

relative importance of HR in radiosensitivity is greater when the cells lack functional NHEJ.

Therefore, our previous findings that dFdC-effects on radiosensitivity are larger in NHEJ-

deficient cells further substantiate our hypothesis that dFdC targets HR. Lastly, support for

this hypothesis also comes from data from Latz et al. [35] showing that the extent of dFdC-

induced radiosensitization is higher in late S phase than in G1 and early S phase. Studies

with the Rad54-/-/Ku70-/- double knockout from the chicken B-cell line DT40 revealed that,

whereas NHEJ is more important for repairing radiation-induced DNA-DSBs during G1 and

early S phase, HR is preferentially used in late S and G2 phases of the cell cycle [36]. Based

on all these observations we conclude that the target for radiosensitization induced by

dFdC is HR.

It is yet unclear which step in the pathway of HR is inhibited. Our data on Rad51 foci

suggest that dFdC induces inhibition of maturation into larger foci. In fact, at 6 h after

irradiation we see more, albeit smaller foci in cells treated with dFdC. One possible expla-

nation for this observation is that dFdC interferes with the DNA polymerization step in

HR, thereby halting the process. However, this has yet to be established experimentally,

for example, by live-recording experiments using green fluorescent protein tagged Rad51

expressing cells [37].

Chapter 6

128


129

The specificity of dFdC to target HR, but not BER or NHEJ [7] may be of important clinical

relevance. As was demonstrated by Essers et al. [21], HR-deficient mice are hypersensitive

to ionizing radiation at the embryonic but not at the adult stage. Thus, whereas a defect

in HR may affect the radiosensitivity of undifferentiated embryonic stem cells [20] and

cultured cell lines [10-18, 36], its impact on the radiosensitivity of differentiated adult

cells in vivo might be limited or even absent. One could therefore speculate that the ra-

diosensitizing effect of dFdC in patients might be less in normal healthy tissue and more

restricted to (undifferentiated) tumor cells, making it a tumor-selective radiosensitizer.

Our data therefore support further trials to evaluate the clinical usefulness of dFdC in

combination with radiation.

Acknowledgements

We thank P.A. Jeggo (University of Sussex, Brighton, UK) for providing the AA8 and irs1 cell

lines, B. Kanon (University of Groningen, the Netherlands) for his help with the survival

experiments, and J.M. Maurer (University of Groningen, the Netherlands) for the determi-

nation of dFdCTP by HPLC.

Chapter 6

130


131

References

1. Shewach DS, Hahn TM, Chang E, et al. Metabolism of 2’,2’-difluoro-2’-deoxycytidine and radiation

sensitization of human colon carcinoma cells. Cancer Res 1994;54:3218-3223.

2. Lawrence TS, Chang EY, Hahn TM, et al. Radiosensitization of pancreatic cancer cells by 2’,2’-

difluoro-2’-deoxycytidine. Int J Radiat Oncol Biol Phys 1996;34:867-872.

3. Joschko MA, Webster LK, Groves J, et al. Enhancement of radiation-induced regrowth delay by

gemcitabine in a human tumor xenograft model. Radiat Oncol Investig 1997;5:62-71.

4. Milas L, Fujii T, Hunter N, et al. Enhancement of tumor radioresponse in vivo by gemcitabine. Can-

cer Res 1999;59:107-114.

5. Gregoire V, Hittelman WN, Rosier JF, et al. Chemo-radiotherapy: radiosensitizing nucleoside ana-

logues (review). Oncol Rep 1999;6:949-957.

6. Zdzienicka MZ. Molecular processes and radiosensitivity. Strahlenther Onkol 1997;173:457-461.

7. Van Putten JWG, Groen HJM, Smid K, et al. End-joining deficiency and radiosensitization induced

by gemcitabine. Cancer Res 2001;61:1585-1591.

8. Shewach DS, Lawrence TS. Radiosensitization of human tumor cells by gemcitabine in vitro.

Semin Oncol 1995;22:68-71.

9. Yang LY, Li L, Jiang H, et al. Expression of ERCC1 antisense RNA abrogates gemicitabine-mediated

cytotoxic synergism with cisplatin in human colon tumor cells defective in mismatch repair but

proficient in nucleotide excision repair. Clin Cancer Res 2000;6:773-781.

10. Asaad NA, Zeng ZC, Guan J, et al. Homologous recombination as a potential target for caffeine

radiosensitization in mammalian cells: reduced caffeine radiosensitization in XRCC2 and XRCC3

mutants. Oncogene 2000;19:5788-5800.

11. Cui X, Brenneman M, Meyne J, et al. The XRCC2 and XRCC3 repair genes are required for chromo-

some stability in mammalian cells. Mutat Res 1999;434:75-88.

12. Liu N, Lamerdin JE, Tebbs RS, et al. XRCC2 and XRCC3, new human Rad51-family members, pro-

mote chromosome stability and protect against DNA cross-links and other damages. Mol Cell

1998;1:783-793.

13. Jones NJ, Cox R, Thacker J. Isolation and cross-sensitivity of X-ray-sensitive mutants of V79-4 ham-

ster cells. Mutat Res 1987;183:279-286.

14. Cartwright R, Tambini CE, Simpson PJ, et al. The XRCC2 DNA repair gene from human and mouse

encodes a novel member of the recA/RAD51 family. Nucleic Acids Res 1998;26:3084-3089.

15. Tambini CE, George AM, Rommens JM, et al. The XRCC2 DNA repair gene: Identification of a posi-

tional candidate. Genomics 1997;41:84-92.

16. Johnson RD, Liu N, Jasin M. Mammalian XRCC2 promotes the repair of DNA double-strand breaks

by homologous recombination. Nature 1999;401:397-399.

17. Fuller LF, Painter RB. A Chinese hamster ovary cell line hypersensitive to ionizing radiation and

deficient in repair replication. Mutat Res 1988;193:109-121.

18. Pierce AJ, Johnson RD, Thompson LH, et al. XRCC3 promotes homology-directed repair of DNA

damage in mammalian cells. Genes Dev 1999;13:2633-2638.

Chapter 6

130


131

19. Kooistra R, Pastink A, Zonneveld JB, et al. The Drosophila melanogaster DmRAD54 gene plays a

crucial role in double-strand break repair after P-element excision and acts synergistically with

Ku70 in the repair of X-ray damage. Mol Cell Biol 1999;19:6269-6275.

20. Essers J, Hendriks RW, Swagemakers SM, et al. Disruption of mouse RAD54 reduces ionizing radia-

tion resistance and homologous recombination. Cell 1997;89:195-204.

21. Essers J, Van Steeg H, De Wit J, et al. Homologous and non-homologous recombination differen-

tially affect DNA damage repair in mice. EMBO J 2000;19:1703-1710.

22. Wallace SS. DNA damages processed by base excision repair: biological consequences. Int J Ra-

diat Biol 1994;66:579-589.

23. Wallace SS. Enzymatic processing of radiation-induced free radical damage in DNA. Radiat Res

1998;150:S60 -S79.

24. Zdzienicka MZ, Van der Schans GP, Natarajan AT, et al. A Chinese hamster ovary cell mutant

(EM-C11) with sensitivity to simple alkylating agents and a very high level of sister chromatid

exchanges. Mutagenesis 1992;7:265-269.

25. Cappelli E, Taylor R, Cevasco M, et al. Involvement of XRCC1 and DNA ligase III gene products in

DNA base excision repair. J Biol Chem 1997;272:23970-23975.

26. Raderschall E, Golub EI, Haaf T. Nuclear foci of mammalian recombination proteins are located at

single-stranded DNA regions formed after DNA damage. Proc Natl Acad Sci USA 1999;96:1921-

1926.

27. Heinemann V, Hertel LW, Grindey GB, et al. Comparison of the cellular pharmacokinetics and tox-

icity of 2’,2’-difluorodeoxycytidine and 1-beta-D-arabinofuranosylcytosine. Cancer Res 1988;48:

4024-4031.

28. De Silva IU, McHugh PJ, Clingen PH, et al. Defining the roles of nucleotide excision repair and

recombination in the repair of DNA interstrand cross-links in mammalian cells. Mol Cell Biol

2000;20:7980-7990.

29. O’Regan P, Wilson C, Townsend S, et al. XRCC2 is a nuclear RAD51-like protein required for dam-

age-dependent RAD51 focus formation without the need for ATP binding. J Biol Chem 2001;276:

22148-22153.

30. Kampinga HH, Dikomey E. Hyperthermic radiosensitization: mode of action and clinical rel-

evance. Int J Radiat Biol 2001;77:399-408.

31. Tashiro S, Walter J, Shinohara A, et al. Rad51 accumulation at sites of DNA damage and in postrep-

licative chromatin. J Cell Biol 2000;150:283-291.

32. Wang ZM, Chen ZP, Xu ZY, et al. In vitro evidence for homologous recombinational repair in resis-

tance to melphalan. J Natl Cancer Inst 2001;93:1473-1478.

33. Haaf T, Golub EI, Reddy G, et al. Nuclear foci of mammalian Rad51 recombination protein in so-

matic cells after DNA damage and its localization in synaptonemal complexes. Proc Natl Acad Sci

USA 1995;92:2298-2302.

34. Hoeijmakers JH. Genome maintenance mechanisms for preventing cancer. Nature 2001;411:

366-374.

35. Latz D, Fleckenstein K, Eble M, et al. Radiosensitizing potential of gemcitabine (2’,2’-difluoro-2’-

deoxycytidine) within the cell cycle in vitro. Int J Radiat Oncol Biol Phys 1998;41:875-882.

Chapter 6

132

36. Takata M, Sasaki MS, Sonoda E, et al. Homologous recombination and non-homologous end-join-

ing pathways of DNA double-strand break repair have overlapping roles in the maintenance of

chromosomal integrity in vertebrate cells. EMBO J 1998;17:5497-5508.

37. Essers J, Houtsmuller AB, Van Veelen L, et al. Nuclear dynamics of RAD52 group homologous

recombination proteins in response to DNA damage. EMBO J 2002;21:2030-2037.

Determination of epirubicin and its metabolite epirubicinol in saliva and plasma by HPLC

Wilma I.W. Dodde1, Jan Gerard Maring2, Gert Hendriks3, Floris M. Wachters4, Harry J.M.

Groen4, Elisabeth G.E. de Vries5, Donald R.A. Uges3

1University Centre for Pharmacy, Groningen; 2Department of Pharmacy, Diacones-

sen Hospital Meppel and Bethesda Hospital Hoogeveen; Departments of 3Pharmacy, 4Pulmonary Diseases and 5Medical Oncology, University Hospital Groningen,

The Netherlands

Ther Drug Monit 2003;25:433-440

Chapter 7

134

HPLC-UV analysis of epirubicin

135

Waterworks. Venice. Italy 2000.

Chapter 7

134


135

Abstract

Aim We present a high-performance liquid chromatography (HPLC) method, suitable for

the analysis of epirubicin and its metabolite epirubicinol in saliva and plasma.

Methods Preparation of saliva and plasma samples was performed by extraction of

analytes with a chloroform : 2-propanol mixture (6:1, v/v) and evaporation of the organic

phase to dryness under vacuum at a temperature of approximately 45 °C. The chromato-

graphic analysis was carried out by reversed-phase isocratic elution of the anthracyclines

with a Chromsep Stainless Steel HPLC column (150 x 4.6 mm I.D.) filled with Nucleosil 100

S C18 material, particle size 5 µm.

Results The detection was accomplished by spectrofluorimetry at excitation and emission

wavelengths of 474 and 551 nm respectively. The anthracyclines eluted within 10 min of

injection and the method appeared to be specific. The method is linear over a concentra-

tion range of 5 – 1000 µg/L for epirubicin and 2 – 400 µg/L for epirubicinol (r > 0.99) in

both saliva and plasma. The recoveries from saliva and plasma of epirubicin, epirubicinol

and the internal standard doxorubicin were 88.9 and 69.0%, 87.6 and 77.3% and 80 and

67.9 % respectively. The lower limit of quantitation was 5 µg/L for epirubicin and 2 µg/L

for epirubicinol. The method proved to be precise and accurate, as the within-day and

between-day coefficients of variation were less than 10 %.

Conclusions Overall results indicate that our method is suitable for the bioanalysis of

epirubicin and epirubicinol in saliva as well as plasma.

Introduction

Anthracyclines are widely used as antitumor agents and are effective against a broad

range of malignancies [1]. The first identified anthracyclines, daunorubicin and doxoru-

bicin, were isolated from pigment producing Streptomyces species in the early 1960s and

remain in widespread clinical use today [2]. Epirubicin is the 4’-epimer of doxorubicin and

has an antitumor spectrum that is similar to doxorubicin, but produces less side effects

[1,3,4]. Clinically epirubicin has shown therapeutic activity in patients with breast cancer,

malignant lymphomas, sarcomas, lung, ovarian and prostate cancer [1,3,5]. Myelosuppres-

sion is the major acute dose-limiting toxicity, while cardiotoxicity is the most important

chronic cumulative dose-limiting toxicity [1,3,6]. Other side effects are nausea, vomiting,

alopecia, diarrhoea, phlebitis and mucositis [1,3]. The relationship between salivary

exposure of cytotoxic drugs and the occurrence of gastrointestinal side effects has so far

given little attention. Salivary excretion has been described for cisplatin [6], carboplatin

[7,8], cytarabin [9], doxorubicin [5,10], fluorouracil [11,12], etoposide [13,14], irinotecan

[15], melphalan [16], methotrexate [17-23], paclitaxel [24] and teniposide [25]. For most of

these agents, huge interindividual differences in saliva/plasma concentration ratios (S/P

Chapter 7

136


137

ratio) were found. This is caused by many variables influencing the excretion of drugs into

saliva. The transfer of drugs from blood into saliva depends upon the (physico-)chemical

properties of the compound such as molecular size, lipid solubility, pKa and protein

binding. The primary physiologic factors affecting salivary distribution are salivary pH,

salivary flow rate and existing pathology of the oral cavity [26]. The salivary excretion

of chemotherapeutic agents in relation to gastrointestinal side effects has so far only

been studied for fluorouracil and methotrexate. Excretion of fluorouracil and 7-hydroxy-

methotrexate into saliva were reported to be positively related to the development of

mucositis [12,17,18,20-23].

Although several methods have been published regarding the analysis of anthracyclines

in plasma, as far as we know a validated assay for determination of these compounds in

saliva has never been reported. Celio et al. [4] and Bresolle et al. [10] studied the salivary

excretion of doxorubicin, but did not provide details on the analytical methods in their

reports. In this paper we describe a validated HPLC method for determining epirubicin

and its metabolite epirubicinol in saliva, which is also suitable for analysis of anthracy-

clines in plasma.

Methods

Chemicals

Epirubicin hydrochloride (purity 98.4 %) and epirubicinol hydrochloride (purity 78 %) were

obtained from Pharmacia & Upjohn, Milano, Italy. Doxorubicin hydrochloride (purity 97.9

%) was purchased from Rhône-Poulenc Pharma, Hoevelaken, the Netherlands. All other

chemicals were of standard analytical grade. Borax buffer consisted of 16.4 g/L disodium

tetraborate · 10 H2O in water, adjusted to pH 9 with a 0.1 M hydrochloric acid solution.

High Performance Liquid Chromatography system

The HPLC system consisted of a Spectroflow 400 solvent delivery system (ABI Analytical

Kratos Division, Ramsey NJ, USA), a Waters 717+ autosampler (Waters, Maryland, MA), a

Shimadzu fluorescence detector FR10AXL (Shimadzu, Kyoto, Japan), a computer equipped

with Chrom Perfect 32 (version 3.5) Chromatography data integration system (Justice In-

novations Inc. Palo Alto, CA). The analytical column used for the validation was a Chromsep

Stainless Steel HPLC column (150 x 4.6 mm I.D.) filled with Nucleosil 100 S C18 material,

particle size 5 µm (Chrompack, Middelburg, the Netherlands). The mobile phase consisted

of water : 0.1 M orthophosphoric acid : triethylamine : acetonitril (70 : 3 : 0.07 : 27, v/v).

Before the acetonitril was added the mixture was adjusted to pH 2.8 with 6 M hydrochlo-

ride acid solution. The pump was set at a flow rate of 1.5 mL/min. The excitation wave-

length of the fluorescence detector was set at 474 nm, the emission wavelength was set

at 551 nm. The injection volume was 50 µL.

Chapter 7

136


137

Preparation of standards

For each compound, except for doxorubicin (internal standard), two independent stock

solutions were prepared. One was used for the preparation of the calibration samples

and the second for the preparation of the validation samples. The stock solutions of

epirubicin and epirubicinol were prepared by dissolving epirubicin(ol) hydrochloride in

methanol in a 25.0 mL (polypropylene) volumetric flask to obtain a concentration of 200

mg/L epirubicin(ol) free base. Calibration samples were prepared by adding the required

amount of the stock solutions to human saliva or plasma to obtain concentrations of 5, 10,

25, 50, 250, 500, 750 and 1000 µg/L epirubicin and 2, 4, 10, 20, 100, 200, 300 and 400 µg/L

epirubicinol respectively. Validation samples were prepared at low (20 µg/L epirubicin and

8 µg/L epirubicinol), medium (400 µg/L epirubicin and 160 µg/L epirubicinol) and high

(800 µg/L epirubicin and 320 µg/L epirubicinol) concentration levels. The lower limit of

quantitation (LLQ) was prepared at a concentration of 5 µg/L epirubicin and 2 µg/L epi-

rubicinol. The stock solution of doxorubicin was prepared by dissolving doxorubicin hy-

drochloride in methanol in a 25.0 mL (polypropylene) volumetric flask to obtain a concen-

tration of 200 mg/L doxorubicin free base. The working solution of the internal standard

was prepared by diluting 50 µL of the stock solution to 25.0 mL with acetonitril : 3 mM

orthophosphoric acid (20:80, v/v). A concentration of 400 µg/L doxorubicin calculated on

free base was obtained. Validation samples were kept frozen at – 20 °C until analysis.

Sample preparation

The extraction procedure was based on a method previously described by Oosterbaan

et al. [28]. Frozen (- 20 °C) saliva or plasma samples (validation or patient samples) were

thawed and sonificated for 15 min before analysis. An aliquot of 0.5 mL of saliva or plasma

sample was mixed with 100 µL of doxorubicin working solution in a 10 mL polypropylene

tube. To plasma samples additionally 100 µL of a solution of 0.2 M calcium chloride was

added and samples were allowed to stand for 15 min. Subsequently, to both saliva and

plasma samples, 0.5 mL of borax buffer pH 9 was added and the samples were extracted

with 7 mL of extraction solvent (chloroform: 2-propanol mixture 6:1 v/v) by shaking on

a rotary mixer for 20 minutes, at a speed of 40 rpm. After centrifugation at 2800 g for 5

min the upper (aqueous) layer was discarded and the remaining organic phase was trans-

ferred to a clean polypropylene tube. To the extracts from saliva samples, subsequently

100 µL of propyleneglycol (10 %) in ethanol was added. The solvent was evaporated to

dryness in a vacuum evaporator at a temperature of approximately 45 ºC. The residue was

reconstituted in 200 µL of the mobile phase and 50 µL was injected into the chromato-

graphic system.

Extracts from plasma were mixed with 200 µL of 0.1 M phosphoric acid and the sample

was extracted by shaking on the rotary mixer for 20 min, at a speed of 50 rpm. After cen-

trifugation at 2800 g for 5 min 50 µL of the upper aqueous layer was injected into the

chromatographic system.

Chapter 7

138


139

Patient samples and blanks

Patient plasma and saliva samples were obtained from a patient who participated in a

randomized multicenter phase III trial comparing gemcitabine in combination with either

cisplatin of epirubicin as first-line treatment in advanced non-small cell lung cancer [27].

The protocol was approved by the Medical Ethics Review Committee of the University

Hospital Groningen and the patient gave written informed consent. Chemotherapy on

the first day of treatment consisted of gemcitabine 1125 mg/m2 as a 30 min infusion im-

mediately followed by epirubicin 100 mg/m2 as bolus injection. Collection of blood and

saliva samples was started immediately after the epirubicin dose and continued until

192 h after bolus injection. The samples were placed on ice immediately after collection.

Subsequently, plasma and untreated saliva samples were kept frozen at – 20 °C until

analysis. Blank saliva samples for method validation were obtained from male and female

volunteers. The ratio of saliva and plasma concentration (S/P ratio) was calculated for the

samples collected at the same time point.

Calibration

For the validation of the method a calibration curve was prepared in the range of 5-1000

ng/mL for epirubicin and 2-400 ng/mL for epirubicinol respectively. The parameters of

the calibration curves were calculated by weighted linear regression and were used to

calculate the epirubicin and epirubicinol concentrations of the validation samples. The

peak height ratios (epirubicin/internal standard and epirubicinol/internal standard) were

taken as the responses for a given sample.

Validation

The method was validated on linearity, accuracy, recovery, freeze-thaw stability, sample

compartment stability and sample dilution. On day one the linearity of the calibration

curves and the stability in the sample compartment were determined. On the days two

to six precision and accuracy, recovery, freeze/thaw stability and dilution of samples were

tested. During validation six blank samples obtained from six different human volunteers

were tested to demonstrate that there were no interfering components. The results of the

tests were evaluated against international used acceptance criteria described by Shah et

al. [29].

Linearity

To evaluate linearity of the calibration curves three calibration curves were prepared and

analysed. The curves were judged linear if the correlation coefficient r was better than 0.99

as calculated by weighted linear regression. The goodness of fit and the lack of fit were

determined by means of ANOVA calculations.

Chapter 7

138


139

Accuracy and precision

To assess the accuracy and precision of the method, the samples LLQ, low, medium and

high were analysed three times a day, during five days. The coefficients of variation (CV

%) for the within-day precision and the coefficients of variation for the between-day

precision were estimated by ANOVA. An overall coefficient of variation less than 20 % was

accepted for the LLQ of this method. For the samples with low, medium and high concen-

tration an overall coefficient of variation less than 15 % was accepted [29]. Accuracy was

calculated from the mean of the amount observed and the theoretical concentrations

at a particular level. The method was considered accurate when the deviation from the

theoretical concentration (bias) was less than 20 % at the LLQ level and less than 15 % at

the remaining levels [29].

Recovery

The recoveries of epirubicin, epirubicinol and doxorubicin were determined by comparing

the peak heights of the validation samples low, medium and high with the peak heights

of analysed solutions containing all the compounds of interest at a concentration corre-

sponding with 100 % recovery [29].

Freezing and thawing

To assess freezing and thawing stability samples with a low concentration and samples

with a high concentration were prepared . The same sample was frozen and thawed each

day for five days. After each freeze/thaw cycle the samples were analysed in triplicate. Bias

was calculated in the same way as with precision and accuracy. Samples were considered

stable if bias was below 10 % after five freeze/thaw cycles.

Dilution

Because some samples of clinical patients can have concentrations above the higher limit

of quantitation (HLQ), these samples have to be diluted to obtain concentrations within

the calibration range. In order to validate the dilution of samples the following experiment

was carried out: samples with a concentration of 2.5 mg/L epirubicin and 1 mg/L epiru-

bicinol respectively were diluted 5 times and samples with a concentration of 10 mg/L

epirubicin and 4 mg/L epirubicinol respectively were diluted 20 times to obtain concen-

trations of 500 µg/L epirubicin and 200 µg/L epirubicinol. Blank human saliva was used as

diluting agent. These diluted samples were analysed in triplicate, during five days. Bias was

calculated by ANOVA. Dilution was considered possible if bias was below 10 %.


Stability during storage in sample compartment was determined by analysing samples

with low and high concentration over a period of 30 h. The calculated response at t = 30 h

was compared to the calculated response at t = 0 h. Samples were judged stable over a

Chapter 7

140


141

period of 30 h if the decrease in response was less than 10 %.

Results

Retention times

The retention times of epirubicinol, doxorubicin and epirubicin were 5.60 ± 0.39, 7.52 ±

0.49 and 9.66 ± 0.66 min (all based on n=265) respectively. No interfering peaks were

observed in the chromatograms.

Linearity

The analysis of the detector response as a function of analyte concentration in calibration

standards in the range of 5-1000 µg/L for epirubicin and 2-400 µg/L for epirubicinol gave a

correlation coefficients better than 0.99 for epirubicin and epirubicinol in saliva (figure 1).

In plasma also correlation coefficients better than 0.99 were found for both compounds.

The lack of fit test turned out significant for epirubicin in both saliva and plasma as well

as for epirubicinol in plasma. For epirubicinol in saliva no significant lack of fit was calcu-

lated.

Figure 1 Linear concentration-response curve of epirubicin in saliva.

��

��

��

��

��

��

��

� ��

��

��

��

Chapter 7

140


141

Table 1 Accuracy and precision, freezing and thawing, dilution and recovery of epirubicin in saliva.

Number of samples

n = 15

Nominal conc.

(µg/L)

Measured conc.

(µg/L)

Within-day

CV (%)

Between-

day CV (%)

Bias


LLQ 5 4.38 7.5 5.4 -12.3

Low 20 19.9 2.1 1.5 -0.6

Medium 400 382 2.9 4 -4.6

High 800 774 1.9 3.5 -3.3


Low 20 19.6 6.7 3.7 -2

High 800 777 6 2.3 -3

Dilution

5 times 2500 2461 3.7 3.3 -2

20 times 10000 9470 13.7 1 -5

Table 2 Accuracy and precision, freezing and thawing, dilution and recovery of epirubicinol in saliva.

Number of samples

n = 15

Nominal conc.

(µg/L)

Measured conc.

(µg/L)

Within-day

CV (%)

Between-

day CV (%)

Bias


LLQ (n = 14) 2 2.03 8.5 15.7 1.6

Low 8 7.64 2.8 0.7 -4.6

Medium 160 163 2.6 3.6 1.9

High 320 325 1.8 2.6 1.6


Low 8 7.86 8.7 0.8 -1.7

High 320 327 5.1 0 2

Dilution

5 times 1000 1066 2.6 2.8 7

20 times 4000 4135 7.5 1.7 3

Chapter 7

142


143

Table 3 Accuracy and precision, freezing and thawing, dilution and recovery of epirubicin in plasma.

Number of samples

n = 15

Nominal conc.

(µg/L)

Measured conc.

(µg/L)

Within-day

CV (%)

Between-

day CV (%)

Bias


LLQ 5 4.98 23 6.9 -0.4

Low 20 21.4 4.2 3.1 7.2

Medium 400 409 3.2 3.5 2.2

High 800 865 2.0 1.3 8.1


Low 20 22.2 4.7 5.9 10.8

High 800 828 2.4 6.2 4

Dilution

5 times 2500 2597 3.3 1.3 4

20 times 10000 10442 2.9 1.3 4

Table 4 Accuracy and precision, freezing and thawing, dilution and recovery of epirubicinol in plasma.

Number of samples

n = 15

Nominal conc.

(µg/L)

Measured conc.

(µg/L)

Within-day

CV (%)

Between-

day CV (%)

Bias


LLQ 2 2 12.8 19.2 0.0

Low 8 8.3 3.7 3.8 3.7

Medium 160 169 4.2 0.2 5.8

High 800 320 2.9 0.0 5.1


Low 8 8.71 8.6 3.7 8.9

High 320 329 1.9 2.9 3

Dilution

5 times 1000 1028 2.8 0.0 3

20 times 4000 4181 3.1 1.9 5

Chapter 7

142


143


In saliva as well as plasma, overall coefficients of variation were below 20 % for LLQ and

below 15 % for low, medium and high concentrations for both epirubicin and epirubicinol

(tables 1-4).

Recovery

In saliva, the mean calculated recoveries of epirubicin for the low, medium and high con-

centrations were 92.6 %, 86.6 % and 87.6 % respectively. For epirubicinol these recoveries

were 85.8 %, 89.1 % and 88.0 %. For doxorubicin a recovery of 80.0 % was found. In plasma,

the mean calculated recoveries of epirubicin for the low, medium and high concentrations

were 75.0 %, 63.8 % and 69.0 %. For epirubicinol these recoveries were 86.2 %, 72.8 % and

73.0 % respectively. For doxorubicin in plasma a recovery of 67.9 % was found.


In saliva, bias was below 10 % for both low and high concentrations of epirubicin and

epirubicinol. In plasma bias was below 10 % for both low and high concentrations of epi-

rubicinol as well as for high concentrations epirubicin, but above 10 % for low epirubicin

concentrations. Detailed results are represented in table 1 and 2 for epirubicin and epiru-

bicinol respectively in saliva and table 3 and 4 for epirubicin and epirubicinol in plasma.

Figure 2 Chromatograms of blank saliva and blank plasma

Chapter 7

144


145

Dilution

In saliva as well as plasma, bias was below 10 % for both low and high concentrations.

Detailed results are represented in tables 1-4.


For epirubicin in saliva the ratio decreased 6.1 % after 30 h for low concentration and 3.1

% for high concentrations. For epirubicinol the ratio decreased 1.1 % after 30 h for low

concentration and 2.4 % for high concentrations.

Figure 3 Chromatogram of saliva from a patient 6 hours after administration of 100 mg/m2 epirubicin. The peak at t = 5.01 min corresponds with epirubicinol 5 µg/L; the peak at t = 6.92 min with doxorubi-cin; the peak at t = 8.84 min with epirubicin 31 µg/L. Scaling is expressed as milliVolt full scale (mV FS). The detector settings were identical to those in figure 2.

��

� � � � ��

��

�

��

��

��

��

��

Chapter 7

144


145

Figure 4 Plasma and saliva curves in a clinical patient after a intravenous dose of 100 mg/m2 epirubicin.

�

��

��

��

��

� � ��

��

��

��

��

��

��

��

��

��

��

In plasma the ratio for epirubicin decreased 1.8 % after 30 h for low concentration and

0.2 % for high concentrations. For epirubicinol in plasma these ratios were 3.0 % for low

concentrations and 0.4 % for high concentrations in plasma.

Patient’s saliva.

During validaton six blank samples were tested. None of the samples showed interfering

peaks. An example of a blank saliva sample is given in figure 2.

Figure 3 shows a chromatogram of saliva from a patient, 6 h after a bolusinjection of 100

mg/m2 epirubicin. Figure 4 depicts the saliva and saliva curves in the same patient. The

theoretical S/P ratio of epirubicin was calculated with the following formula:

According to literature, the pKa of epirubicin is 7.7, the fraction unbound in plasma ap-

proximately 0.23, and the fraction unbound in saliva 1.00. Hence, the theoretical S/P ratio

of epirubicin ranges from 0.23 to 3.92 when saliva pH decreases from 7.4 to 6. In the

patient, epirubicin S/P ratios ranging from 0.002 to 2.56 were measured (see table 5). The

lowest values were measured during the distribution phase shortly after bolus injection,

during rapid decline of epirubicin plasma levels.

Chapter 7

146


147

Discussion

In this paper we demonstrate that epirubicin and its metabolite epirubicinol can be

measured in saliva over a wide range of concentrations (5-1000 µg/L for epirubicin and 2-

400 µg/L for epirubicinol respectively) with high linearity and precision. This range is wide

enough to cover saliva levels of epirubicin and epirubicinol in clinical practice. In a study

with doxorubicin, Bressolle et al. [10] reported parotid saliva levels ranging from 11.7 to

82.6 µg/L following intravenous doses of 28-72 mg/m2 doxorubicin. Celio et al. [5] found a

range of 11.6 to 36.0 µg/L for doxorubicin in parotid saliva following an intravenous total

dose of 50-90 mg.

Surprisingly, a lack of fit was calculated for the linearity of the epirubicin calibration curve,

despite a high correlation coefficient. We analysed that a very small variance in the tripli-

cates, compared to the deviations of the individual points from the calibration line caused

this lack of fit. Therefore, we considered the outcome of this statistical test in this case as

irrelevant.

We calculated a lower limit of quantification of 5 µg/L for epirubicin and 2 µg/L for epiru-

bicinol in saliva. As far as we know, the lowest limit of quantitation mentioned in literature

for analysis of anthracyclines in saliva by HPLC is 25 µg/L, although analytical results as

low as 11.6 µg/L doxorubicin in saliva have been reported [5,10]. Despite the fact that

epirubicin and doxorubicin are chemically not fully identical, we believe that our method

is at least 2.5-5 times more sensitive than previously reported methods for analysis of

anthracyclines in saliva. As the extraction recovery at low concentrations is only margin-

ally higher than that of doxorubicin (93% vs. 80%) and the relative emission intensities of

epirubicin and doxorubicin during fluorospectroscopy are more or less identical, these

factors do not explain improved sensitivity. Sample size, sample concentration, peak

shape, signal to noise ration, and/or injection volume might be relevant parameters, but

this was not further investigated.

Table 5 Patient data regarding epirubicin concentrations in plasma and saliva, concurrent saliva pH values and calculated S/P ratios.

sample time (h) Cplasma

(µg/L) Csaliva

(µg/L) S/P ratio pHsaliva

1 5199 11 0.002 6.7

1.5 190 56 0.29 5.4

2 92 87 0.95 6.5

3 66 105 1.59 6.6

4.5 54 138 2.56 6.1

6 46 74 1.61 6.0

22 15 25 1.67 5.5

Chapter 7

146


147

We measured recoveries of 88.9 %, 87.6 % and 80 % for epirubicin, epirubicinol and

doxorubicin in saliva respectively at intermediate concentration levels. Although these

recoveries are lower than those mentioned by Celio et al. [5] (95%), they appear to be

very reproducible. The extraction procedure according to Oosterbaan et al. [28], which

was initially applied, produced recoveries of only 24%, 57% and 27% for epirubicin, epiru-

bicinol and doxorubicin. Subsequently, several attempts have been made to improve the

recovery from saliva, including solid phase extraction, sequential addition of isopropanol

and chloroform, protein denaturation with acetonitril before extraction, concentration

and pH variations in extraction buffer, variations in CaCl2

concentration and addition of

propylene glycol. The use of propylene glycol produced an acceptable increase in the

recovery of epirubicin and epirubicinol, which could be explained by the prevention of

sublimation or adsorption of the analytes during the evaporation step.

Freezing and thawing of samples, sample dilution, and storage of samples in a auto-

sampler sample compartment were all considered acceptable according to Shah’s criteria

for accuracy and precision [29].

The saliva/plasma (S/P) ratios measured in our patient were in line with theoretical values.

The S/P ratios increased significantly with time after dosing. This is in line with earlier

findings of Bresolle et al. [10] for doxorubicin and doxorubicinol. The largest increase of

S/P ratio occurred during the hours immediately after injection, largely due to rapidly de-

creasing epirubicin plasma levels as a result of extensive drug distribution.

We conclude that the method for determination of anthracyclines in saliva, presented in

this paper, has a lower limit of quantification than previously reported methods and is

applicable over a wide concentration range. With slight modifications, this method can

also be used for determination of anthracyclines in plasma. With concurrent analysis of

anthracyclines in plasma and saliva, the extent of drug excretion into saliva can be studied

and S/P ratios can be calculated.

Acknowledgements

The authors thank Marina Maurer for her efforts in analysing patient samples.

Chapter 7

148


149

References

1. Hortobágyi GN. Anthracyclines in the treatment of cancer: an overview. Drugs 1997:54(suppl 4):

1-7.

2. Weiss RB. The anthracyclines: will we ever find a better doxorubicin? Semin Oncol 1992:19:670-

86

3. Plosker GL, Faulds D. Epirubicin A review of its pharmacodynamic and pharmacokinetic proper-

ties, and therapeutic use in cancer chemotherapy. Drugs 1993;45:788-856

4. Lilenbaum RC, Green MR. Novel chemotherapeutic agents in the treatment of non-small cell lung

cancer. J Clin Oncol 1993;11:1391-1402.

5. Celio LA, DiGregorio GJ, Ruch E, Pace J, Piraino AJ. Doxorubicin and 5-fluorouracil plasma concen-

trations and detectability in parotid saliva. Eur J Clin Pharmacol 1983;24:261-266.

6. Allen A, The cardiotoxicity of chemotherapeutic drugs. Semin Oncol 1992:19:529-42.

7. Holding JD, Lindup WE, Roberts NB, et al. Measurement of platinum in saliva of patients treated

with cisplatin. Ann Clin Biochem 1999;36:655-659.

8. Van Warmerdam LJ, van Tellingen O, ten Bokkel Huinink WW, et al. Monitoring carboplatin con-

centrations in saliva: a replacement for plasma ultrafiltrate measurements? Ther Drug Monit

1995;17:465-470.

9. Slevin ML, Johnston A, Woollard RC, et al. Relationship between protein binding and extravas-

cular drug concentrations of a water-soluble drug, cytosine arabinoside. JR Soc Med 1983;76:

365-368.

10. Bresolle F, Jacquet JM, Galtier M, et al. Doxorubicin and doxorubicinol plasma concentrations and

excretion in parotid saliva, Cancer Chemother Pharmacol 1992;30:215-218.

11. Milano G, Thyss A, Santini J, et al. Salivary passage of 5-fluorouracil during continuous infusion.

Cancer Chemother Pharmacol 1989;24:197-199.

12. Joulia JM, Pinguet F, Ychou M, et al. Plasma and salivary pharmacokinetics of 5-fluorouracil (5-FU)

in patients with metastatic colorectal cancer receiving 5-FU bolus plus continuous infusion with

high-dose folinic acid. Eur J Cancer 1999;35:296-301.

13. Holthuis JJ, Postmus PE, Van Oort WJ et al. Pharmacokinetics of high dose etoposide (VP 16-213).

Eur J Cancer Clin Oncol 1986;22:1149-1155.

14. Gouyette A, Deniel A, Pico JL et al. Clinical pharmacology of high-dose etoposide associated with

cisplatin. Pharmacokinetic and metabolic studies. Eur J Cancer Clin Oncol 1987;23:1627-1632.

15. Takahashi T, Fujiwara Y, Sumiyoshi H, et al. Salivary drug monitoring of irinotecan and its active

metabolite in cancer patients. Cancer Chemother Pharmacol 1997;40:449-452.

16. Slavik M, Wu J, Riley C. Salivary excretion of anticancer drugs. Ann NY Acad Sci 1993;694:319-

321.

17. Schroder H, Jensen KB, Brandsborg M. Lack of correlation between methotrexate concentrations

in serum, saliva and sweat after 24 h methotrexate infusions. Br J Clin Pharmacol 1987;24:537-

541.

18. Steele WH, Stuart JF, Whiting B et al. Serum, tear and salivary concentrations of methotrexate in

Chapter 7

148


149

man. Br J Clin Pharmacol 1979;7:207-211.

19. Patterson AJ, Ritschel WA, Zellner D, et al. Methotrexate serum and saliva concentrations in pa-

tients. Int J Clin Pharmacol Ther Toxicol 1981;19:381-385.

20. Ishii E, Yamada S, Higuchi S, et al. Oral mucositis and salivary methotrexate concentration in

intermediate-dose methotrexate therapy for children with acute lymphoblastic leukemia. Med

Pediatr Oncol 1989;17:429-432.

21. Oliff A, Bleyer WA, Poplack DG. Methotrexate-induced oral mucositis and salivary methotrexate

concentrations. Cancer Chemother Pharmacol 1979;2:225-226.

22. Albertioni F, Rask C, Schroeder H, et al. Monitoring of methotrexate and 7-hydroxymethotrexate

in saliva from children with acute lymphoblastic leukemia receiving high-dose consolidation

treatment: relation to oral mucositis. Anticancer Drugs 1997;8:119-124.

23. Rask C, Albertioni F, Schroder H, et al. Oral mucositis in children with acute lymphoblastic leuke-

mia after high-dose methotrexate treatment without delayed elimination of methotrexate: rela-

tion to pharmacokinetic parameters of methotrexate. Pediatr Hematol Oncol 1996;13:359-367.

24. Svojanovsky SR, Egodage KL, Wu J, et al. High sensitivity ELISA determination of taxol in various

human biological fluids. J Pharm Biomed Anal 1999;20:549-555.

25. Holthuis JJ, de Vries LG, Postmus PE, et al. Pharmacokinetics of high-dose teniposide. Cancer Treat

Rep 1987;71:599-603.

26. Jusko W, Milsap R. Pharmacokinetic principles of drug distribution in saliva. Ann NY Acad Sci

1993;694:36-47.

27. Wachters FM, Van Putten JWG, Kramer H, et al. Randomized multicenter phase III trial comparing

gemcitabine in combination with cisplatin and epirubicin as first-line treatment in advanced

non-small cell lung cancer. Proc Am Soc Clin Oncol 2002; abstract 1181

28. Oosterbaan MJM, Dirks RJ, Vree TB, et al. Rapid quantitative determination of seven anthracy-

clines and their hydroxy metabolites in body fluids. J Chromatogr 1984;306:323-332.

29. Shah, Midha KK, Dighe S, et al. Analytical methods validation: bioavailability, bioequivalence, and

pharmacokinetic studies. J Pharm Sci 1992;3:309-312.

Gemcitabine and epirubicin plasma concentra-tions and excretion in saliva in non-small cell lung cancer patients.

Jan Gerard Maring1 , Floris M. Wachters2 , Marina Maurer3 , Donald R.A. Uges4, Elisabeth

G.E. de Vries5 , Harry J.M. Groen2


Hoogeveen; 2Department of Pulmonary Diseases, University Hospital Groningen, 3Univer-

sity Centre for Pharmacy, Groningen; Departments of 4Pharmacy and 5Medical Oncology,

University Hospital Groningen, The Netherlands

Submitted

Chapter 8

152

Gemcitabine and epirubicin excretion in saliva

153

Camel Man. Hollywood LA, USA 1998.

Chapter 8

152


153

Abstract

Aim The excretion in saliva of gemcitabine and its metabolite 2’,2’-difluorodeoxyuridine

(dFdU) as well as epirubicin and its metabolite epirubicinol was studied in non-small cell

lung cancer patients, treated with gemcitabine plus epirubicin.

Methods Patients (n=12) were treated with gemcitabine 1125 mg/m2, followed by epi-

rubicin 100 mg/m2. Blood, saliva and oral mucosa cells were collected during 22 h for

analysis of gemcitabine, epirubicin and their metabolites. Gemcitabine, dFdU, epirubicin

and epirubicinol were quantified by High Performance Liquid Chromatography (HPLC).

Results Gemcitabine was rapidly cleared from plasma and undetectable after 3 h in all

patients. Gemcitabine was detectable in saliva only during the first hour after infusion. The

Cmax

in saliva was 0.66 ± 0.61 mg/L and the saliva/plasma ratio (S/P ratio) was 0.038 ± 0.037.

Epirubicin displayed a triexponential plasma concentration-time profile. The concentration in

saliva at t=6 h after administration was 55 ± 27 µg/L and decreased to 28 ± 14 µg/L at t=22

h. The corresponding S/P ratios were 1.28 ± 0.73 and 1.72 ± 1.00. The amount of epirubicin

in mucosal cells ranged from 135-598 ng/106 cells at t=3 h and decreased to 33-196 ng/106

cells at t=22 h.

Conclusion Gemcitabine and epirubicin as well as their main metabolites dFdU and epi-

rubicinol are excreted in detectable amounts in saliva, although their absolute amounts

remain relatively low.

Introduction

Gemcitabine and epirubicin, respectively a pyrimidine antagonist and an anthracycline

analogue, are both extensively used in the treatment of solid tumors. Both agents are

rapidly distributed to tissues and quickly cleared from plasma immediately after intra-

venous administration. The clearance of gemcitabine is primarily determined by its de-

gradation into 2’,2’-difluorodeoxyuridine (dFdU) by the enzyme cytidine deaminase [1].

Epirubicin is cleared by liver metabolism and excretion into bile [2]. The main metabolite

is epirubicinol, which also has cytotoxic activity. The plasma pharmacokinetics of both

drugs have been described previously [3-5]. Hardly any information however is available

with respect to the excretion of gemcitabine and epirubicin into saliva. Previously, the

excretion in saliva of the pyrimidine antagonist cytarabine and that of the anthracycline

analogue doxorubicin have been reported [6-8]. Saliva is secreted by the parotid, sublin-

gual and submaxillary glands, with the parotid and submaxillary glands accounting for

90% of the approximately 1200 mL of saliva that is secreted each day [9]. The blood supply

to the glands is provided by the external carotid artery with the direction of the arterial

flow being countercurrent to the direction of salivary flow within the ductal system. The

excretion of cytotoxic drugs in saliva may be related to the development of side effects

Chapter 8

154


155

such as oral mucositis and diarrhea. The extent of salivary secretion is mainly determined

by the lipofilicity and pKa of the drug, the level of protein binding of the drug in plasma

and the pH of saliva. Drugs are believed to enter saliva predominantly via passive diffusion,

a process that is limited to the un-ionized drug [9].

The aim of the current study was to determine the excretion of gemcitabine and epirubicin

and respectively their main metabolites dFdU and epirubicinol in saliva. In addition, for

these drugs the importance of salivary excretion as a route of elimination was evaluated.

Patients and methods

Patient selection

This study was performed as a site study of a phase III trial of gemcitabine plus epirubicin

versus gemcitabine plus cisplatin in advanced NSCLC patients [10]. Patients had to meet

the inclusion and exclusion criteria of the main study. In short, patients were included

if they had stage IIIB/IV NSCLC. No prior chemotherapy was allowed. An adequate bone

marrow reserve, normal renal and liver function were required. Patients were excluded

if they had active infections, second primary malignancies, uncorrected hypercalcae-

mia or a left ventricular ejection fraction (LVEF) less than 45%. A detailed description of

the inclusion and exclusion criteria was published earlier [10]. The local medical ethics

committee of the hospital approved the protocol. All patients gave informed consent

before study entry. The gemcitabine and dFdU plasma pharmacokinetic data presented

in this study were also used to explore the interaction of gemcitabine and epirubicin in

another trial. The results of this interaction study are shown in chapter 9. The toxicity was

scored before chemotherapy and on days 8, 15 and 21 according to the Common Toxicity

Criteria, version 2.0.

Treatment and sample collection

Gemcitabine (Gemzar®, Lilly, Nieuwegein,The Netherlands) in a dose of 1125 mg/m2 in 250

mL 0.9% NaCl solution was administered as a 30 min infusion on day 1 and day 8. Epiru-

bicin (Farmorubicine®, Pharmacia, Woerden, The Netherlands) in a dose of 100 mg/m2 in

50 mL 0.9% NaCl solution was administered as an intravenous bolus injection over 5 min,

immediately after the end of the gemcitabine infusion, on day 1 of each 21-day cycle. For

pharmacokinetic sampling, a cannula was placed intravenously in the arm of the patient

contralateral to the side of drug administration. Blood samples of 9 mL were collected in

heparinized tubes containing 0.25 mg tetrahydrouridine (THU) in 50 µL water, just before

chemotherapy and at t = 25, 40, 50, 60, 75, 90, 105, 120, 150, 180, 270, 360, 540 and 1320 min

after start of the gemcitabine infusion. Unstimulated whole saliva was collected over 5 min

periods in plastic cups, containing 0.25 mg THU in 50 µL water, just before chemotherapy

and at t = 25, 40, 60, 90, 120, 180, 270, 360, 540 and 1320 min after start of the gemcitabine

Chapter 8

154


155

infusion. The saliva pH was measured with a calibrated pH meter on the day of sample col-

lection. Harvesting of oral mucosa cells was performed before chemotherapy, and 180 min

and 1320 min after start of the gemcitabine infusion by thorough mouth rinsing during a

30 sec period with 5 mL 0.9 % NaCl solution. The cell suspension was collected in plastic

cups, containing 0.25 mg THU in 50 µL water, and subsequently placed on ice. Within 1 h

after collection, the cell suspension was centrifuged during 10 min at 190 g at 4 ºC. The

supernatant was discarded and cells were washed in 10 mL ice cold Phosphate Buffered

Saline, pH=7.40 (PBS) and centrifuged during 10 min at 190 g at 4 ºC. The pellet was resus-

pended in 1 mL ice cold PBS and a 50 µL aliquot of this cell suspension was mixed with 50

µL tryptan blue solution (0.4% in a 8.77 g/L NaCl solution) for microscopic cell counting.

The viability was estimated by measuring the percentage of cells able to exclude tryptan

blue. The remaining suspension was transferred in a microcentrifuge cup and shortly (15

s) centrifuged at 10,000 g The supernatant was discarded and the pellet was kept frozen

at – 80 ºC until further analysis.

HPLC analysis

Epirubicin hydrochloride and epirubicinol hydrochloride were obtained from Pharmacia

& Upjohn (Milano, Italy). Doxorubicin hydrochloride was purchased from Rhône-Poulenc

Pharma (Hoevelaken, the Netherlands). Gemcitabine hydrochloride and dFdU, were

obtained from Lilly Co., (Indianapolis, IN). Tetrahydrouridine was purchased from Calbio-

chem (La Jolla, CA). All other chemicals were of standard analytical grade.

The extraction and analysis of epirubicin and epirubicinol from plasma and saliva was

carried out according to the method previously described by Dodde et al. [11].

The analysis of gemcitabine and dFdU in plasma was carried out as described by Freeman

et al. [12]. For the analysis in saliva, a slight modification on this method was performed as

follows: Individual 200 µL aliquots of plasma or 1 mL aliquots of saliva standards, controls

and subject samples were pipetted into 10 mL glass tubes. For plasma sample concentra-

tions above 10 mg/L, sample volumes from 20 - 100 µL were used and diluted to 200 µL

with THU treated plasma. A 50 µL aliquot of working internal standard solution was added

to each tube. The samples were briefly vortex-mixed. Then 1 mL isopropanol was added

and the samples were vortex-mixed again. After 5 min a 2.5 mL aliquot of ethylacetate was

added and vortex-mixed. The samples were centrifuged at 2,500 g for 10 min. The super-

natant was transferred to a fresh tube and evaporated at 40 ºC under a stream of nitrogen.

The samples were reconstituted with 250 µL of mobile phase.

The extraction of epirubicin and epirubicinol from cells was performed as follows: Frozen

cell pellets were thawed and resuspended in 150 µL ultrapure water using a vortex mixer.

Protein denaturation was carried out by addition of 50 µL trichloroacetic acid solution

50%. The mixture was allowed to stand on ice during 20 min. Subsequently, the suspen-

sion was centrifuged during 2 min at 10,000 g. The supernatant was transferred into a

clean cup and 1 mL of trioctylamine : 1,1,2-trichlorotrifluoroethane (1:5) was added. The

Chapter 8

156


157

Table 1 Patient characteristics

(n=12)

Gender (M/F) 10/2

Age (y) 65 ± 7

Weight (kg) 77 ± 13

Length (cm) 176 ± 4

Body surface area (m2) 1.93 ± 0.15

Serum-Creatinine (µmol/L) 86 ± 15

Mean values are presented ± the standard deviation

Table 2 Toxicity CTC score during the first treatment cycle

Toxicity grade

Grade 0 Grade 1-2 Grade3-4n n n

Hemoglobin 0 10 2

Leucocytes 3 6 3

Neutro-/Granulocytes 5 2 5

Platelets 1 5 6

Nausea 7 5 0

Vomiting 11 1 0

Mucositis 5 7 0

Diarrhea 12 0 0

Table 3 Epirubicin pharmacokinetic parameters

Epirubicin

Dose (mg) 190 ± 15

AUC0→22 h

(µg.h/L) 1880 ± 578

Vdistribution

(L) 1483 ± 565

Cl (L/h) 90 ± 24

Csaliva 6 h

(µg/L) 55 ± 27

S/P ratio 6 h

1.28 ± 0.73

Csaliva 22 h

(µg/L) 28 ± 14

S/P ratio 22 h

1.72 ± 1.00

Epirubicinol

AUC0→22 h

(µg.h/L) 414 ± 164

T 1⁄2 elimination

(h) 16.0 ± 4.1

Mean values ± the standard deviation are presented.

Chapter 8

156


157

mixture was vortexed during 1 min and subsequently centrifuged for 2 min at 10,000 g.

The supernatant was divided over 2 autosampler tubes for HPLC analysis of epirubicin

and epirubicinol. The lower limit of quantitation was 5 µg/L for epirubicin and 2 µg/L for

epirubicinol.


Pharmacokinetic data were analyzed in Mw\Pharm (version 3.5; MediWare, Groningen, The

Netherlands) using KinFit. For both gemcitabine and epirubicin and their metabolites, the

Area Under the Curve (AUC; trapezoid rule) and elimination half-lifes were calculated by

non-compartiment analysis. Additionallly, the epirubicin and epirubicinol data were also

analyzed in a three compartiment pharmacokinetic model. The saliva/plasma ratios were

calculated by dividing saliva and plasma concentrations at each time point.


Subject data were analyzed for descriptive statistics in the SYSTAT 7.0 statistical program

(SPSS inc. 1997). Blood, saliva and mucosal cellular levels and saliva/plasma ratios on

different time points were compared with a paired Student’s t-test. Pairs consisted of data

obtained from the same individual.

Results

Patients

Between November 2000 and September 2002 we included 12 patients.

Patient characteristics are represented in table 1. All patients had normal liver and renal

function parameters. Treatment related toxicity, measured during the first cycle, is repre-

sented in table 2. Nearly all patients experienced hematological toxicity. The main non-

hematological toxicity was grade 1/2 mucositis in 7 out of 12 patients.

Pharmacokinetics

Mean pharmacokinetic curves of gemcitabine and dFdU in saliva are represented in figure 1.

Gemcitabine and dFdU plasma data, also reported in detail in chapter 9, were used for saliva/

plasma ratio (S/P ratio) calculations and for this reason included in figure 1.

Gemcitabine was rapidly cleared from plasma and undetectable after 3 h in all patients. Both

gemcitabine and dFdU data were fitted in a parent drug – metabolite model, comprising one

compartiment for gemcitabine and two compartiments for dFdU pharmacokinetics. Gemci-

tabine was detectable in saliva only during the first hour after infusion. The Cmax

in saliva was

0.66 ± 0.61 mg/L and the S/P ratio was only 0.038 ± 0.037. This was in line with the theoretical

S/P ratio, calculated for gemcitabine.

Mean pharmacokinetic curves of epirubicin and epirubicinol in plasma and saliva are

Chapter 8

158


159

Figure 2 Mean concentration-time profiles of epirubicin and its metabolite epirubicinol in plasma and saliva after a bolus dose of 100 mg/m2 epirubicin. The error bars represent the s.d. values.

Figure 1 Mean concentration-time profiles of gemcitabine and its metabolite dFdU in plasma and saliva after a 30 min infusion of 1125 mg/m2 gemcitabine. Error bars represent the s.d. values.

��

��

��

��

� � � � �

��

��

��

��

��

��

��

��

��

�

��

��

��

� � ��

��

��

��

��

��

��

��

Chapter 8

158


159

represented in figure 2. Data of epirubicin and epirubicinol were fitted separately in a

three-compartment pharmacokinetic model. Table 3 represents the pharmacokinetic pa-

rameters of both compounds in plasma and saliva, including S/P ratios at t=6 h and t=22 h

after epirubicin administration. Figure 3 displays the S/P ratios at t=6 h (upper panel) and

t=22 h (lower panel) as function of saliva pH. There was no consistent effect of pH on the

S/P ratio. Nearly all S/P ratios of epirubicin exceeded 1, which was above the theoretical

maximum value calculated for epirubicin.

Mucosal cells for quantification of intracellular epirubicin were available from 7 patients.

The amount of epirubicin ranged from 135-598 ng/106 cells at t=3 h and decreased to 33-

196 ng/106 cells at t=22 h (p<0.05, paired t-test; see figure 4).

�

�

�

�

�

� � � �

��

��

��

�

�

�

�

�

� � � �

��

��

��

�

�

Figure 3 Saliva-Plasma (S/P) ratios of epirubicin after a bolus dose of 100 mg/m2 epirubicin as a func-tion of saliva pH. Panel A displays values at t = 6 h after epirubicin administration and panel B values at t = 22 h.

Chapter 8

160


161

Discussion

Excretion of gemcitabine in saliva occurred in negligible amounts. Low S/P ratios were

measured and gemcitabine was only detectable in small amounts during the first hour

after infusion. The low S/P ratios were in line with our expectations, since gemcitabine

is a hydrophilic molecule and ionized at physiological pH. Based on the pKa, and fraction

unbound in plasma, for each drug the S/P ratio can be calculated. For weak acidic drugs

the general formula is [13]:

�

�

��

��

�

��

�

�

��

��

�

�

�

��

��

��

Where fp and f

s represent the fractions of unbound drug in plasma and saliva and pH

s and

pHp represent the salivary and plasma pH values.

Gemcitabine has a pKa of 3.6 and is hardly bound to proteins [14]. This results in theoretical

S/P ratios from 0.0006 to 0.13 depending on saliva pH over a range from 4 to 7.4. Low S/P

ratios have also been reported for the pyrimidine antagonist cytarabine [6].

Following the administration of epirubicin, a triexponential disappearance of epirubicin

from plasma was observed with a rapid distribution phase and a prolonged elimina-

tion phase. This pharmacokinetic profile is typical for anthracyclines [5]. The prolonged

elimination is consistent with extensive drug retention within peripheral tissues and

�

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

�

Figure 4 Amounts of epirubicin in oral mucosa cells (n=7) measured at t = 3 h and at t = 22 h after a bolus dose of 100 mg/m2 epirubicin. Values from the same individual are paired with a closed line.

Chapter 8

160


161

gradual release thereafter. Anthracyclines are accumulated within cells against a gradient,

because of the intracellular presence of high affinity receptors such as DNA. Compared to

gemcitabine, much larger S/P ratios were observed for epirubicin, which were in line with

previous findings for doxorubicin [8]. The pKa of epirubicin is 7.7 and the fraction unbound

in plasma 0.8, which results in theoretical S/P ratios ranging from 0.13-1.00 depending on

saliva pH values from 4.0-7.4 [15]. The S/P ratios of epirubicin increased significantly with

time during the 22 h period after dosing, mostly due to decrease of plasma levels. The

absolute amount of epirubicin excreted in saliva remained however low, as saliva concen-

trations never exceeded 220 µg/L. As a result, in patients with a normal saliva production

of 1.2 – 1.5 L per day, the total amount epirubicin excreted over 24 h is only 0.3 mg, which

corresponds to about 0.1-0.15 % of the administered dose. The mean gemcitabine Cmax

in

saliva was about 0.7 mg/L and rapidly dropped to undetectable levels within 2 h. The total

amount excreted in saliva during this period was less then 0.1 mg, which is 0.05 % of the

gemcitabine dose.

These calculations indicate that the gastrointestinal exposure to epirubicin and gemcit-

abine as a result of excretion in saliva is limited. Although more than 50% of all patients in

our study experienced grade 1/2 mucositis, we believe that it is indeed not very likely that

the mucositis is caused by a direct effect of the small amounts of gemcitabine excreted

in saliva during only few hours. On the other hand, we are less sure about the role of epi-

rubicin. After an initial distribution phase, the epirubicin concentrations were generally

higher in saliva than in plasma and epirubicin remained detectable in saliva until at least

22 h after intravenous administration. The prolonged exposure of oral mucosal cells to

both epirubicin in saliva and epirubicin from blood in the extravascular fluid may have

added to the development of mucositis.

We conclude that gemcitabine and epirubicin as well as their main metabolites dFdU

and epirubicinol are excreted in detectable amounts in saliva, although their absolute

amounts remain relatively low.

Chapter 8

162

References

1. Grunewald R, Abbruzzese JL, Tarassoff P, Plunkett W. Saturation of 2’,2’-difluorodeoxycytidine 5’-

triphosphate accumulation by mononuclear cells during a phase I trial of gemcitabine. Cancer

Chemother Pharmacol 1991;27:258-262

2. Young CW, Weenen H. Pharmacology of epirubicin. In: Advances in anthracycline chemotherapy:

epirubicin. Ed. Bonadonna G. Masson Italia Editori. Milano 1984. pp.51-60

3. Abbruzzese JL, Grunewald R, Weeks EA, Gravel D, Adams T, Nowak B, Mineishi S, Tarassoff P, Satter-

lee W, Raber MN, et al. A phase I clinical, plasma, and cellular pharmacology study of gemcitabine.

J Clin Oncol 1991;9:491-498.

4. van Moorsel CJ, Kroep JR, Pinedo HM, Veerman G, Voorn DA, Postmus PE, Vermorken JB, van

Groeningen CJ, van der Vijgh WJ, Peters GJ. Pharmacokinetic schedule finding study of the com-

bination of gemcitabine and cisplatin in patients with solid tumors. Ann Oncol 1999;10:441-448

5. Weenen H, Lankelma J, Penders PG, McVie JG, ten Bokkel Huinink WW, de Planque MM, Pinedo

HM. Pharmacokinetics of 4’-epi-doxorubicin in man. Invest New Drugs 1983;1:59-64

6. Slevin ML, Johnston A, Woollard RC, Piall EM, Lister TA, Turner P. Relationship between protein

binding and extravascular drug concentrations of a water-soluble drug, cytosine arabinoside. J R

Soc Med 1983;76:365-368

7. Celio LA, DiGregorio GJ, Ruch E, Pace J, Piraino AJ. Doxorubicin and 5-fluorouaracil plasma con-

centrations and detectability in parotid saliva. Eur J Clin Pharmacol 1983;24:261-266

8. Bressolle F, Jacquet JM, Galtier M, Jourdan J, Donadio D, Rossi JF. Doxorubicin and doxorubicinol

plasma concentrations and excretion in parotid saliva. Cancer Chemother Pharmacol 1992;30:

215-218.

9. Drobitch RK, Svensson CK. Therapeutic drug monitoring in saliva. An update. Clin Pharmacokinet

1992;23:365-379

10. Wachters FM, Van Putten JW, Kramer H, Erjavec Z, Eppinga P, Strijbos JH, de Leede GP, Boezen HM,

de Vries EG, Groen HJ. First-line gemcitabine with cisplatin or epirubicin in advanced non-small-

cell lung cancer: a phase III trial. Br J Cancer 2003;89:1192-1199

11. Dodde WI, Maring JG, Hendriks G, Wachters FM, Groen HJ, de Vries EG, Uges DR. Determination

of epirubicin and its metabolite epirubicinol in saliva and plasma by HPLC. Ther Drug Monit

2003;25:433-440

12. Freeman KB, Anliker S, Hamilton M, Osborne D, Dhahir PH, Nelson R, Allerheiligen SR. Validated as-

says for the determination of gemcitabine in human plasma and urine using high-performance

liquid chromatography with ultraviolet detection. J Chromatogr B Biomed Appl 1995;665:171-

181

13. Jusko WJ, Milsap RL. Pharmacokinetic principles of drug distribution in saliva. Ann NY Acad Sci

1993;694:36-47

14. Gemzar package insert (Lilly Canada), 12/12/96.

15. Arcamone F, Cassinelli G, Penco S, Vicario GP, Vigevani A. Chemistry of epirubicin. In: Advances

in anthracycline chemotherapy: epirubicin. Ed. Bonadonna G. Masson Italia Editori. Milano 1984.

pp.3-28

Pharmacokinetics and pharmacogenetics of gemcitabine combined with epirubicin or cisplatin in non-small cell lung cancer patients

Jan Gerard Maring1, Floris M. Wachters2 , Monique Slijfer3 , Marina Maurer4, Marieke H.M.

Boezen5, Donald R.A. Uges6, Elisabeth G.E. de Vries5, Harry J.M. Groen2


Hoogeveen; 2Department of Pulmonary Diseases, University Hospital Groningen; 3De-

partment of Pharmacy, Martini Hospital Groningen; 4University Centre for Pharmacy,

Groningen; Departments of 5Medical Oncology and 6Pharmacy, University Hospital

Groningen, The Netherlands

Submitted

Chapter 9

164

Gemcitabine pharmacokinetics and pharmacogenetics

165

Interaction of statues. Paris. France 1998.

Chapter 9

164


165

Abstract

Aim The pharmacokinetics of gemcitabine and its metabolite 2’,2’-difluorodeoxyuridine

(dFdU) and the influence of a common A79C polymorphism in the cytidine deaminase

gene (CDD) were studied in non-small cell lung cancer patients, treated with gemcitabine

plus epirubicin (EG) or gemcitabine plus cisplatin (GC).

Methods Patients were treated with gemcitabine 1125 mg/m2, followed by epirubicin 100

mg/m2 (EG; n=12) or cisplatin 80 mg/m2 (GC; n=10). Plasma was collected during 3 h after

gemcitabine administration. Gemcitabine and dFdU were quantified by High Perform-

ance Liquid Chromatography (HPLC) with ultraviolet detection. The CDD A79C genotype

was determined with Polymerase Chain Reaction (PCR) and DNA sequencing.

Results Gemcitabine was rapidly cleared from plasma and undetectable after 3 h. The phar-

macokinetics of gemcitabine was the same in the two treatment groups. A plasma Area Under

the Curve (AUC) of 8.3 vs. 7.6 mg.h/L and a half-life of 0.20 vs. 0.16 h were calculated in re-

spectively the EG and GC group. The dFdU half-life was larger in EG compared to GC treated

patients (3.3 vs. 1.2 h; p<0.05). The influence of the CDD A79C genotype was studied in 20

patients. There was a trend towards higher AUC (+16%; p=0.20) and lower clearance values

(-11%; p=0.35) in individuals heterozygous or homozygous for the C-genotype (C/C; A/C;

n=12), compared to homozygotes for the A-genotype (A/A; n=8).

Conclusion The pharmacokinetics of gemcitabine is similar in EG treated compared to

GC treated patients. The influence of a common A79C polymorphism in the CDD gene on

gemcitabine pharmacokinetics is probably only minor.

Introduction

During the last decade, several new chemotherapeutic agents have been evaluated for

their beneficial effect in patients with non-small cell lung cancer (NSCLC). So far, gemci-

tabine plus cisplatin has emerged as one of the standard regimens for the treatment of

advanced NSCLC [1]. Unfortunately, cisplatin can cause nephro-, neuro-, and ototoxicity.

Moreover, cisplatin administration requires pre- and post hydration. Thus, in search for a

better tolerable, easy to administer, non-platinum regimen, the activity of gemcitabine

combined with epirubicin (EG) was studied in our hospital in patients with advanced

NSCLC [2]. Main toxicities of the EG combination, observed during phase I/II trials were

granulocytopenia, thrombocytopenia, febrile neutropenia and mucositis.

Only few reports are available with respect to the pharmacokinetic interaction between

gemcitabine and epirubicin. Perez-Manga et al. studied the pharmacokinetics of gemci-

tabine 800 mg/m2 in the presence of a low dose (25 mg/m2) doxorubicin and found that

the tissue disposition and clearance of both drugs was unchanged [3]. Fogli et al. studied

the pharmacokinetics of 90 mg/m2 epirubicin in the presence of 1000 mg/m2 gemcitab-

Chapter 9

166


167

ine. They concluded that gemcitabine has no effect on epirubicin pharmacokinetics [4].

However, the effect of epirubicin on the gemcitabine pharmacokinetics was not studied.

The clearance of gemcitabine is primarily determined by its degradation into 2’,2’-di-

fluorodeoxyuridine (dFdU) by the enzyme cytidine deaminase [5]. Cytidine deaminase is

ubiquitous in the human body, catalyzing the hydrolytic deamination of (deoxy-)cytidine

to (deoxy-)uridine. The total enzyme capacity of cytidine deaminase in all organs and

tissues determines the biotransformation rate of gemcitabine into dFdU and thereby in-

directly the duration of exposure to gemcitabine. Interestingly, cloning of human cytidine

deaminase has revealed a A79C polymorphism in exon 1 of the CDD gene correspond-

ing with two protein variants (CDD1 and CDD2) with more than 2-fold difference in vitro

deamination rates [6]. The C genotype corresponds to a Gln carrying enzyme (CDD-1) and

the A genotype to a Lys-carrying variant (CDD-2). The CDD-2 enzyme exerts a 1.3 - 3.3 fold

higher deamination rate of cytarabine than CDD-1 [7]. Thus, apart from a possible interac-

tion with epirubicin, the pharmacokinetics of gemcitabine may be affected by this genetic

polymorphism.

The aim of the current study was to determine the pharmacokinetics of gemcitabine in EG

compared to GC treated NSCLC patients. Information on pharmacokinetic and pharmaco-

dynamic interactions between anti-cancer drugs is essential for optimizing the efficacy-

toxicity ratio of a treatment schedule. Additionally, the effect of the A79C polymorphism in

the cytidine deaminase gene in relation to gemcitabine pharmacokinetics was explored.

Patients and methods

Patient selection

This study was performed as a site study of a phase III trial of gemcitabine plus epiru-

bicin versus gemcitabine plus cisplatin (GC) in advanced NSCLC patients [8]. Patients had

to meet the inclusion and exclusion criteria of the main study. In short, patients were

included if they had stage IIIB/IV NSCLC. No prior chemotherapy was allowed. An adequate

bone marrow reserve, normal renal and liver function were required. The glomerular filtra-

tion rate (GFR) was calculated according to the formula of Cockcroft and Gault [9].

Patients were excluded if they had active infections, second primary malignancies, un-

corrected hypercalcaemia or a left ventricular ejection fraction (LVEF) less than 45%. A

detailed description of the inclusion and exclusion criteria is published elsewhere [8]. The

local medical ethics committee of the hospital approved the protocol. All patients gave

informed consent before study entry.

Chapter 9

166


167

Treatment and sample collection

Gemcitabine-Epirubicin group

Gemcitabine (Gemzar®, Lilly, Nieuwegein,The Netherlands) in a dose of 1125 mg/m2 in 250

mL 0.9% NaCl solution was administered as a 30 min infusion on day 1 and day 8. Epiru-

bicin (Farmorubicine®, Pharmacia, Woerden, The Netherlands) in a dose of 100 mg/m2 in

50 mL 0.9% NaCl solution was administered as an intravenous bolus injection over 5 min,

immediately after the end of the gemcitabine infusion, on day 1 of each 21-day cycle. For

pharmacokinetic sampling, a cannula was placed intravenously in the arm of the patient

contralateral to the side of drug administration. Blood samples of 9 mL were collected in

heparinized tubes containing 0.25 mg tetrahydrouridine (THU) in 50 µL water, just before

chemotherapy and at t = 25, 40, 50, 60, 75, 90, 105, 120, 150, 180, 270, 360, 540 and 1320 min

after start of the gemcitabine infusion.

Gemcitabine-Cisplatin group

Gemcitabine (Gemzar, Lilly, Nieuwegein, The Netherlands) in a dose of 1125 mg/m2 in 100

mL 0.9% NaCl solution was administered as a 30 min infusion on day 1 and day 8. Cisplatin

in a dose of 80 mg/m2 in 1000 mL 0.9% NaCl solution was administered as a 3 h infusion,

starting 1 h after the end of the gemcitabine infusion, on day 1 of each 21-day cycle.

Blood samples of 9 mL were collected in heparinized tubes containing 0.25 mg tetrahy-

drouridine (THU) in 50 µL water, just before chemotherapy and at t = 25, 40, 50, 60, 75, 90,

105, 120, 150, 180, and 240 min after start of the gemcitabine infusion. Plasma and saliva

samples were kept frozen at - 20 ºC until analysis.


Gemcitabine hydrochloride, dFdU, 2’,2’-difluorodeoxycytidine monophosphate (dFdCMP),

2’,2’-difluorodeoxycytidine diphosphate (dFdCDP), 2’,2’-difluorodeoxycytidine diphos-

phate (dFdCTP) were obtained from Lilly Co., (Indianapolis, IN). Tetrahydrouridine was

purchased from Calbiochem (La Jolla, CA). All other chemicals were of standard analytical

grade.

The analysis of gemcitabine and dFdU in plasma was carried out as described by Freeman

et al. [10].

Cytidine deaminase genotyping

The CDA exon 1 polymorphism (C/A) at codon position 27 was genotyped by direct se-

quencing, in both directions, of PCR amplified genomic DNA.

First, the CDA region flanking the polymorphic site was amplified using PCR with forward

primer 5’- AGTAGCTTCCCCTTCCAGTAGC and reversed primer 5’-CCTCTTCCTGTACATCTTC-

CTCTG. The 25 µL reactions contained: 2.5 units Taq polymerase (Amersham Biosciences,

Uppsala, Sweden); 0.5 mM dNTP mix (Roche Diagnostics, Mannheim, Germany); 1x PCR

buffer (Roche Diagnostics), 0.05 mM MgCl2; 0.2 µM of each primer; and approximately

Chapter 9

168


169

50 ng genomic DNA. The amplification was performed on a PTC-225 thermal cycler (MJ

Research, Waltham, MA), using a stepdown protocol. The first 5 cycles were carried out at

94 °C, 65 °C, and 72 °C, each for 30 s. The next 5 cyles at 94 °C, 63 °C, and 72 °C, each for 30 s.

The last 25 cyles at 94 °C, 60 °C, and 72 °C, each for 30 s. Following cycling the PCR products

were purified with the Qiagen Qiaquick PCR purification kit (Westburg b.v, Leusden, the

Netherlands). Subsequently, 100 ng of the purified PCR product was cycle sequenced with

a Dyeterminator kit (US81090, Amersham Biosciences, Roosendaal, the Netherlands) in a

thermal cycler (MJ Research), using 0.05 mM sequencing primer. For the reverse reaction

the same primer was used as in the PCR, but for the forward reaction an internal primer

was used (5’-GGTACCAACATGGCCCAGAAG). After the cycle reaction the sequencing

products were cleaned on a Sephadex plate (Amersham Biosciences) by centrifugation

for 5 min at 910 g. The eluted sample was vacuum dried for 45 min at 65 °C. Finally, 20 µL of

loading solution (Amersham Biosciences) was added to dissolve the sequencing products.

The samples were analyzed on a MegaBACE 1000 capillary sequencer (Amersham Bio-

sciences) by injecting the samples for 45 s at 3 kV, and running them for 5 hours at 4 kV. The

data were processed with Sequence Analyser 3.0 (Amersham Biosciences) and Seqman II

(DNASTAR Inc., Madison, WI).

Pharmacokinetic modelling

Pharmacokinetic data were analyzed in Mw\Pharm (version 3.5; MediWare, Groningen,

The Netherlands) using KinFit. For both gemcitabine and epirubicin and their metabolites,

the AUC (trapezoid rule) and elimination half-lifes were calculated by non-compartmen-

tal analysis. Parent drug-metabolite pharmacokinetic relations were analyzed by multi-

compartiment analysis in the ADAPT II Maximum Likelihood Parameter Estimation program

(version 4.0; University of Southern California, Los Angeles, CA). Variance for the observations

was assumed to be proportional to the measured values and set at 10%. The Akaike Informa-

tion Criterion (AIC) was used for model selection. The model with the lowest summarized AIC

value was selected as the better one.


Patient data were analyzed in two groups, based on treatment schedule. Clinical chemistry

and pharmacokinetic data were compared with a two sided Student’s t-test. In case of

unequal variances, as indicated by the Kolmogorov-Smirnov test, data were tested with

the non-parametric Mann-Whitney U-test. The study was powered (>80%) to detect a 30

% difference in population means, assuming a standard deviation in pharmacokinetic

parameters of 30%.

Correlations between clinical chemistry, demographic, pharmacogenetic and pharma-

cokinetic data were tested by Spearman Rank correlation analysis. Statistical significance

was at p<0.05. Analyses were performed with the SYSTAT 7.0 statistical package (SPSS inc.

1997).

Chapter 9

168


169

Results

Patients

Between November 2000 and September 2002 we included 12 patients in the EG group

and 10 patients in the CG group. Patient characteristics of both groups are represented in

table 1. Mean serum creatinine level in EG treated patients was 86 ± 15 µmol/L (mean ±

s.d) and higher compared to 72 ± 13 µmol/L in GC treated patients. The GFR revealed a

lower rate of 74 ± 17 mL/min in EG compared to 93 ± 21 mL/min in GC treated patients

(p<0.02). No differences were observed in other parameters.

Pharmacokinetics

Mean pharmacokinetic curves of gemcitabine and dFdU in plasma are represented in figure

1 for both treatment groups. Gemcitabine was rapidly cleared from plasma and undetectable

after 3 h in all patients. Both gemcitabine and dFdU data were fitted in a parent drug – meta-

bolite model, comprising one compartiment for gemcitabine and two compartiments for

dFdU pharmacokinetics. The pharmacokinetic data of the two groups is represented in table

2. No differences were measured in the pharmacokinetics of gemcitabine. However, the

half-life of dFdU appeared larger in EG compared to GC treated patients. This also resulted

in a larger AUC of dFdU in the EG group. In a Spearman rank correlation analysis, only a weak

correlation was found between dFdU plasma half-life and serum creatinine (R=0.39) or GFR

(R=0.40) (see figure 2).

Table 1 Patient characteristics in both treatment groups.

EG (n=12) GC (n = 10)

Gender (M/F) 10/2 11/1

Age (y) 63 ± 9 65 ± 7

Weight (kg) 77 ± 13 77 ± 13

Length (cm) 178 ± 11 176 ± 4

Body surface area (m2) 1.95 ± 0.21 1.92 ± 0.15

Serum-Creatinine (µmol/L) 86 ± 15 72 ± 13 #

GFR (mL/min) 74 ± 17 93 ± 21 #

Serum-AST (U/L) 23 ± 4 21 ± 6

Serum-ALT (U/L) 35 ± 7 27 ± 8

Serum-LDH (U/L) 101 ± 52 110 ± 47

Serum-ALP (U/L) 239 ± 88 234 ± 59

Serum-Bilirubin (µmol/L) 10 ± 2 12 ± 3

Mean values ± the standard deviation are presented; # different at p<0.05 (Student’s t-test)

Chapter 9

170


171

Table 2 Gemcitabine pharmacokinetic parameters in both treatment groups.

EG (n=12) GC (n = 10)

Gemcitabine

Dose (mg) 2136 ± 173 2180 ± 274

AUC0→3 h

(mg.h/L) 8.3 ± 2.9 7.6 ± 1.5

Vdistribution

(L) 60 ± 20 63 ± 20

Clmetabolic

(L/h) 240 ± 147 298 ± 66

T 1⁄2 elimination

(h) 0.20 ± 0.08 0.16 ± 0.04

dFdU

AUC0→3 h

(mg.h/L) 67 ± 14 56 ± 8 #

T 1⁄2 elimination

(h) 3.3 ± 1.4 1.2 ± 0.2 #

Mean values ± the standard deviation are presented # different at p<0.05 (Student’s t-test)

��

��

��

��

� � � �

��

��

��

��

��

��

��

��

��

��

Figure 1 Pharmacokinetics of gemcitabine and its metabolite dFdU in epirubicin plus gemcitabine and gemcitabine plus cisplatin treated patients after a 30 min infusion of 1125 mg/m2 gemcitabine. Error bars represent the s.d. values.

Chapter 9

170


171

Pharmacogenetic analysis

The pooled gemcitabine pharmacokinetic data of all 22 patients were analyzed with respect

to the influence of the A79C polymorphism in the CDD gene. These data are represented

in table 3. The mean pharmacokinetic curves of gemcitabine and dFdU according to CDD

genotype are represented in figure 3.

The A genotype corresponds to the CDD-2 variant of cytidine deaminase, which has a 2-

fold higher intrinsic activity than the to the C genotype corresponding CDD-1 variant. Our

data indeed show a trend towards higher AUC (+16%; p=0.20) and lower clearance values

(-11%; p=0.35) in individuals heterozygous or homozygous for the C-genotype (C/C; A/C;

n=12), compared to homozygotes for the A-genotype (A/A; n=8).

�

�

�

�

�

�

�

�

��

��

��

��

��

Figure 2 Correlation between serum-creatinine levels and dFdU half-life in non-small cell lung cancer patients treated with a 30 min infusion of 1125 mg/m2 gemcitabine

Table 3 Gemcitabine drug elimination related parameters, as measured in each subgroup ac-cording to cytidine deaminase A79C genotype.

A/A

(n=8)

C/C

(n=4)

A/C

(n=8)

A allele bearing

(n=16)

C allele bearing

(n=12)

AUC (mg.h/L) 8.00 ± 1.56 9.79 ± 3.01 9.31 ± 3.31 8.75 ± 2.70 9.47 ± 3.08

Cl (L/h) 271 ± 50 245 ± 126 239 ± 60 252 ± 56 241 ± 82

T1⁄2 elimination (h) 0.19 ± 0.06 0.20 ± 0.05 0.18 ± 0.06 0.18 ± 0.06 0.18 ± 0.06

Mean values ± the standard deviation are presented

Chapter 9

172


173

Discussion

In this study, we investigated the effect of epirubicin on the pharmacokinetics of gem-

citabine in NSCLC patients treated with both drugs. In all patients gemcitabine was

rapidly cleared from plasma, as was expected from previous reports [11]. We observed

no differences in gemcitabine clearance between EG and GC treated patients, indicat-

ing lack of interaction between gemcitabine and epirubicin. This is in line with previous

findings of Conte et al. who reported that the pharmacokinetics of gemcitabine remains

unchanged in the presence of 175 mg/m2 paclitaxel and 90 mg/m2 epirubicin [12]. It was

known already that cisplatin does not alter gemcitabine pharmacokinetics [13]. Interest-

ingly, the clearance of the gemcitabine metabolite dFdU was lower in EG compared to

GC treated patients. Since dFdU elimination is mainly determined by renal excretion we

analyzed the effect of renal function. Although the renal function was about 20% better

in GC compared to EG treated patients, we only found a weak correlation between dFdU

clearance and serum creatinine or glomerular filtration rate. This suggests that, apart from

renal function, also another factor contributes to the observed difference. We hypothe-

sized that the shorter half-life of dFdU in GC treated patients may in part be the result

of increased dFdU excretion and/or tissue disposition due to pre-hydration measures,

Figure 3 Pharmacokinetics of gemcitabine and its metabolite dFdU after a 30 min infusion of 1125 mg/m2 gemcitabine grouped according to genotype of the cytidine deaminase A79C polymorphism. Error bars represent the s.d. values.

��

��

��

��

� � � � �

��

��

��

��

��

��

��

��

��

��

��

��

Chapter 9

172


173

necessary for cisplatin administration. Enhanced elimination due to hydration is known

to occur for a few drugs, including the anticancer agent methotrexate [14,15]. Another

possibility could be an interaction between dFdU and cisplatin or epirubicin. Interestingly,

increased elimination of dFdU has also been reported by Van Moorsel et al. when they

administered gemcitabine 4 hours after cisplatin compared to 4 h before cisplatin [13].

In our study, the cisplatin administration was started 1 h after the end of the gemcitabine

infusion in GC treated patients. Thus, dFdU pharmacokinetics may have been influenced

by the presence of cisplatin. Since dFdU is considered to be biologically inert, the observed

difference was considered of no clinical importance [16].

The most important factor that determines the clearance rate of gemcitabine is the

activity of the enzyme cytidine deaminase. This enzyme rapidly catabolizes gemcitabine.

The enzyme capacity of cytidine deaminase in all organs and tissues determines the

biotransformation rate of gemcitabine into dFdU and thus the duration of exposure to

gemcitabine. Therefore, we determined whether gemcitabine metabolism was affected

by a known A79C polymorphism in exon 1 of the CDD encoding gene. The C genotype

corresponds to the Gln carrying enzyme (CDD-1) and the A genotype to the Lys-carrying

natural variant (CDD-2). The CDD-2 enzyme has been shown to exert a 1.3 - 3.3 fold higher

deamination rate of cytarabine than CDD-1 [7]. The frequencies of the A/A, A/C and C/C

genotype were 42%, 37% and 21% respectively in our study. We observed no large dif-

ferences in gemcitabine clearance between the different genotypes. Our data showed a

trend towards higher AUC and lower clearance values in individuals who are heterozygous or

homozygous for the C-genotype, compared to homozygotes for the A-genotype. These dif-

ferences however did not reach statistical significance. The observed difference in clearance

was 11% and in AUC 16%, while the standard deviation reached nearly 33%. Based on these

data, we calculated that at least 120 patients are required to proof the influence of the A79C

polymorphism on gemcitabine pharmacokinetics.

Interestingly, recently two new polymorphisms in the CDD gene have been reported.

These concern the G208A and T435C polymorphism with allele frequencies of 4.3% and

70.1% respectively [17]. The G208A polymorphism produces a alanine to threonine sub-

stitution (A70T) within the conserved catalytic domain. Introduction of this gene in yeast

null mutants, resulted in a 20% reduction of the 50% inhibitory concentration value for

cytarabine [17]. The impact of this polymorphism on gemcitabine clearance is unclear.

The presence of several polymorphisms in the cytidine deaminase gene, with at least two

affecting the catalytic domain, may partly explain the interindividual variability in enzyme

activity. Since two polymorphisms already result in nine different genotypes, the full phar-

macogenetic picture of cytidine deaminase in relation to gemcitabine clearance may be

quite complex and can only be elucidated in larger clinical trials.

We conclude that the pharmacokinetics of gemcitabine is similar in EG treated compared

to GC treated patient. The influence of a common A79C polymorphism in the cytidine

deaminase gene on gemcitabine pharmacokinetics is probably only minor.

Chapter 9

174


175

References

1. Schiller JH, Harrington D, Belani CP, Langer C, Sandler A, Krook J, Zhu J, Johnson DH; Eastern Coop-

erative Oncology Group. Comparison of four chemotherapy regimens for advanced non-small-

cell lung cancer. N Engl J Med 2002;346:92-98

2. van Putten JW, Eppinga P, Erjavec Z, de Leede G, Nabers J, Smeets JB, Th Sleijfer D, Groen HJ. Activ-

ity of high-dose epirubicin combined with gemcitabine in advanced non-small-cell lung cancer:

a multicenter phase I and II study. Br J Cancer 2000;82:806-811

3. Perez-Manga G, Lluch A, Alba E, Moreno-Nogueira JA, Palomero M, Garcia-Conde J, Khayat D, Riv-

elles N. Gemcitabine in combination with doxorubicin in advanced breast cancer: final results of

a phase II pharmacokinetic trial. J Clin Oncol 2000;18:2545-2552

4. Fogli S, Danesi R, Gennari A, Donati S, Conte PF, Del Tacca M. Gemcitabine, epirubicin and paclitax-

el: pharmacokinetic and pharmacodynamic interactions in advanced breast cancer. Ann Oncol

2002;13:919-927

5. Grunewald R, Abbruzzese JL, Tarassoff P, Plunkett W. Saturation of 2’,2’-difluorodeoxycytidine 5’-

triphosphate accumulation by mononuclear cells during a phase I trial of gemcitabine. Cancer

Chemother Pharmacol 1991;27:258-262.

6. Kirch HC, Schroder J, Hoppe H, Esche H, Seeber S, Schutte J. Recombinant gene products of two


cytarabine in vitro. Exp Hematol 1998;26:421-425.

7. Kirch HC, Schroder J, Hoppe H, Esche H, Seeber S, Schutte J. Recombinant gene products of two


cytarabine in vitro. Exp Hematol 1998;26:421-425

8. Wachters FM, Van Putten JW, Kramer H, Erjavec Z, Eppinga P, Strijbos JH, de Leede GP, Boezen HM,

de Vries EG, Groen HJ. First-line gemcitabine with cisplatin or epirubicin in advanced non-small-

cell lung cancer: a phase III trial. Br J Cancer 2003;89:1192-1199

9. Cockcroft DW, Gault MH. Prediction of creatinine clearance from serum creatinine. Nephron

1976;16:31-41

10. Freeman KB, Anliker S, Hamilton M, Osborne D, Dhahir PH, Nelson R, Allerheiligen SR. Validated as-

says for the determination of gemcitabine in human plasma and urine using high-performance

liquid chromatography with ultraviolet detection. J Chromatogr B Biomed Appl 1995;665:171-

181

11. Abbruzzese JL, Grunewald R, Weeks EA, Gravel D, Adams T, Nowak B, Mineishi S, Tarassoff P, Satter-

lee W, Raber MN, et al. A phase I clinical, plasma, and cellular pharmacology study of gemcitabine.

J Clin Oncol 1991;9:491-498.

12. Conte PF, Gennari A, Donati S, Salvadori B, Baldini E, Bengala C, Pazzagli I, Orlandini C, Danesi R,

Fogli S, Del Tacca M. Gemcitabine plus epirubicin plus taxol (GET) in advanced breast cancer: a

phase II study. Breast Cancer Res Treat 2001;68:171-179.

13. van Moorsel CJ, Kroep JR, Pinedo HM, Veerman G, Voorn DA, Postmus PE, Vermorken JB, van

Groeningen CJ, van der Vijgh WJ, Peters GJ. Pharmacokinetic schedule finding study of the com-

Chapter 9

174


175

bination of gemcitabine and cisplatin in patients with solid tumors. Ann Oncol 1999;10:441-448

14. Kinoshita A, Kurosawa Y, Kondoh K, Suzuki T, Manabe A, Inukai T, Sugita K, Nakazawa S. Effects

of sodium in hydration solution on plasma methotrexate concentrations following high-dose

methotrexate in children with acute lymphoblastic leukemia. Cancer Chemother Pharmacol

2003;51:256-260

15. Relling MV, Fairclough D, Ayers D, Crom WR, Rodman JH, Pui CH, Evans WE. Patient characteristics

associated with high-risk methotrexate concentrations and toxicity. J Clin Oncol 1994;12:1667-

1672

16. Plunkett W, Huang P, Xu YZ, Heinemann V, Grunewald R, Gandhi V. Gemcitabine: metabolism,

mechanisms of action, and self-potentiation. Semin Oncol 1995;22(4 Suppl 11):3-10

17. Yue L, Saikawa Y, Ota K, Tanaka M, Nishimura R, Uehara T, et al. A functional single-nucleotide

polymorphism in the human cytidine deaminase gene contributing to ara-C sensitivity. Pharma-

cogenetics 2003;13:29-38

Summary

178

Summary

179

View from the sky. Chicago, USA 2003.

Summary

178

Summary

179

Summary

Pyrimidine antagonists belong to the group of antimetabolite anti-cancer drugs and

show structural resemblance with naturally occurring nucleotides. Their action is accom-

plished through the incorporation as false precursors in DNA or RNA or through inhibi-

tion of proteins involved in nucleotide metabolism. The most commonly used pyrimi-

dine antagonists are 5-fluorouracil, gemcitabine and cytarabine. Newer oral variants of

5-fluorouracil are capecitabine and tegafur. 5-Fluorouracil and its analogues are used e.g.

in the treatment of colorectal-, breast- and head and neck cancer, whereas gemcitabine

is especially prescribed for non-small cell lung cancer and pancreatic cancer. Cytarabine

is used in the treatment of leukemia. All pyrimidine antagonists are prodrugs and in-

tracellular conversion into cytotoxic nucleosides and nucleotides is needed to produce

cytotoxic metabolites. Proteins, involved in pyrimidine metabolism handle these synthetic

drugs, as if they were naturally occurring substrates. The extensive metabolism of pyrimi-

dine antagonists implies that the intracellular concentrations of cytotoxic metabolites,

largely depend on intracellular metabolic enzyme activity. Therefore, understanding of

the genetics of metabolizing enzymes and the range of (iso)enzyme kinetics involved is

essential for the optimal subscription of these anticancer drugs.

In this thesis, a number of pharmacokinetic and pharmacogenetic aspects of pyrimidine

antagonist chemotherapy are evaluated in relation to safe use of these agents. Better

knowledge of factors that have critical impact on pharmacokinetics and/or pharmacody-

namics may help to reduce the incidence of side effects.

Genetic factors at least partly explain interindividual variation in anti-tumor efficacy

and toxicity of pyrimidine antagonists. In chapter 2, proteins relevant for the efficacy

and toxicity of pyrimidine antagonists are described. In addition, the role of germ-line

polymorphisms, tumor specific somatic mutations and protein expression levels in the

metabolic pathways and clinical pharmacology of these drugs are discussed. With respect

to the 5-fluorouracil metabolic pathway, germ-line polymorphisms have been reported

in uridine monophosphate kinase (UMPK), orotate phosphoribosyl transferase (OPRT),

thymidylate synthase (TS), dihydropyrimidine dehydrogenase (DPD), and methylene

tetrahydrofolate reductase (MTHFR). The impact of most germ-line polymorphisms is not

yet clear. Mutations in the dihydropyrimidine dehydrogenase gene are however highly

associated with DPD enzyme deficiency and can result in life threatening toxicity after

5-fluorouracil chemotherapy due to reduced 5-fluorouracil catabolism. Furthermore, the

impact of a triple tandem repeat polymorphism in the promoter enhancer zone of the

thymidylate synthase gene has been studied in a number of small trials, but remains to be

established.

In addition, intratumoral gene expression levels of uridine monophosphate kinase, orotate

Summary

180

Summary

181

phosphoribosyl transferase, thymidylate synthase, dihydropyrimidine dehydrogenase,

uridine phosphorylase, uridine kinase, thymidine phosphorylase, thymidine kinase, and

dUTP nucleotide hydrolase have been studied in relation to 5-fluorouracil efficacy. Most

interesting results have been reported with respect to dihydropyrimidine dehydrogenase,

thymidylate synthase, thymidine phosphorylase, and orotate phosphoribosyl transferase

expression levels. High intratumoral expression levels of both dihydropyrimidine dehy-

drogenase and thymidylate synthase may be associated with decreased sensitivity of

tumor cells to 5-fluorouracil, but this remains to be established.

Regarding the gemcitabine and cytarabine metabolic pathway, germ line polymorphisms

in cytidine deaminase (CDA) and 5’-nucleotidase (5NT) have been reported, but the

impact of these polymorphisms on the efficacy of these drugs is hardly explored. Interest-

ing results were obtained with regard to intratumoral gene expression levels of cytidine

deaminase, 5’-nucleotidase and deoxycytidine kinase in relation to cytarabine efficacy,

but these need to be further explored in larger clinical trials.

In section A, involving chapters 3, 4.1, 4.2 and 5, several pharmacokinetic and pharma-

cogenetic aspects of 5-fluorouracil in colorectal cancer patients are explored.

A simple and sensitive high performance liquid chromatographic method with UV

detection was developed for the determination of both 5-fluorouracil and its metabo-

lite 5,6-dihydrofluorouracil in small volume plasma samples. The method is presented in

chapter 3. It is characterized by isocratic elution at ambient temperature on a C18 5 µm

column and subsequent ultraviolet diode array detection. The limits of quantification in

plasma were 0.040 µg /mL for 5-fluorouracil and 0.075 µg/mL for 5,6-dihydrofluorouracil.

The method appeared linear over a range from 0.04-15.90 µg/mL for 5-fluorouracil, and

from 0.075-3,84 µg/mL for 5,6-dihydrofluorouracil. Compared to previous methods, the

extraction procedure was simplified and the required sample size was reduced to only

100 µL.

The impact of liver metastases and liver function on 5-fluorouracil pharmacokinetics has

long remained unclear. In most clinical trials, only patients with good performance status

and adequate organ functions are included. However in actual practice, many patients

with compromised performance status and/or inadequate renal or liver function are

treated with chemotherapy.

In chapter 4.1 the influence of liver metastases on the pharmacokinetics of 5-fluorouracil

and its metabolite 5,6-dihydrofluorouracil is described in 33 patients with gastrointes-

tinal cancers. Patients were assigned to two different groups based on the presence or

absence of liver metastases. Chemotherapy consisted of 5-fluorouracil plus leucovorin

according to the Mayo Clinics schedule. Blood sampling was carried out on the first day

of the first chemotherapy cycle. A multi-compartiment Michaelis-Menten model was

developed for simultaneous analysis of 5-fluorouracil and 5,6-dihydrouracil pharmaco-

kinetic data. Extensive hepatic replacement due to liver metastases did not influence

Summary

180

Summary

181

the clearance of 5-fluorouracil and its metabolite. From the study it was concluded

that there is no need for dose adjustment of 5-fluorouracil as a standard procedure in

patients with liver metastases and mild to moderate elevations in liver function tests.

One of the patients who participated in the liver metastases study experienced more

than expected toxicity. Further research was subsequently initiated to elucidate the

cause of this and results are presented in chapter 4.2. 5-Fluorouracil pharmacokinetics,

dihydropyrimidine dehydrogenase-activity and DNA sequence analysis were compared

between an index patient with extreme 5-fluorouracil induced toxicity and six control

patients with normal 5-fluorouracil related symptoms. The 5-fluorouracil area under

the curve (AUC) in the index patient was about 2.5 timer higher, and the clearance 2.5

times lower than in control patients. The activity of dihydropyrimidine dehydrogenase

in blood mononuclear cells of the index patient was 50% of that in controls. Sequence

analysis of the dihydropyrimidine dehydrogenase gene revealed that the index patient

was heterozygous for a IVS14+1G→A point mutation. These results indicate that the

inactivation of one dihydropyrimidine dehydrogenase allele can result in a strong

reduction in 5-fluorouracil clearance, causing severe 5-fluorouracil induced toxicity.

The case of the dihydropyrimidine dehydrogenase deficient patient illustrates the impact

of dihydropyrimidine dehydrogenase deficiency on 5-fluorouracil pharmacokinetics. The

prevalence of dihydropyrimidine dehydrogenase deficiency has been estimated 1-2% in

the Caucasian population. During the last decade, several methods have been proposed

for early detection of dihydropyrimidine dehydrogenase deficiency, including genotyp-

ing, measurement of endogenous uracil/dihydrouracil plasma levels and measurement

of dihydropyrimidine dehydrogenase activity in peripheral mononuclear blood cells. For

general large scale purposes however, these methods are too expensive and/or lack sen-

sitivity.

Therefore, the pharmacokinetics of uracil after oral administration was studied with the

aim to develop a cheap and easy oral Uracil Challenge Test. Chapter 5 contains a prelimi-

nary report about the potential clinical use of such a test for dihydropyrimidine dehydro-

genase phenotyping. The pharmacokinetics of uracil and its metabolite 5,6-dihydrouracil

after oral administration of an uracil challenge dose were studied in 12 human volun-

teers and in one patient with dihydropyrimidine dehydrogenase deficiency. All subjects

ingested 500 mg/m2 uracil as an oral solution on an empty stomach. Blood sampling was

carried out during 4 h after oral intake. All volunteers had dihydropyrimidine dehydroge-

nase activities within normal range, but in the patient it was reduced due to heterozygos-

ity for missense mutation D949V in exon 22 and I543V polymorphism in exon 13 of the

dihydropyrimidine dehydrogenase gene. Uracil plasma concentrations at 1 and 2 h and

the uracil AUC were increased in the patient and differed more than 2 standard deviations

from mean values in volunteers. These preliminary results indicate that further research in

a larger number of previously characterized, partially dihydropyrimidine dehydrogenase

Summary

182

Summary

183

deficient patients is warranted, to determine its use in pre-chemotherapy phenotyping for

early detection of dihydropyrimidine dehydrogenase deficiency.

In section B, involving chapters 6, 7, 8, and 9, focus is placed on clinical pharmacologi-

cal, pharmacokinetic and pharmacogenetic aspects of gemcitabine in the treatment of

patients with non-small cell lung cancer.

Gemcitabine has been recognized as a potent radiosensitizer, and as such, an interesting

candidate for pre-radiotherapy radiosensitization in non-small cell lung cancer patients.

The mechanism of gemcitabine mediated radiosensitization is yet poorly understood.

Inhibition of DNA double-strand break repair by nonhomologous end-joining was previ-

ously excluded as a means of radiosensitization. In chapter 6 is explored whether gem-

citabine affects either homologous recombination-mediated double strand break repair

or base excision repair. Gemcitabine-mediated radiosensitization in cell lines deficient

in base excision repair or deficient in homologous recombination were compared with

that in their base excision repair-proficient and homologous recombination-proficient

parental counterparts. Sensitization to mitomycin C was also investigated in cell lines

deficient and proficient in homologous recombination. Mitomycine C is known to cause

DNA double strand breaks by interstrand cross-links and repair of these cross-links is es-

pecially dependent on homologous recombination. In addition, the effect of gemcitabine

on Rad51 foci formation after irradiation was studied. Rad51 foci are thought to represent

homologous recombination. Gemcitabine did induce radiosensitization in base excision

repair-deficient cells; however, the respective mutant cells deficient in homologous re-

combination did not show gemcitabine-mediated radiosensitization. In homologous re-

combination-proficient, but not in homologous recombination-deficient cells, gemcitabi-

ne also induced substantial enhancement of the cytotoxic effect of mitomycine. Finally,

it was observed that gemcitabine interferes with Rad51 foci formation after irradiation.

From this study was concluded that gemcitabine causes radiosensitization by specific

interference with homologous recombination.

A frequently prescribed chemotherapy schedule for the treatment of stage IIIB/IV non-

small cell lung cancer is the combination of gemctabine with cisplatin. Unfortunately,

cisplatin can cause nephro-, neuro-, and ototoxicity. Moreover, cisplatin administration

requires pre- and post hydration. The combination of gemcitabine plus epirubicin has

been proposed as an alternative treatment schedule, that can be administered in out-

patient setting. This schedule was well tolerated in phase 1/2 clinical trials. Mucositis was

reported as the main non-hematological toxicity. Therefore the excretion of gemcitabine

and epirubicin in saliva was studied in non-small cell lung cancer patients treated with

both drugs, in order to estimate the relative contribution of salivary excretion to total drug

exposure of mucosal cells in the oral cavity and upper gastrointestinal tract.

The high performance liquid chromatography (HPLC) method used for determination of

Summary

182

Summary

183

epirubicin and epirubicinol in plasma and saliva is described in chapter 7. Preparation of

saliva and plasma samples was performed by extraction in organic extraction fluid. The

chromatographic analysis was carried out by reversed-phase isocratic elution on a C18 5

µm column. The detection was performed with spectrofluorimetry. The method appeared

linear over a concentration range of 5 to 1000 µg/L for epirubicin and 2 to 400 µg/L for

epirubicinol in both saliva and plasma. The lower limit of quantification was 5 µg/L for

epirubicin and 2 µg/L for epirubicinol. The method proved to be precise and accurate.

The excretion in saliva of gemcitabine and epirubicin and their main metabolites dFdU

and epirubicinol was studied in 12 patients and is described in chapter 8. Gemcitabine

was detectable in saliva only during the first hour after infusion. The Cmax

in saliva was 0.66

± 0.61 mg/L and the saliva/plasma ratio was 0.038 ± 0.037. The epirubicin concentration in

saliva 6 h after administration was 55 ± 27 µg/L and decreased to 28 ± 14 µg/L at 22 h. The

corresponding saliva/plasma ratios were 1.28 ± 0.73 and 1.72 ± 1.00. The absolute amount

of drug excreted in saliva was for both anticancer agents estimated under 0.2% of the ad-

ministered dose. Is was therefore concluded that, although gemcitabine and epirubicin as

well as their main metabolites dFdU and epirubicinol are excreted in detectable amounts

in saliva, their absolute amounts in saliva remain relatively low.

Another issue that was explored in this thesis concerns the possible pharmacokinetic in-

teraction of gemcitabine and epirubicin when both drugs are used concurrently. Only few

reports are available with respect to the pharmacokinetics of this particular drug com-

bination. Information on pharmacokinetic and pharmacodynamic interactions of anti-

cancer drugs is essential for optimizing the efficacy-toxicity ratio of a treatment schedule.

Therefore a study was initiated to determine the pharmacokinetics of gemcitabine in

gemcitabine-epirubicin compared to gemcitabine-cisplatin treated non-small cell lung

cancer patients. Additionally, the effect of a common A79C polymorphism in the cytidine

deaminase gene in relation to gemcitabine pharmacokinetics was explored. The results of

this study are presented in chapter 9. Patients were treated with gemcitabine followed by

epirubicin (n=12) or cisplatin (n=10). Plasma was collected during 3 h after administration

of gemcitabine. The pharmacokinetics of gemcitabine was similar in both treatment groups.

The half-life of 2’,2’ difluorodeoxyuridine was larger in epirubicin- compared to cisplatin

co-treated patients. Although the renal function was about 20% better in gemcitabine-

cisplatin treated patients, we only found a weak correlation between 2’,2’ difluorodeoxy-

uridine clearance and serum creatinine (R=0.39) or glomerular filtration rate (GFR; R=0.40)

in a spearman rank correlation analysis. This suggests that, apart from renal function, also

another factor contributes to the observed difference.

We hypothesized that this might be due to increased 2’,2’-difluorodeoxyuridine excretion

and/or tissue disposition, as a result of pre-hydration measures, necessary for cisplatin

administration. Another possibitly could be an interaction of epirubicin or cisplatin with

Summary

184

2’,2’-difluorodeoxyuridine. Since 2’,2’-difluorodeoxyuridine has no cytotoxic potential, the

observed difference was considered as clinically irrelevant.

The influence of the cytidine deaminase A79C genotype was studied in 20 patients. PCR

plus DNA sequencing was performed to determine the genotype. A trend towards slightly

higher AUC (+16%) and little lower clearance values (-11%) was observed in individuals het-

erozygous or homozygous for the C-genotype (C/C; A/C; n=12), compared to homozygotes for

the A-genotype (A/A; n=8). Based on these data, it can be calculated that at least 120 patients

would be required to elucidate the precise role of the A79C polymorphism. It was concluded

that the pharmacokinetics of gemcitabine is similar in epirubicin- compared to cisplatin

co-treated patients. There was a small 10-15%, not significant influence of a common

A79C polymorphism in the cytidine deaminase gene on gemcitabine pharmacokinetics.

186

General discussion and future perspectives

187

Back to the future. NASA. Florida USA 2002.

186

General discussion and future perspectives

187

General discussion en future perspectives

The aim of this thesis was to clarify the role of a number of potential factors in the clinical

pharmacology and pharmacogenetics of pyrimidine antagonists related to the occur-

rence of side effects.

To date, the impact of genetic testing in clinical practice is only minor and mainly re-

stricted to patients with specific pharmacogenetic syndromes, such as dihydropyrimidine

dehydrogenase deficiency. In the near future, possibly as a result of further development

of micro-array techniques, a process of tumor “chemotyping” might precede drug dosing.

Based on germ-line DNA polymorphisms combined with tumor specific mRNA or protein

expression patterns, individualization of chemotherapy may become daily practice. Pre-

diction of non-responders can prevent unnecessary treatment and save treatment costs,

but far more large clinical trials are needed to elucidate, optimize and validate such an

approach.

In the mean time, a 1-2% prevalence of dihydropyrimidine dehydrogenase deficiency in

the population can not be fully ignored in relation to the high number of patients that

are each year treated with 5-fluorouracil. A Number Needed to Genotype in the range

of 50-100 patients to prevent one serious event has so far been considered as too high

to justify routine screening, due to high costs of current screening methods. However, a

Uracil Challenge Test, as proposed in this thesis, may be an effective approach for routine

pre-chemotherapy dihydropyrimidine dehydrogenase phenotyping at reasonable cost.

Very preliminary results of this approach at least indicate that further research in a larger

number of previously characterized, partially dihydropyrimidine dehydrogenase deficient

patients is warranted to establish the sensitivity of this method. In the near future, the

use of LC-MS/MS techniques in stead of standard HPLC for analysis of uracil may even

minimize sample preparation and increase sample throughput time.

With respect to gemcitabine, a small impact of the cytidine deaminase A79C genotype

on the pharmacokinetics was observed. The current findings, however, do not exclude the

A79C polymorphism from a larger panel of factors that together determine the interindi-

vidual variation in gemcitabine pharmacokinetics. We calculated that at least 120 patients

are needed to elucidate the exact role of the A79C polymorphism for gemcitabine phar-

macokinetics. Since, recently, a number of new polymorphisms in the cytidine deaminase

gene have been discovered, a combined analysis of all known polymorphisms in relation

to gemcitabine pharmacokinetics may be needed to establish the impact of genetic

factors on cytidine deaminase mediated gemcitabine catabolism more precisely.

We observed that in tumor cell lines gemcitabine causes radiosensitization by specific

interference with homologous recombination, while non-homologous end-joining and

base excision repair are unaffected. It is however yet unclear which step in the pathway of

homologous recombination is inhibited. Based on current results, it was speculated that

188

gemcitabine might interfere with the DNA polymerization step in homologous recombi-

nation, thereby halting the process. This has to be established experimentally. Based on

current and previous in vitro data, we hypothesized that gemcitabine may be a tumor-

selective radiosensitizer. This, however, has so far not been confirmed in current clinical

trials investigating gemcitabine induced radiosensitization in locally advanced non-small

cell lung cancer. In recent phase I/II clinical trials the feasibility of gemcitabine/radiation

therapy has been shown with potential interesting results. Additional clinical trials are

warranted to assess the long-term efficacy and safety of gemcitabine in combination with

other chemotherapeutic agents and radiation therapy.

Regarding the impact of a number of non-inherited factors on pyrimidine antagonist

chemotherapy, this thesis showed that hepatic replacement due to liver metastases with

concurrent mild to moderate elevations in liver function tests has minor impact on the

pharmacokinetics of 5-fluorouracil. The dihydropyrimidine dehydrogenase activity in

liver metastases appears largely to compensate the dihydropyrimidine dehydrogenase

activity of replaced liver tissue. As a result, 5-fluorouracil dose reduction should not be

performed as a standard procedure in patients with liver metastases, accompanied by

mild to moderate elevations in liver function tests. Since, no patients with CTC grade 4

disturbances in liver function tests were included in the study, it is still unclear whether

dose reduction may be needed in this subgroup.

The last issue explored in this thesis, is the pharmacokinetic interaction of gemcitabine

and epirubicin. Both drugs appear not to interact with respect to plasma pharmacokinet-

ics. This implicates that schedule optimization procedures to improve efficacy may include

variations in the order of drug administration (gemcitabine before epirubicin or the

reverse) without consequences for pharmacokinetics. However, the use of this anticancer

drug combination has been terminated based on phase 3 trial results. Progression-free

survival, overall survival, response rate, and quality of life were not different between the

gemcitabine-epirubicin and gemcitabine-cisplatin combination, however, overall toxicity

was more severe in the gemcitabine-epirubicin arm. Therefore, further exploration of this

treatment schedule in non-small cell lung cancer is no current topic.

Samenvatting

190

Samenvatting

191

Klompen, Molens &…Kaas. Alkmaar 1998.

Samenvatting

190

Samenvatting

191

Samenvatting

Pyrimidine-antagonisten zijn antikanker-medicijnen die wat betreft hun chemische

structuur grote gelijkenis vertonen met in het lichaam voorkomende bouwstenen van

DNA en RNA. Door deze grote overeenkomst worden ze door het lichaam ingebouwd in

het DNA of RNA. Als gevolg hiervan ontstaan fouten in de DNA- en RNA-structuur en kan

celdeling niet meer plaatsvinden. Verder kan door pyrimidine-antagonisten blokkering

van eiwitten plaatsvinden die een rol spelen in de opbouw van het DNA of RNA. Dit alles

resulteert in afsterving van de cel.

DNA duplicatieDNA bestaat uit een dubbelstrengs gedraaide helix. De erfelijke code is vastgelegd in de volgorde van de bouw-stenen, die worden aangeduid met de letters A, C, G en T. Binnen de dubbele helix zijn de twee strengen met elkaar verbonden: tegenover elke A past alleen een T, tegenover elke C past alleen een G. Hierdoor is DNA in staat zichzelf te kopiëren: door de dubbele streng uit elkaar te draaien en op elke enkele streng tegenover elke vrijgekomen A, C, G of T positie de passende bouwsteen te plaatsen ontstaan twee nieuwe dubbelstrengs DNA ketens.

� � � � � � �

� � � � � � �

� � � � � � �

� � � � � � �

� � � � � � �

� � � ��

� � � � � � �

� � � � � � ��

� � � � � � �

� � � � � � �

� � � �

Door ingebouwde cytostatica (X), onstaan fouten in de DNA code. Het kopieerproces loopt mis of stopt en de cel kan niet meer delen en sterft af.

Veel toegepaste pyrimidine-antagonisten zijn 5-fluorouracil, gemcitabine en cytarabine.

Nieuwe varianten van 5-fluorouracil zijn capecitabine en tegafur.

5-Fluorouracil wordt toegepast bij de behandeling van dikke-darmkanker, borstkanker en

hoofd- en hals tumoren. Gemcitabine wordt vooral bij longkanker en bij alvleesklierkan-

ker toegepast, cytarabine hoofdzakelijk bij de behandeling van leukemie. Alle pyrimidine-

antagonisten zijn zogenaamde pro-drugs. Ze moeten namelijk in het lichaam geactiveerd

worden voordat ze hun toxische werking kunnen uitoefenen. Dit betekent dat de hoeveel-

heid geactiveerde stof in tumorcellen mede afhankelijk is van de mate van activering

door lichaamseigen eiwitten. Een goed inzicht in de farmacogenetische aspecten en

werkingswijze van eiwitten die betrokken zijn bij de activering van pyrimidine-antagonis-

ten is dus belangrijk om deze middelen optimaal te kunnen doseren.

Samenvatting

192

Samenvatting

193

Een belangrijk doel van de kankerbehandeling is ervoor te zorgen het maximale

antitumor-effect te bewerkstelligen, terwijl de bijwerkingen zo beperkt mogelijk blijven.

Genetische factoren bepalen mede de eiwitactiviteit en verklaren daarom ook deels de

interindividuele verschillen in antitumor-effectiviteit en toxiciteit van pyrimidine-antago-

nisten.

Van DNA naar eiwitDNA codeert voor eiwitten. Eiwitten zijn opgebouwd uit reeksen aminozuren. In het menselijk lichaam worden 20 verschillende aminozuren toegepast in eiwitten. Om van DNA tot eiwit te komen wordt één van de DNA strengen afgelezen, waarbij een enkele streng RNA wordt gevormd. Dit proces heet DNA transcriptie. De bouw-stenen van RNA zijn gelijk aan die van DNA, met één uitzondering: op de plaats van T komt een U. Een set van drie bouwstenen van RNA (een codon) correspondeert met 1 aminozuur van de te vormen eiwitketen.

��

� � � � � � � � �

� � � � � � � � �

� � � � � � � � � ��

Hier codeert UGG voor het aminozuur tryptofaan (Trp), UCU voor serine (Ser) en AAU voor asparagine (Asn). De stap van RNA naar eiwit heet translatie.

Figuur 1 Verschillende factoren hebben invloed op de werking van een geneesmiddel. Dit zijn enerzijds erfelijke factoren, anderzijds ‘omgevingsfactoren’. Alle factoren tezamen bepalen de mate van werkzaamheid van een middel op individueel niveau.

��

��

��

��

��

��

��

��

��

��

��

��

In dit proefschrift zijn een aantal farmacokinetische en farmacogenetische aspecten van

pyrimidine-antagonisten onderzocht in relatie tot veiliger gebruik van deze medicijnen.

Farmacokinetiek bestudeert het gedrag van een geneesmiddel in het lichaam, zoals

verdeling naar weefsel, omzetting in inactieve stoffen en uitscheiding door nieren en

lever. Farmacogenetica bestudeert de relatie tussen werking van het geneesmiddel en

gencodering in het DNA.

In hoofdstuk 2, een literatuurstudie, worden de enzymen, waarvan bekend is dat ze een

Samenvatting

192

Samenvatting

193

rol spelen in het metabolisme van pyrimidine-antagonisten op een rij gezet. Vervolgens

wordt de rol van DNA polymorfismen in de kiembaan (variaties in DNA-codering), van tu-

morcelspecifieke somatische DNA mutaties (in de tumorcel ontstane DNA veranderingen)

en van eiwitactiviteit voor elk enzym apart besproken.

DNA mutaties en DNA polymorfismen in de kiembaanDNA codeert voor eiwitten. In de erfelijke code van het DNA komen echter natuurlijke variaties voor. Als een variatie in meer dan 1% van de populatie voorkomt heet dit een polymorfisme. Meer zeldzame variaties heten mutaties. De meeste polymorfismen zijn veranderingen in slechts 1 bouwsteen van de DNA keten. Deze kunnen echter enorme gevolgen hebben voor de werkzaamheid en/of functie van het eiwit waarvoor het codeert. Hieronder een voorbeeld:DNA, RNA en eiwit van persoon 1:

� � � � � � � � � � � � � � � � � � ��

� � � � � � � � � � � � � � � � � � ��

In persoon 2 is op de derde positie in het DNA de C veranderd in een A. Dit heeft tot gevolg dat in RNA wordt gecodeerd voor UGU, wat correspondeert met aminozuur cysteïne (Cys). De eigenschappen van het eiwit kunnen hierdoor zijn veranderd. Als bijvoorbeeld het eiwit de afbraak van een geneesmiddel bepaalt en het eiwit in persoon 1 is daarin effectiever dan dat van persoon 2, dan blijft het geneesmiddel langer in het lichaam van persoon 2. Dosisaanpassing kan nodig zijn.

Somatische mutatiesVeranderingen in het DNA kunnen ook optreden tijdens een levenscyclus van een cel. Meestal vindt reparatie plaats van fouten in DNA. Als een fout niet wordt opgemerkt en wordt doorgegeven aan dochtercellen heet dit een somatische mutatie. Een kritische somatische mutatie kan grote gevolgen hebben voor de dochtercellen. Kanker wordt veroorzaakt door een reeks van somatische mutaties in genen die een rol spelen bij celdeling en celgroei.

Uit deze literatuurstudie blijkt dat studies naar de invloed van tumorcelspecifieke so-

matische DNA-mutaties op de effectiviteit en bijwerkingen van de behandeling met

pyrimidine-antagonisten tot dusver klein van opzet zijn. Het is nagenoeg onmogelijk om

conclusies te trekken uit beschikbare onderzoeksgegevens, wegens onvoldoende sta-

tistische onderbouwing, verschillen in onderzoekspopulatie en onderzoekstechnieken.

Daarentegen is met betrekking tot DNA polymorfismen in de kiembaan in de afgelopen

jaren duidelijk geworden dat bij patiënten met defecten aan het dihydropyrimidine-

dehydrogenase-gen zeer ernstige bijwerkingen kunnen optreden na toediening van 5-

fluorouracil. Dit gendefect komt voor bij ongeveer 1-2% van de bevolking. Screening op

een tekort aan dihydropyrimidine-dehydrogenase (DPD-deficiëntie) voorafgaand aan de

5-fluorouracil toediening wordt momenteel echter nog te duur geacht.

De precieze rol van genetica voor de dagelijkse praktijk ten aanzien van de behandeling

met pyrimidine-antagonisten is voor de korte termijn dus nog onduidelijk. DNA-onderzoek

Samenvatting

194

Samenvatting

195

wordt momenteel vooral ingezet om zogenaamde farmacogenetische syndromen, zoals

dihydropyrimidine-dehydrogenase-deficiëntie vast te stellen. Gezien de snelle ontwik-

kelingen op het gebied van DNA- en RNA-diagnostiek wordt het in de toekomst wellicht

mogelijk om patiënten te “chemotyperen” voorafgaand aan het voorschrijven van een

chemotherapiekuur. Op basis van familiair overgeërfde DNA-kenmerken in combinatie

met de tumorspecifieke genetische eigenschappen zou dan voor ieder individu het

meest optimale chemotherapieschema kunnen worden vastgesteld. Voorspelling van

non-responders (personen die geen baat hebben van de therapie) kan dan onnodige

behandeling met dure chemotherapie voorkomen. Er is echter nog heel veel onderzoek

nodig voordat dit scenario toepasbaar is in de dagelijkse praktijk.

Sectie A van dit proefschrift omvat de hoofdstukken 3, 4.1, 4.2 en 5 en belicht verschil-

lende farmacokinetische en farmacogenetische aspecten van de behandeling met het

antikankermiddel 5-fluorouracil. Een vast onderdeel van farmacokinetisch onderzoek

is het meten van geneesmiddelconcentraties in bloed. Om deze metingen te kunnen

uitvoeren, werd een eenvoudige en gevoelige Hoge Druk Vloeistof Chromatografie (HPLC)

analysemethode ontwikkeld voor het aantonen van 5-fluorouracil en het afbraakproduct

5,6-dihydrofluorouracil. De methode wordt beschreven in hoofdstuk 3. Ten opzichte van

eerder in de literatuur beschreven methoden werd de extractieprocedure vereenvoudigd

en werd het benodigd monstervolume verlaagd naar 100 microliter.

Een van de aspecten van 5-fluorouracil behandeling waarover lang onduidelijkheid heeft

bestaan is de invloed van levermetastasen (uitzaaiingen in de lever) en de daaraan ge-

relateerde verstoring van de leverfunctie op de farmacokinetiek van 5-fluorouracil. In de

meeste grote klinische onderzoeken worden namelijk uitsluitend patiënten toegelaten

die een normale lever- en nierfunctie hebben.

Hoofdstuk 4.1 beschrijft het onderzoek naar de invloed van levermetastasen op de

farmacokinetiek van 5-fluorouracil en 5,6 dihydrofluorouracil in patiënten met colon- of

rectumkanker. De patiënten werden verdeeld over twee groepen, op basis van aan- of

afwezigheid van levermetastasen. De behandeling bestond voor alle patiënten uit een

Leverfunctie en levermetastasenDe uitscheiding van geneesmiddelen uit het lichaam vindt meestal plaats via de lever of de nieren. De lever is een soort chemische fabriek, waar allerlei stoffen die het lichaam binnenkomen (meestal via maagdarmkanaal) chemisch worden aangepast om ze geschikt te maken voor uitscheiding via de gal of de nieren. Levermetastasen bestaan uit kankerweefsel afkomstig van een primaire tumor. Bij colonkanker kunnen er dus uitzaaiingen van de oorspronkelijke tumor in de lever zijn. Dit weefsel verdringt het bestaande leverweefsel. Bij uitgebreide verdring-ing van leverweefsel door kankerweefsel kan de functie van de lever als chemische fabriek onder druk komen te staan. Gelukkig heeft de lever een enorme overcapaciteit.

Samenvatting

194

Samenvatting

195

combinatie van 5-fluorouracil met folinezuur volgens het zogenaamde Mayo-Clinics-

schema. Er werd geen effect van levermetastasen op de bloedconcentraties van beide

verbindingen vastgesteld. De studie toont aan dat dosisaanpassing van 5-fluorouracil

niet noodzakelijk is in patiënten die levermetastasen en lichte tot matige verhogingen in

leverfunctiewaarden hebben. Bij één van de patiënten in deze studie uit de groep zonder

levermetastasen traden kort na chemotherapie zeer ernstige bijwerkingen op. Verder

onderzoek is daarom uitgevoerd om de oorzaak hiervan te achterhalen. De resultaten van

dit onderzoek worden beschreven in hoofdstuk 4.2.

De farmacokinetiek van 5-fluorouracil, de activiteit van het dihydropyrimidine-dehy-

drogenase-enzym in witte bloedcellen en de DNA-defecten in het dihydropyrimidine-

dehydrogenase-gen zijn onderzocht in de patiënt met ernstige bijwerkingen en in een

zestal controlepatiënten met voorspelbare aan de therapie gerelateerde bijwerkingen. De

oppervlakte onder de plasmaconcentratie-tijd curve, een maat voor blootstelling aan het

medicijn, was in de patiënt met bijwerkingen 2,5 maal groter dan in de controlepatiënten.

De verdwijningsnelheid van 5-fluorouracil uit plasma was 2,5 maal lager. De activiteit van

het dihydropyrimidine-dehydrogenase-enzym, gemeten in witte bloedcellen, was in de

patiënt met bijwerkingen 50% van die in de controlegroep. Uit onderzoek op DNA niveau

aan het dihydropyrimidine-dehydrogenase-gen bleek dat de patiënt met ernstige bijwer-

kingen heterozygoot was voor een specifieke mutatie (IVS14+1G→A) in het gen. Deze

resultaten laten zien dat een tekort aan dihydropyrimidine-dehydrogenase-eiwit een

sterke vermindering in de afbraak van 5-fluorouracil tot gevolg kan hebben, waardoor

zeer ernstige bijwerkingen optreden bij toepassing van een standaarddosering.

Homozygoot of heterozygootIeder mens beschikt over een dubbele set chromosomen. De ene set is afkomstig van vader, de andere van moeder. Op beide sets kunnen polymorfismen voorkomen. Als een persoon homozygoot is voor een bepaald genotype, betekent dit dat van zowel vader als moeder hetzelfde gen is overgeërfd. Als iemand heterozygoot is, dan is het genpaar van vader en moeder verschillend. In het geval van heterozygotie voor een IVS14+1G→A mutatie in het dihydropyrimidine-dehydrogenase gen erft iemand van één van beide ouders (meestal) het normale gen, dat werkzaam eiwit oplevert, en van de andere ouder een gen dat resulteert in een onwerkzaam eiwit. Van alle gevormde dihydropyrimidine-dehydrogenase eiwitmoleculen is bij deze persoon dus maar de helft actief.

In de afgelopen decennia zijn verschillende methoden beschreven om een dihydropyri-

midine-dehydrogenase-tekort vroegtijdig op te sporen. Hieronder vallen genotypering

van mutaties in het dihydropyrimidine-dehydrogenase-gen, meting van de verhouding

(ratio) tussen lichaamseigen uracil en dihydrouracil in bloedplasma, en meting van de

dihydropyrimidine-dehydrogenase-activiteit in witte bloedcellen. Deze methoden zijn

echter tot dusver niet gebruikt voor routinematige screening op grote schaal, vanwege

gebrek aan gevoeligheid van de methode of hoge kosten. Het meten van uracilconcen-

traties in bloed na toedienen van een testdosis uracil aan de patiënt zou misschien een

klinisch haalbare en betaalbare screeningsmethode kunnen zijn. In hoofdstuk 5 staan de

Samenvatting

196

Samenvatting

197

Genotypering en fenotyperingGenotypering is het vaststellen van de erfelijke code in DNA. De erfelijke code op de chromosomen afkomstig van vader en moeder bepalen gezamenlijk de eigenschappen van een individu, het fenotype. Het vaststellen van een bepaalde eigenschap in relatie tot overerving heet fenotypering. Een verandering in genotype hoeft niet altijd gevolgen te hebben voor het fenotype. Een voorbeeld is de overerving van oogkleur. Iemand kan drager zijn van een gen voor blauwe oogkleur, maar zelf bruine ogen hebben. Deze persoon is heterozygoot voor een bruin en een blauw gen. Dragers van twee genen voor bruine oogkleur (homozygoten) hebben ook bruine ogen. Aan de buitenkant (fenotype) zijn beide personen dus hetzelfde, maar genetisch (genotype) zijn ze verschillend.

voorlopige resultaten van een lopend onderzoek met een dergelijke test voor dihydropy-

rimidine-dehydrogenase-fenotypering beschreven.

De farmacokinetiek van uracil en zijn metaboliet 5,6 dihydrouracil werd onderzocht in

een twaalftal gezonde vrijwilligers en 1 patiënt met een dihydropyrimidine-dehydro-

genase-tekort. Alle deelnemers moesten op lege maag 500 mg/m2 uracil in drankvorm

innemen. Gedurende 4 uur na inname van de drank werden bloedmonsters afgenomen.

De verlaging van de enzymactiviteit in de patiënt bleek het gevolg te zijn van een tweetal

mutaties (D949V en I543V) in het dihydropyrimidine-dehydrogenase-gen. De uracil

plasma-concentraties gemeten 1 en 2 uur na inname van de drank en de oppervlakte

onder de plasmaconcentratie-tijd curve (als maat voor blootstelling) bleken ongeveer

verdubbeld in de patiënt in vergelijking met de vrijwilligers. De voorlopige resultaten zijn

dus hoopvol, maar nader onderzoek is nodig in een groter aantal patiënten met DPD-defi-

ciëntie om de waarde van de test voor screeningsdoeleinden vast te stellen.

Sectie B van dit proefschrift omvat de hoofdstukken 6, 7, 8 en 9 en gaat in op klinisch

farmacologische en farmacogenetische aspecten van het antikankermiddel gemcitabine

in patiënten met niet-kleincellig longcarcinoom.

Gemcitabine is een cytostaticum waarvan bekend is dat het cellen gevoeliger kan maken

voor de inwerking van gammastraling bij radiotherapie. Dit wordt radiosensitisatie

genoemd. Gemcitabine is daarom een interessante kandidaat voor radiosensitisatie

voorafgaand aan radiotherapie bij patiënten met niet-kleincellig longcarcinoom. Over

de manier waarop gemcitabine de cellen gevoeliger maakt voor straling is nog maar

weinig bekend. Onlangs is aangetoond dat dit in ieder geval niet gebeurt door ingrijpen

op het cellulair mechanisme voor reparatie van dubbele breuken in DNA, genaamd non-

homologe eind-koppeling. In hoofdstuk 7 wordt bekeken of gemcitabine mogelijk radio-

sensitisatie veroorzaakt door invloed op het proces van homologe recombinatie dan wel

door effecten op base excisie reparatie.

Samenvatting

196

Samenvatting

197

DNA reparatieFouten in DNA kunnen door diverse oorzaken ontstaan. Gelukkig worden deze fouten in de meeste gevallen direct herkend en gerepareerd, zodat de genetische code niet in gevaar komt.De belangrijkste reparatiemechanismen zijn:

1. Base Excisie Reparatie (BER). Hierbij wordt de foute bouwsteen (base) uit de keten verwijderd en vervangen door de juiste component.

2. Nucleotide Excisie Reparatie (NER). Hierbij wordt een korte reeks bouwstenen uit de DNA keten verwij-derd en vervangen door de juiste reeks.

3. Mismatch Reparatie (MMR). Hierbij worden reparaties uitgevoerd als er binnen de dubbele helix structuur een fout is ontstaan die de standaard A-T en C-G paring verstoort.

Bovendien kunnen door straling en sommige chemische stoffen breuken in het DNA ontstaan. Hierbij kunnen enkelstrengs of dubbelstrengs breuken optreden. Enkelstrengs breuken worden gerepareerd via het zelfde mechanisme als BER. Dubbelstrengs breuken kunnen op twee manieren worden hersteld:

1. Non-Homologe Eind Koppeling (non-homologous end joining, NHEJ). Dit is een directe koppeling van beide strengen.

2. Homologe Recombinatie (homologous recombination, HR). Hierbij wordt gebruik gemaakt van DNA informatie op het zogenaamde homologe chromosoom. Dit is het chromosoom dat genetisch afkomstig is van de andere ouder.

Stralingsexperimenten��

��

��

��

��

��

��

BER = base excisie reparatie; HR = homologe recombinatie

Om de invloed van homologe recombinatie en van base excisie reparatie vast te stellen

werden bestralingsexperimenten uitgevoerd, na blootstelling aan gemcitabine, met

cellijnen die wel of niet de beschikking hadden over deze verschillende reparatiemecha-

nismen. Gemcitabine veroorzaakte wel radiosensitisatie in base excisie reparatie-deficiënte

cellen, maar niet in homologe recombinatie-deficiënte cellen. Uit de gecombineerde resul-

taten van deze experimenten werd de conclusie getrokken dat gemcitabine waarschijnlijk

radiosensitisatie veroorzaakt door een effect op homologe recombinatie.

Gemcitabine in combinatie met cisplatine is een relatief vaak toegepaste combinatie

bij de behandeling van niet-kleincellig longcarcinoom. Aan deze combinatie kleeft het

bezwaar dat voor toediening van cisplatine vrijwel altijd ziekenhuisopname nodig is,

vanwege de vocht- en elektrolytentoediening die noodzakelijk is om nierschade door cis-

platine te voorkomen. De combinatie van gemcitabine met het cytostaticum epirubicine

Samenvatting

198

Samenvatting

199

Geneesmiddelen in speekselSterk bepalend voor de mate waarin stoffen vanuit de bloedbaan in speeksel terechtkomen zijn ondermeer de volgende chemische eigenschappen:

1. Vetoplosbaarheid. Goed vetoplosbare stoffen kunnen makkelijker celmembranen passeren en komen eerder in speeksel.

2. Elektrische lading. Alleen ongeladen (neutrale) stoffen kunnen celmembranen passeren. De lading van een chemische stof (ionvorm of neutraal) is ondermeer afhankelijk van de zuurgraad (pH). Bloed is neutraal en heeft pH 7.4; speeksel is vaak enigszins zuur en varieert meestal van pH 4 tot 7.5

3. Sterk eiwitgebonden stoffen worden in bloed “vastgehouden” door bloedeiwitten. Alleen ongebonden stof kan naar speeksel overgaan.

zou een alternatief kunnen vormen voor de ‘klassieke’ gemcitabine-cisplatine-combinatie

vanwege eenvoudiger toepasbaarheid. In vroege klinische studies bleek de combina-

tie gemcitabine plus epirubicine goed te worden verdragen. Wel trad er relatief vaak

ontsteking van het mondslijmvlies (mucositis) op.

Daarom werd besloten vast te stellen in welke mate de beide anti-kankermedicijnen in

speeksel worden uitgescheiden. Zo kon een indruk verkregen worden van de relatieve

bijdrage van in speeksel uitgescheiden chemotherapie aan de totale blootstelling van

het maagdarmkanaal aan chemotherapie. De Hoge Druk Vloeistof-Chromatografische

(HPLC) methode die werd ontwikkeld om epirubicine en epirubicinol te meten in plasma

en speeksel is beschreven in hoofdstuk 7. De bepalingslimiet in plasma en speeksel was

5 µg/L voor epirubine en 2 µg/L voor epirubicinol.

De uitscheiding van gemcitabine, epirubicine en hun metabolieten in speeksel is onder-

zocht in 12 patiënten en staat beschreven in hoofdstuk 8.

Gemcitabine was alleen gedurende het eerste uur na start van het infuus meetbaar in

speeksel. Epirubicine daarentegen kon zelfs 22 uur na toediening nog in speeksel worden

aangetoond. De concentratie in speeksel was 6 en 22 uur na het infuus zelfs 28 en 72%

hoger dan in plasma. De totale hoeveelheid die via speeksel werd uitgescheiden is naar

schatting echter minder dan 0,2% van de epirubicine- en minder dan 0,1% van de gem-

citabinedosis. Beide anti-kankermedicijnen waren dus meetbaar in speeksel, maar de

absolute hoeveelheid bleef relatief laag.

Een ander punt van de gemcitabine-epirubicine behandelcombinatie betrof de vraag of

de middelen elkaars farmacokinetiek beïnvloeden bij gelijktijdige toediening.

Er is maar heel weinig onderzoek gedaan naar farmacokinetische interactie tussen gemci-

tabine en epirubicine. Daarom werd een studie gestart om de farmacokinetiek van gem-

citabine te vergelijken tussen enerzijds patiënten die gemcitabine samen met epirubine

en anderzijds patiënten die gemcitabine samen met cisplatine kregen toegediend.

Daarnaast is ook gekeken naar de invloed van een in de bevolking algemeen voorkomend

A79C-polymorfisme in het cytidine-deaminase-gen op de farmacokinetiek van gemcita-

Samenvatting

198

Samenvatting

199

bine. Circa 80-90% van de gemcitabine dosis wordt afgebroken door cytidine deaminase.

De resultaten van dit onderzoek staan beschreven in hoofdstuk 9. Tussen beide behan-

delgroepen werd geen verschil gemeten in de farmacokinetiek van gemcitabine. De

halfwaardetijd van de metaboliet dFdU bleek wel langer in de gemcitabine-epirubicine-

groep ten opzichte van gemcitabine-cisplatine-groep. Dit leek ten dele te kunnen worden

toegeschreven aan de iets betere nierfunctie van de patiënten in de gemcitabine-cisplati-

ne-groep, aangezien dFdU via de nieren het lichaam verlaat. Dit kon echter niet het gehele

verschil verklaren. Een ander deel van het verschil zou mogelijk verklaard kunnen worden

door verhoogde uitscheiding of verdeling naar weefsels van dFdU als gevolg van de intra-

veneuze toediening van grote hoeveelheden vocht die noodzakelijk zijn bij behandeling

met cisplatine. Ook zou een interactie van epirubicine of cisplatine met dFdU het verschil

kunnen verklaren. Omdat dFdU geen anti-kankeractiviteit heeft werd het geconstateerde

verschil niet klinisch relevant gevonden.

Het effect van het A79C-polymorfisme in het cytidine-deaminase-gen op de farmacoki-

netiek van gemcitabine is waarschijnlijk relatief beperkt. Onze studie was te klein om

hierover precieze uitspraken te doen. Een groter onderzoek met minimaal 120 patiënten

zou hier wel antwoord op kunnen geven.

Aanvullend onderzoek naar optimalisatie van het gemcitabine-epirubicine-schema in

relatie tot effectiviteit van de behandeling zou mogelijk interessant zijn geweest. Het

schema wordt echter niet meer toegepast naar aanleiding van de uitkomsten van klinisch

vergelijkend onderzoek. De combinatie gemcitibine-epirubicine bleek wat betreft anti-

kankerwerking niet verschillend van de combinatie gemcitabine-cisplatine, maar gaf wel

meer bijwerkingen. Aanvullende onderzoek met het gemcitabine-epirubicine-schema

bij patiënten met niet-kleincellig longcarcinoom is derhalve op dit moment niet aan de

orde.

201

Dankwoord

Vele personen hebben bijgedragen aan de totstandkoming van dit proefschrift. Promove-ren doe je niet alleen. Sterker nog, promoveren kan je niet eens alleen. Op deze plaats wil ik daarom de volgende personen bedanken voor hun inzet.

In de eerste plaats wil ik prof. dr. E.G.E. de Vries bedanken voor de jarenlange ondersteu-ning van het onderzoek. Liesbeth, dankzij jouw kritisch commentaar en waardevolle sug-gesties heeft dit proefschrift tot zijn huidige vorm kunnen uitgroeien. Mijn tweede promotor, prof. dr. H.J.M. Groen wil ik van harte danken voor de ondersteu-ning bij alle “gem-epi” delen van het onderzoek. Harry, jouw enthousiasme in de zoektocht naar nieuwe wegen en mogelijkheden in het onderzoek was aanstekelijk.Onmisbaar was de bijdrage van prof. dr. D.R.A Uges aan de totstandkoming van dit proef-schrift. Donald, dank zij jouw expertise zijn alle HPLC analyses meer dan uitstekend uitge-voerd.

Onmisbaar was ook de inzet van Floris Wachters en Monique Slijfer. Floris het was geweldig om met je samen te werken. Heel wat onderzoeksuren van jou zitten in dit boekje. Goede herinneringen bewaar ik ook aan de post-ASCO minitour door Florida. Toch jammer dat de space-shuttle bij NASA niet echt was…. Monique, bedankt voor de uitstekende wijze waarop je het onderzoeksdeel in het Martini Ziekenhuis hebt uitgevoerd en gecoördineerd.

Graag wil ik ook de bijvakstudenten farmacie Wilma Dodde, Leonie Schouten, Marina Maurer en Marieke Welzen bedanken voor hun inzet bij het analyseren van de vele farma-cokinetiek monsters. Zij werden in hun werk uitstekend bijgestaan door de analisten van het Laboratorium Apotheek van het AZG en begeleid door Gert Hendriks en Ben Greijda-nus, die ik hiervoor wil dankzeggen.

Alle DPD metingen hebben plaatsgevonden op het Laboratorium voor Genetisch Metabole Ziekten van het AMC te Amsterdam. Ik ben dr. André van Kuilenburg zeer erken-telijk voor de plezierige wijze waarop wij de afgelopen jaren hebben samengewerkt.

Dr. Hans Proost wil ik bedanken voor de heldere wijze waarop complexe farmacokineti-sche vraagstukken konden worden teruggebracht tot analyseerbare farmacokinetische modellen.

Dr. Wim Sluiter en dr. Marieke Boezen wil ik bedanken voor hun gedegen statistisch advies bij het opzetten en interpreteren van de diverse klinische onderzoeken.

Een speciaal dankwoord gaat uit naar alle artsen, arts-assistenten, oncologieverpleeg-kundigen en overige medewerkers van de afdelingen oncologie van het Academische Ziekenhuis en het Martini Ziekenhuis in Groningen, het Diaconessenhuis in Meppel en

202 203

het ziekenhuis Bethesda in Hoogeveen voor hun bijdrage aan het onderzoek door onder-steuning bij het insluiten van patiënten in de diverse studies, bij het uitvoeren van de vele bloedafnames en bij het verrichten van de toxiciteits-scores.

In het bijzonder wil ik Henk Piersma, Barbara Bong, dr. Robert de Jong, Janny Haasjes en Henk de Korte danken voor hun inzet.

Zeer veel dank ben ik ook verschuldigd aan alle patiënten en proefpersonen die op vrijwillige basis bereid zijn geweest deel te nemen aan de klinische onderzoeken in dit proefschrift.

De leden van de beoordelingscommissie, prof. dr. J.H. Beijnen, prof. dr. H.J. Guchelaar en prof. dr. J.Verweij, wil ik bedanken voor hun bereidheid het manuscript te beoordelen.

De analisten van de apotheeklaboratoria van ziekenhuisapotheek Meppel-Hoogeveen en van het Martini Ziekenhuis Groningen wil ik bedanken voor hun begeleiding bij de HPLC analyses die in respectievelijk Meppel en Groningen plaatsvonden. HLO studente Yvette Huisman wil ik danken voor haar bijdrage aan de uracil HPLC analyses.

Mijn collega-ziekenhuisapothekers dr. Peter Lerk en Solko Bolman wil ik danken voor de mogelijkheid het onderzoek flexibel in te passen naast een baan als full-time ziekenhuis-apotheker. Collega Barbara Theeuwes-Oonk wil ik danken voor haar inzet bij de totstand-koming van de uracil studie en voor de nauwgezette uitvoering ervan.Dankbaar ben ik ook voor de bijdrage van dr. Geke Hospers van de afdeling medische oncologie van het AZG aan dit deel van het onderzoek.

Onder de indruk ben ik van de transformatie van tekst naar boekje die door creatief en kundig handwerk van Paula Berkemeyer heeft plaatsgevonden. Paula het is prachtig geworden!

Mathijs, leuk dat je paranimf wilt zijn. Tijdens de studie farmacie hebben wij heel wat practica en studieblokken samen doorlopen. Het voelt goed om, als vanouds, dit grote academisch “examen” ook een beetje samen te doen.

Boys from the band: “ ‘t was niet nix, maar woensdag bleef en blijft No-Dix”.

JUPE, lieve Peter en Judith: betere vriendjes kunnen wij ons niet wensen. Peter, de vorige keer samen in rokkostuum was bij jouw promotie. Ik ben blij dat, in omge-keerde rolverdeling, jij mij ditmaal bijstaat in de aula van het academiegebouw.

Tenslotte, lieve Monique, bedankt voor je geduld en steun, vooral tijdens de laatste zware loodjes.

202 203

Curriculum Vitae

Jan Gerard Maring werd geboren op 19 februari 1967 te Assen. Na het behalen van het VWO diploma aan de Christelijke Scholengemeenschap Assen (thans Vincent van Gogh) begon hij in 1986 aan de studie farmacie aan de Rijksuniversiteit Groningen. Na het behalen van het propedeutisch examen in 1987 volgde hij tijdens de doctoraalfase de specialisatierichting farmacologie. Het bijvakonderzoek werd uitgevoerd bij de vakgroep Farmacokinetiek & Drug Delivery onder leiding van prof. dr. D.K.F. Meijer en betrof onderzoek naar kationtransport in de lever (begeleiding dr. H. Steen). In 1992 behaalde hij het doctoraal examen (cum laude). Na het doctoraal examen volgde hij de beroepsop-leiding tot apotheker, waarvan het examen in 1994 werd behaald. Hierna verrichtte hij als projectapotheker onderzoek naar een propofol formulering in het St. Antonius Ziekenhuis in Nieuwegein. In 1995 startte hij met de opleiding tot ziekenhuisapotheker in het Martini Ziekenhuis Groningen (opleider: O.G. Groenewold). In 1997 werd als onderdeel van deze opleiding in samenwerking met de afdeling medische oncologie van het Academisch Ziekenhuis Groningen een aanvang gemaakt met de in dit proefschrift beschreven lever-metastasen studie. De opleiding tot ziekenhuisapotheker werd eind 1998 afgerond. Sinds 1999 werkt hij als ziekenhuisapotheker in ziekenhuisapotheek Meppel-Hoogeveen en is vanaf de oprichting van de Sazinon ziekenhuisapotheek, een samenwerkingsverband van de ziekenhuizen in Emmen, Hardenberg, Hoogeveen en Meppel, tevens werkzaam voor de ziekenhuisapotheek Emmen-Hardenberg. Zijn aandachtsgebieden zijn het klinisch-farma-ceutisch en toxicologische laboratorium, de klinisch-farmaceutische zorg en hieraan gere-lateerde informatisering & automatisering. Het in dit proefschrift beschreven onderzoek vond plaats in de periode 1997-2004 en werd begeleid door prof. dr. E.G.E. de Vries van de afdeling medische oncologie, prof. dr. H.J.M. Groen van de afdeling longziekten en prof. dr. D.R.A. Uges van de apotheek van het Academisch Ziekenhuis Groningen.

204 205

204 205

Publications related to this thesis

Maring JG, van Kuilenburg AB, Haasjes J, Piersma H, Groen HJ, Uges DR, Van Gennip AH, De Vries EG. Reduced 5-FU clearance in a patient with low DPD activity due to heterozygosity for a mutant allele of the DPYD gene. Br J Cancer 2002;86:1028-1033.

Maring JG, Piersma H, van Dalen A, Groen HJ, Uges DR, De Vries EG. Extensive hepatic replacement due to liver metastases has no effect on 5-fluorouracil pharmacokinetics. Cancer Chemother Pharmacol 2003;51:167-173.

Dodde WI, Maring JG, Hendriks G, Wachters FM, Groen HJ, de Vries EG, Uges DR. Determina-tion of epirubicin and its metabolite epirubicinol in saliva and plasma by HPLC. Ther Drug Monit 2003;25:433-440.

Wachters FM, van Putten JW, Maring JG, Zdzienicka MZ, Groen HJ, Kampinga HH. Selective targeting of homologous DNA recombination repair by gemcitabine. Int J Radiat Oncol Biol Phys 2003;57:553-562.

Maring JG, Schouten L, Greijdanus B, De Vries EGE, Uges DRA. A simple and sensitive fully validated HPLC-UV method for the determination of 5-fluorouracil and its metabolite 5,6-dihydrofluorouracil in plasma. Ther Drug Monit 2004. In press.

Maring JG, Groen HJM, Wachters FM, Uges DRA, De Vries EGE. Genetic factors influencing pyrimidine antagonist chemotherapy. Pharmacogenetics J. Revised resubmitted.

Maring JG, Wachters FM, Maurer M, Uges DRA, De Vries EGE, Groen HJM. Gemcitabine and epirubicin plasma concentrations and excretion in saliva in non-small cell lung cancer patients. To be submitted.

Maring JG, Wachters FM, Slijfer M, Maurer M, Boezen HM, Uges DRA, De Vries EGE, Groen HJM. Pharmacokinetics and pharmacogenetics of gemcitabine combined with epirubicin or cisplatin in non-small cell lung cancer patients. Submitted.

Other publications

Steen H, Maring JG, Meijer DK. Differential effects of metabolic inhibitors on cellular and mitochondrial uptake of organic cations in rat liver. Biochem Pharmacol 1993;45:809-818.

Van Kuilenburg AB, Haasjes J, Richel DJ, Zoetekouw L, Van Lenthe H, De Abreu RA, Maring JG, Vreken P, van Gennip AH. Clinical implications of dihydropyrimidine dehydrogenase (DPD) deficiency in patients with severe 5-fluorouracil-associated toxicity: identification of new mutations in the DPD gene. Clin Cancer Res 2000;6:4705-4712.

206 207

Koster VS, Maring JG, Knibbe CAJ, Lange R, Kuks PFM, Langemeijer JJM, Talsma H, Lie-A-Huen L. Propofol 6% SAZN: preparation and stability of a new formulation of propofol. Eur Hosp Pharm 2000;6:92–96

Beaufort TM, Proost JH, Maring JG, Scheffer ER, Wierda JK, Meijer DK. Effect of hypothermia on the hepatic uptake and biliary excretion of vecuronium in the isolated perfused rat liver. Anesthesiology 2001;94:270-279.

Wachters FM, Groen HJ, Maring JG, Gietema JA, Porro M, Dumez H, de Vries EG, van Oosterom AT. A phase I study with MAG-camptothecin intravenously administered weekly for 3 weeks in a 4-week cycle in adult patients with solid tumours. Br J Cancer 2004;90:2261-2267

Publications in dutch

Maring JG. Azitromycine. Meer microkracht, maar nauwelijks schonere weefsels. Pharma Sel 1994;10:130-134

Maring JG, Van der Graaf CJ. Afleveren van geneesmiddelen: van kunst naar kunde. Pharm Weekbl 1994;129:546

Maring JG. Helicobacter pylor eradicatie. Zuur einde voor een lastig heerschap. Pharm Sel 1995;11:45-48

Maring JG. Meropenem. Carbapenem op solotour. Pharm Sel 1996;12:46-50.

Maring JG. Riluzole. Bij amyotrofische lateraal sclerose. Pharm Sel 1996,12:116-118

Maring JG. Methotrexaat. Als ontstekingsremmer bij chronische aandoeningen. Pharm Sel 1997;13:44-47

Troost SJ, Maring JG. Anti-emetica. Welk middel voor welke toepassing. Pharm Sel 1997,13:82-86

Maring JG. Tacrolimus. Pro graft of ook pro host? Pharm Sel 1997;13:134-137.

Maring JG, Weening EC. Thuisbehandeling van diep-veneuze trombose. Pharm Sel 1998;14:68-74

Maring JG, Niemeijer MG. De mogelijkheden van insluipend gedoseerde beta-blokkers. Pharm Weekbl 1998;133:747-751

206 207

Maring JG, Eppinga M. Cholinesteraseremmers bij alzheimer. Verbeterde stroomvoorzien-ing voor beschadigd geheugen. Pharm Sel 1999;15:17-20

Maring JG. Oxaliplatin. Nieuw edelmetaal in strijd tegen kanker. Pharm Sel 1999;15:96-99.

Maring JG. Ibopamine obsoleet. Pharm Weekbl 1999;134:754-755

Stolk LML, Maring JG. Leflunomide. Doorbraak bij rheuma? Pharm Sel 2000;16:2-5.

Maring JG, Eppinga M. Entacapon. Blijf het ‘off’ of comt het ‘on’? Pharm Sel 2000;16:46-49.

Troost SJ, Maring JG. Gabapentine. (R)evolutionair bij refractaire epilepsie. Pharm Sel 2000;16:93-96

Westerman EM, Maring JG. Trastuzumab. Antilichaam in de strijd tegen borstkanker. Pharm Sel 2001;17:14-17.

Maring JG, Stolk LML. Capecitabine. Oraal 5-FU met kans op mond- en voetzeer. Pharm Sel 2001;17:61-64.

Van de Ven LI, Maring JG. Levetiracetam. Nog geen schokkende verbetering. Pharm Sel 2001;17:129-132

Maring JG, Schimmel K. Imatinib. Bestrijdt leukemie, ontstaan na chromosomaal pootje over. Pharm Sel 2002;18:37-40

Maring JG, Dekens KG, Piersma H, Groenewold OG, De Vries EGE. De farmacokinetiek van 5-fluorouracil en 5,6 dihydrofluorouracil. Invloed van levermetastasen. Pharm Weekbl 2002;137:1344-1348

Maring JG, Dettmers EM. Gefetinib. Pas in derde plaats effectief? Pharm Sel 2003;19:135-137

Kuiper L, Maring JG. Fulvestrant. Puur is duur? Pharm Sel 2004;20:79-82

Bartelink IH, Maring JG. Bortezomib. Nieuwe therapieën tegen (w)elke prijs? Pharm Sel 2004;20:94-97

Maring JG, Bruggeman R. Alefacept. Bij psoriasis beter dan … wat? Pharm Sel 2004:20:100-102

New Insights in Pyrimidine Antagonist Chemotherapy The ... · cology and pharmacogenetics of...

Documents

Transcript of New Insights in Pyrimidine Antagonist Chemotherapy The ... · cology and pharmacogenetics of...