저 시-비 리- 경 지 2.0 한민

는 아래 조건 르는 경 에 한하여 게

l 저 물 복제, 포, 전송, 전시, 공연 송할 수 습니다.

다 과 같 조건 라야 합니다:

l 하는, 저 물 나 포 경 , 저 물에 적 된 허락조건 명확하게 나타내어야 합니다.

l 저 터 허가를 면 러한 조건들 적 되지 않습니다.

저 에 른 리는 내 에 하여 향 지 않습니다.

것 허락규약(Legal Code) 해하 쉽게 약한 것 니다.

Disclaimer

저 시. 하는 원저 를 시하여야 합니다.

비 리. 하는 저 물 리 목적 할 수 없습니다.

경 지. 하는 저 물 개 , 형 또는 가공할 수 없습니다.

의학박사 학위논문

Genetic Polymorphisms in the

Folate Pathway Are Associated with

Efficacy and Toxicity of

Methotrexate in Pediatric

Osteosarcoma

소아 골육종 환자에서 Folate 대사

연관 유전자 다형성과

Methotrexate 치료 효과 및 독성의

연관성에 관한 연구

2013 년 2 월

서울대학교 대학원

의학과 분자종양의학 과정

박 정 아

ii

A thesis of the Degree of Doctor of Philosophy

소아 골육종 환자에서 Folate 대사

연관 유전자 다형성과

Methotrexate 치료 효과 및 독성의

연관성에 관한 연구

Genetic Polymorphisms in the

Folate Pathway Are Associated with

Efficacy and Toxicity of

Methotrexate in Pediatric

Osteosarcoma

February 2013

The Department of Molecular Oncology

Seoul National University

College of Medicine

Jeong A Park

i

ABSTRACT

Background & Purpose: Osteosarcoma is the most common childhood malignant

bone tumor. Efficacy of multi-agent chemotherapy for osteosarcoma including

methotrexate, adriamycin and cisplatin may be influenced by multiple cellular

pathways. Methotrexate (MTX), one of the main drugs used for osteosarcoma, is a

representative folic acid antagonist. Genetic polymorphisms in folate pathway genes

are expected to influence the response and toxicity of high-dose MTX therapy in

pediatric osteosarcoma, However, there are scarce data available regarding

associations between genetic polymorphisms and pediatric osteosarcoma. This

study evaluated the effect of common genetic polymorphisms in the folate

metabolic pathway on overall survival, event-free survival and histological response

to neoadjuvant chemotherapy including high-dose MTX. In addition, whether these

genetic polymorphisms affect the concentrations of MTX and toxicity after high-

dose MTX therapy for osteosarcoma was investigated.

Methods: Blood and tissue samples from 48 osteosarcoma patients (blood samples

from 19 patients, tissue samples from 22 patients, and both blood and tissue samples

from 7 patients) who had completed chemotherapy were obtained, and the

following polymorphisms were analyzed; RFC1 80G>A, DHFR 829C>T, MTHFR

677C>T, MTHFR 1298A>C, AMPD1 34C>T, ATIC 347C>G, and ITPA 94C>A.

Associations between candidate polymorphisms and survival, histological response

ii

(tumor necrosis rate) and MTX level and toxicity after high-dose MTX therapy

were analyzed.

Results: Event-free survival significantly decreased in DHFR 829 CC homozygote

(P=0.045). There were no statistically significant associations between genetic

polymorphisms and histological response, however, variant carriers of MTHFR

677C>T had tendency towards poor histological response (P=0.078). MTX

concentration was significantly associated with RFC1 80G>A polymorphism

(P=0.027). Liver toxicity after high-dose MTX was associated with ATIC 347C>G

(P=0.043) and tended to increase in carriers of MTHFR 677C>T (P=0.069). Severe

stomatitis was associated with RFC1 80G>A (P=0.012).

Conclusions: This study has demonstrated that several genetic polymorphisms in

folate pathway can significantly influence therapeutic response, clinical outcome

and MTX level and toxicity after high-dose MTX therapy in osteosarcoma patients.

If these associations are independently validated, these variants could be used as

genetic predictors of clinical outcome in the treatment of patients with osteosarcoma,

aiding the development of tailored therapeutic approaches.

----------------------------------------------------------------------------------------------------

Key words:

Osteosarcoma, methotrexate, folate, genetic, polymorphism

Student Number: 2006-30540

iii

CONTENTS

Abstract………………………………………………………………………i

Contents……………………………………………………………… …….iii

List of tables and figures……………………………………………….........iv

List of abbreviations…………………………………………………………v

Introduction …………………………………………………………..……..1

Patients and Methods………………………………………………...……. . 5

Results…………………………..…………………………..………………16

Discussion…....……..………………………………………………………31

Conclusion…………….……………………………………………………39

References………………………………………………………..…………40

Abstract in Korean………….………………………………………………49

iv

LIST OF TABLES AND FIGURES

List of Tables

Table 1. Clinical and pathological characteristics of patients with

osteosarcoma at diagnosis-----------------------------------------------------------7

Table 2. Sequencing by synthesis (SBS) primer sequences for multiple

amplification of methotrexate genes ----------------------------------------------11

Table 3. Allele-specific primer extension (ASPE) primer sequences ------------13

Table 4. Treatment and clinical outcome of patients with osteosarcoma-----17

Table 5. Genotype frequencies of patients with osteosarcoma ----------------22

Table 6. Associations between various polymorphisms and histological response to

neoadjuvant chemotherapy including high-dose methotrexate.----------------------26

Table 7. Genotypic associations with methotrexate concentration at 48 h after high-

dose methotrexate therapy.-------------------------------------------------------------- 28

Table 8. Genotypic associations with grade 3-4 toxicities after high-dose

methotrexate therapy ------------------------------------------------------------------30

List of Figures

Figure 1. Effect of methotrexate on folate metabolic pathway-----------------------2

Figure 2. Event-free survival (A) and overall survival curves (B) of patients with

osteosarcoma according to histological response ----------------------------------- 20

Figure 3. Event-free survival of patients with osteosarcoma according to

dihydrofolate reductase polymorphism-------------------------------------------------- 24

v

LIST OF ABBREVIATIONS

MTX; methotrexate

RFC; reduced folate carrier

DHFR; dihydrofolate reductase

MTHFR; 5, 10-methylenetetrahydrofolate reductase

TS; thymidylate synthase

GGH; γ-glutamyl hydrolase

AICAR; 5-aminoimidazole-4-carbosamide ribonucleotide

ATIC; 5-aminoimidazole-4-carbosamide ribonucleotide (ATIC)

formyltransferase

AMPD; adenosine monophosphate deaminase

ITPA; inosine triphosphate pyrophosphatase

SNP; single nucleotide polymorphism

1

INTRODUCTION

Folate metabolism is essential for cellular functioning, because it provides one-

carbon donors for the synthesis of de novo purines and pyrimidines necessary for

RNA and DNA synthesis, remethylation of homocysteine and DNA methylation.

Folate metabolism may become deranged by inadequate nutrition, altered cellular

transport and polymorphisms in folate-related genes. These polymorphisms may

influence cellular folate metabolism by lowering folate status, shifting cellular

folate distribution, hypomethylation of DNA and uracil misincorporation. There has

been a growing body of evidence that polymorphisms in these folate pathway genes

are important factors in carcinogenesis and influence the risk of various

malignancies (1-3). Also, they are associated with an altered response to folic acid

antagonists in patients with malignancy and autoimmune disease.

Methotrexate (MTX), as a representative folic acid antagonist, is a potent inhibitor

of dihydrofolate reductase (DHFR), a key enzyme for intracellular folate

metabolism, which converts dihydrofolate to the active tetrahydrofolate. Inhibition

of DHFR leads to impairment of purine and pyrimidine nucleotide biosynthesis,

resulting in blocked DNA synthesis and cell death (4). Metabolized polyglutamated

forms of MTX inhibit many other enzymes involved in the folate cycle, such as

5,10-methylenetetrahydrofolate reductase (MTHFR), thymidylate synthase (TS), 5-

aminoimidazole-4-carboxamide ribonucleotide (AICAR) formyltransferase (ATIC),

and inhibition of these enzymes contributes to the effects of MTX (Figure 1) (5).

2

Cell membraneTarget cell

Adenosine

Rc

RFC1

MTX

MTX-PG

DHF THF

MTHFR

TS ATIC

Pyrimidine

synthesis

Purine

biosynthesis

Adenosine

accumulation

MTX

DHFR

FPGS GGH

Efflux transporter

Figure 1. Effect of methotrexate on the folate metabolic pathway. Methotrexate

(MTX), carried by the reduced folate carrier-1 (RFC1) transporter, enters cells, is

converted to methotrexate polyglutamate (MTX-PG) by folypoly-γ-gluatamate

synthetase (FPGS) and is extruded after deconjugation by γ-glutamyl hydrolase

(GGH). MTX-PG inhibits dihydrofolate reductase (DHFR), thymidylate synthase

(TS) and 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR)

formyltransferase (ATIC), which are involved in the folate metabolic pathway.

DHFR inhibition results in reduced conversion of dihydrofolate (DHF) to

tetrahydrofolate (THF) and consequently in reduced synthesis of 5,10-

methylenetetrahydrofolate to 5-methyltetrahydrofolate by 5,10-

methylenetetrahydrofolate reductase (MTHFR), which in turn results in increased

homocysteine levels. TS inhibition results in reduced pyrimidine synthesis. ATIC

inhibition decreases purine biosynthesis and increases extracellular concentrations

of adenosine.

3

MTX is commonly used to treat a variety of diseases including autoimmune

disease like rheumatoid arthritis and psoriasis, malignancies and for prevention of

graft-versus-host disease after transplantation. MTX efficacy and toxicity differ

widely depending on the disease and the MTX doses used (6). However, even when

given identical MTX doses, patients show significantly different responses and

patterns of toxicities, and this diversity can be linked with genetic polymorphisms

associated with drug absorption, metabolism, excretion, and effector targets.

Osteosarcoma is the most frequent malignant bone tumor in children and

adolescents. Treatment for osteosarcoma includes preoperative chemotherapy,

surgery and postoperative chemotherapy. MTX, adriamycin, cisplatin and

ifosfamide form the backbone of most standard treatment protocols. These multi-

agent chemotherapies result in improved survival from less than 20% after surgery

alone to 60 to 70% at 3 years (7, 8). For treatment of osteosarcoma, conventional

doses of MTX therapy have been proven ineffective, and several retrospective

studies have suggested that a threshold peak MTX level needs to be achieved to

obtain a good histological response to chemotherapy (9, 10). High-dose MTX with

leucovorin rescue has been a cornerstone of neoadjuvant chemotherapy for

osteosarcoma. However, resistance to MTX can occur through a variety of

mechanisms, including decreased accumulation due to impaired transport of the

drug via the reduced folate carrier-1 (RFC1), decreased intracellular retention as a

consequence of a lack of polyglutamation, amplification of DHFR, altered

(mutated) DHFR that binds MTX less avidly, and increased level of γ-glutamyl

4

hydrolase (GGH) that hydrolyses MTX polyglutamates (11, 12). Some studies have

reported that impairment of methotrexate influx and upregulation of DHFR occur in

osteosarcoma, and genetic alterations in these genes could influence drug resistance

and toxicity (13-16). Outside of that, many functional polymorphisms in the genes

involved in the folate pathway are expected to influence not only MTX toxicity, but

also responses to chemotherapy in osteosarcoma patients. However, there are scarce

data regarding associations between polymorphisms of folate pathway genes and

pediatric osteosarcoma, and these results are inconsistent among different

populations. Also, no study has examined associations of genetic polymorphisms of

the DHFR and adenosine pathways with treatment outcomes of pediatric

osteosarcoma. This study hypothesized that, first, common polymorphisms of

various genes in the folate metabolic pathway could be predictors of treatment

outcome for patients with osteosarcoma, and second, these polymorphisms might

affect the histological response to neoadjuvant chemotherapy including high-dose

MTX, and third, these genetic polymorphisms might affect plasma levels of MTX

and toxicities after high-dose MTX therapy. This study used multiplex-polymerase

chain reaction (PCR) for mass analysis of various genetic polymorphisms, and

pharmacogenomic profiling of osteosarcoma patients using multiplex-PCR could

facilitate the optimization of current chemotherapy with the aim of improved

outcome and decreased toxicity.

5

PATIENTS AND METHODS

Study population

This is a retrospective study comprising 40 patients at Seoul National University

Children’s Hospital and 8 patients at Asan medical Center given pathological

diagnosis of osteosarcoma and treated with high-dose MTX. Between 1986 and

2009, 124 children were diagnosed with osteosarcoma and were treated at Seoul

National University Children’s Hospital. Seventy patients who had not been treated

with high-dose MTX and 14 patients for whom informed consent was not obtained,

were excluded from this study. Eight patients at Asan Medical Center enrolled in

this study were diagnosed with osteosarcoma in 2009 and were treated with high-

dose MTX containing regimens. This study was approved by the Ethics Committee

of Institutional Review Board of the Seoul National University Hospital (IRB No.

H-0906-067-284). In all cases, informed consent was obtained from the patients,

parents or both.

Each patient received high-dose MTX according to the treatment protocols: CCG

7921 A, CCG 7921 B (7), and COG AOST 0331 (17). High-dose MTX 12 g/m2 was

administered separately by a period of 1 week, each of which was infused over 4

hours. Intravenous hydration and alkalization was achieved 12 hours before the start

of MTX therapy. High-dose MTX was started at urine pH >7.0 for protection

against MTX-induced renal dysfunction. Leucovorin (calcium folinate) rescue was

started 24 hours after start of MTX infusion at a dose rate of 15 mg/m2, and

6

leucovorin doses were repeated every 6 hours until the MTX plasma concentration

was below the cut-off value (0.1 μmol/L).

Clinical data

All data were collected from the patients’ charts, including patients’ characteristics

and clinical variables at diagnosis: gender, age, weight, height, histology, primary

tumor site, tumor volume and presence of metastasis (Table 1). The median age of

the patients was 11.4 years. The primary site of osteosarcoma was most common in

femur (52%), the next in tibia and fibula (27%), and then in humerus and radius

(15%). Because the patients who did not receive MTX were not included, the

proportion of the patients with metastasis at diagnosis (67%) was much more than

those without. The majority of histological diagnoses were osteoblastic type (88%),

and median tumor volume was 125.6 cm3.

7

Table 1. Clinical and pathological characteristics of patients with osteosarcoma

at diagnosis

N %

Total No. of patients 48

Age at diagnosis (years)

Median 11.4

Range 5.0-15.7

Sex

Male 28 58.3

Female 20 41.7

Primary site

Femur 25 52.1

Tibia/fibula 13 27.1

Humerus/radius 7 14.6

Axial 3 6.3

Maxillofacial 0 0.0

Metastasis at diagnosis

Absent 16 33.3

Present 32 66.7

Histological subtype

Osteoblastic 42 87.5

Chondroblastic 3 6.3

Telangiectatic 3 6.3

Tumor volume (cm3)

Median 125.6

Range 2.7-2128

8

To evaluate clinical outcome, following data were collected; treatment protocol,

surgical intervention (reconstruction or amputation), histological response to

neoadjuvant chemotherapy (degree of tumor necrosis determined histologically in

the surgical resection specimen defined as good response [more than 90% necrosis]

or poor response [less than 90% necrosis]) (9), time to and site of relapse and length

of follow-up. Overall survival (OS) was considered as the time from diagnosis to

death or last follow-up, and event-free survival (EFS) was defined as the time from

diagnosis to the first of disease recurrence, development of lung or bone metastases,

and/or death.

MTX concentration and toxicity

Venous blood samples were collected from all patients through routine TDM

protocol at 24 hours, 48 hours and 72 hours from the beginning of the infusion of

high-dose MTX, and additional sampling continued until the MTX plasma

concentration was <0.1 μmol/L. Plasma MTX concentrations were measured by a

fluorescence polarization immunoassay on a TDx system (Abbot Laboratories,

Abbot Park, IL). To evaluate the MTX exposure-toxicity relationship, following

data for each course of high-dose MTX treatment: blood tests including complete

blood count (CBC), total bilirubin, aspartate aminotransferase (AST), alanine

aminotransferase (ALT), blood urea nitrogen (BUN) and serum creatinine and

grades of stomatitis, liver toxicity, kidney toxicity and neurotoxicity according to

the Common Terminology Criteria for Adverse Events version 3.0 (CTCAE)

(http://ctep.info.nih.gov/reporting/index.html) were collected.

9

DNA extraction and genotyping

The genomic DNA from peripheral blood and formalin-fixed, paraffin-embedded

tumor tissue of the 48 patients of this study were analyzed. Blood samples were

obtained from 19 patients, tissue samples from 22 patients, and both blood and

tissue samples from 7 patients. Genomic DNA was extracted from peripheral blood

lymphocytes and tumor tissues using the QIAamp DNA Mini Kit and QIAamp

DNA FFPE Tissue kit (QIAGEN, Hilden, Germany) according to the

manufacturer’s instructions. DNA yield, integrity and protein contamination were

determined by spectrophotometry. Genotyping was performed for RFC1 80G>A,

DHFR 829C>T, MTHFR 677C>T and 1298A>C, ATIC 347C>G, inosine

triphosphate pyrophosphatase (ITPA) 94C>A and adenosine monophosphate

deaminase-1 (AMPD1) 34C>T in the folate metabolic pathway. Multiplex-PCR was

used for mass analysis of polymorphisms of various genes, and the results of

multiplex PCR were compared with the results of standard real-time PCR in 2

patients using blood samples.

Gene amplification

Gene amplification was performed in a total volume of 20 μL mixture containing 5

μM forward and reverse SBS (sequencing by synthesis) primers (Table 1), 0.25 mM

dNTP mix, 112.5 mM Tris HCl (pH 9.0), 3 mM MgCl2, 75mM KCl, 30mM

(NH4)2SO4, and 1.5 U of Taq polymerase (Biotools, Madrid, Spain). The reactions

were preheated at 94℃ for 2 min, then 10 amplification cycles were carried out;

denaturation at 94℃ for 15 sec, annealing at 50℃ for 30 sec and extension at 72℃

10

for 1 min and then 40 amplification cycles using the following parameters:

denaturation at 94℃ for 15 sec, annealing at 60℃ for 230 sec and extension at

72℃ for 40 sec in a 96 well thermal cycler (Applied Biosystems, CA, USA).

Sixteen µL of PCR products was mixed with 4 μL of the activation solution (YeBT,

Seoul, Korea), and this was incubated at 37℃ for 60 min and 85℃ for 15 min.

11

Table 2. Sequencing by synthesis (SBS) primer sequences for multiple

amplification of methotrexate related genes

Gene position Sequence ( 5’ to 3’)

RFC1 c.80 Forward GTGGAACCTGGG AAAA TGACCCCGAGCTCC

Reverse TGATGAAGCTCTC AAAA CTGGCCGTATCTGC

MTHFR

c.677

Forward CTGTCATCCCTATT AAAA CAGGTTACCCCAAAG

Reverse GTGCATGCCTTC AAAA AAAGCGGAAGAATGTG

MTHFR

c.1298

Forward CCTTTGGGGA AAAA TGAAGGACTACTACC

Reverse GCAAGTCACTTTGT AAAA CCATTCCGGTTTGG

DHFR c.829 Forward TGCTATAACTAAGTGCAAAACTCCAAGACCCCAAC

Reverse GTGAAACTGCTCAGTAAAAAAGGGTATGTGGATCT

ATIC c.347 Forward TTTAATGACAGCCAGAAAAACGTCTTTGTTTTATAGA

Reverse AATCCCAAAACACAATAAAAAGAAGTAGCTATTTTCT

AMPD1 c.34 Forward TGATACTCTGACAAATAAAACAGCAAAAGTAATGCA

Reverse TGGAAGGCTGAGC AAAA AAATAACAGCAATC

ITPA c.94 Forward CTTTAGGAGATGGG AAAA GCAGAGTTATCGATGA

Reverse CACAGAAAGTCAGGT AAAA CAGGAAGACAGAGAAA

12

Labeling of activation products

Five μL of activated PCR product was added to 20 μL of an allele-specific primer

extension (ASPE) reaction mixture containing 75 mM Tris HCl (pH 9.0), 2 mM

MgCl2, 50 mM KCl, 20 mM (NH4)2SO4, 25 nM ASPE primer mix (Table 2), 6 mM

biotin dCTP, 50 mM of dATP, dGTP, dTTP mix and 1.0 U of Taq polymerase

(Biotools, Spain). The reactions were denatured at 94℃ for 5 min, 35 amplification

cycles were then carried out, using the following parameters to label the amplicons:

94℃ for 30 s, 55℃ for 1 min, and 72℃ for 2 min and a final extension at 72℃

for 7 min.

13

Table 3. Allele-specific primer extension (ASPE) primer sequences

Gene Taq sequence Sequence (5’ to 3’)

RFC1 80G TCAAAATCTCAAATACTCAAATCA AAAGGTAGCACACGAGGC

RFC1 80A CAATTCAAATCACAATAATCAATC AAAGGTAGCACACGAGGT

MTHFR 677C

MTHFR 677T

CTAACTAACAATAATCTAACTAAC TGCGTGATGATGAAATCGG

AATCTTACTACAAATCCTTTCTTT TGCGTGATGATGAAATCGA

MTHFR 1298A

MTHFR 1298C

CTACAAACAAACAAACATTATCAA GAGCTGACCAGTGAAGA

CAATATACCAATATCATCATTTAC GAGCTGACCAGTGAAGC

DHFR 829C

DHFR 829T

TACAAATCATCAATCACTTTAATC TGGAATGGCAGCTCACTG

TACACTTTCTTTCTTTCTTTCTTT TGGAATGGCAGCTCACTA

ATIC 347C

ATIC 347G

TCAATTACCTTTTCAATACAATAC CACAGCCTCCTCAACAG

TTACTCAAAATCTACACTTTTTCA CACAGCCTCCTCAACAC

AMPD1 34C

AMPD1 34T

TCATTTACCAATCTTTCTTTATAC TCATACAGCTGAAGAGAAAC

TCATTTCAATCAATCATCAACAAT TCATACAGCTGAAGAGAAAT

ITPA 94C

ITPA 94A

CAATATCATCATCTTTATCATTAC TGCCACCAAAGTGCATGG

TAACATTACAACTATACTATCTAC TGCCACCAAAGTGCATGT

14

Hybridization of amplicons

Microspheres (FlexMAP beads, Tm Bioscience, Toronto, Canada) with anti-tags

for each allele specific primer were added to 22 μL of the ASPE reaction product

for a final volume of 42 μL in 2× Hybrisol (YeBT, Seoul, Korea). The mixtures

were denatured for 10 min at 95℃, and then incubated for 30 min at 37oC.

Microspheres were washed 3 times in 160 μL of Tm hybridization buffer (0.2 M

NaCl, 0.1 M Tris (pH 8.0), 0.08% Triton X-100). Streptavidin-R-phycoerythrin

(SAPE, MOSS, Pasadena, MD) was diluted 1:500 in Tm hybridization buffer, and

100 μL was added to the microsphere-hybridized ASPE reaction products. The

mixture was incubated for 15 min at room temperature.

Data analysis

Microsphere fluorescence was measured using a Luminex 200 cytometer

(Luminex, Austin, TX). Data were collected from a minimum of 50 microspheres of

each type. Masterplex GT software (Miraibio, San Francisco, CA) was used to

analyze single nucleotide polymorphism (SNP) genotypes. Homozygous alleles are

discriminated by differences of 25% in median fluorescence intensity (MFI). The

differences ratio was calculated by dividing the net MFI of one allele by the sum of

the net MFI of all alleles and multiplying by 100.

Statistical analysis

All statistical analyses were performed using SAS ver. 9.3. The x2 test was used

to analyze categorical variables, and the student’s t-test, ANOVA test, Wilcoxon

rank sum test, Kruskal-Wallis test were used for continuous variables. The

15

associations between SNPs and toxicity were analyzed by Fisher’s exact test. SNPs

were assessed in relation to OS and EFS using Kaplan-Meier method. Log-rank test

and Cox-regression analysis were used to evaluate the significance of survival

curves, and P-value of less than 0.05 was considered statistically significant. Due to

insufficient number of patients, multivariate analysis was not performed.

16

RESULTS

Treatment and clinical outcome of patients with osteosarcoma

Data of forty-eight patients with osteosarcoma were analyzed. Treatment and

clinical outcome of the patients are displayed in Table 4. The median follow-up

period was 51.5 months. Twenty-five patients were treated with high-dose MTX as

neoadjuvant chemotherapy (CCG 7921 A/B and COG AOST0331 protocol), and 23

patients were treated according to different regimens not included high-dose MTX

[IA CDDP+ IV ADR (18) and BCD regimen (19)]. Forty-six patients received high-

dose MTX as an adjuvant chemotherapy, but two patients were treated with other

adjuvant protocols not including high-dose MTX [one patient with BCD regimen

and the other patient with POG-ICE regimen (20)] due to significant renal toxicity

after high-dose MTX therapy. All patients, except 4, who received an amputation of

an affected limb, received wide excision and reconstruction. After neoadjuvant

chemotherapy (regardless of the protocol used), 19 of 48 patients showed good

histological response. Among 25 patients who received neoadjuvant chemotherapy

with high-dose MTX, 7 patients showed good response (more than 90% necrosis),

and 18 patients showed poor histological response (less than 90% necrosis). By the

time of analysis, 22 patients experienced relapse, and 32 patients were alive.

17

Table 4. Treatment and clinical outcome of patients with osteosarcoma

N %

Total No. of patients 48

Follow-up (months)

Median 51.5

Range 10-298

Neoadjuvant chemotherapy

CCG7921A (CDDP, ADR, HD-MTX) 17 35.4

CCG7921B (Ifos, ADR, HD-MTX) 2 4.2

IA CDDP + IV ADR(18) 20 41.7

COG AOST0331 (CDDP, ADR, HD-MTX) 6 12.5

Others (BCD; Bleo, CPM, ACTD) 3 6.3

Adjuvant chemotherapy

CCG7921A (CDDP, ADR, HD-MTX) 22 45.8

CCG7921B (CDDP, ADR, HD-MTX, Ifos) 19 39.6

COG AOST0331 (CDDP, ADR, HD-MTX /Ifos, VP16) 5 13.2

Others 2 4.2

Surgical intervention

Reconstruction 40 90

Amputation 4 10

Histological response

Good 19 39.6

Poor 29 60.4

Histological response to neoadjuvant chemotherapy

including HD-MTX

Good 7 28

Poor 18 72

Relapse

No 22 45.8

Yes 26 54.2

18

Last follow-up status

Alive 32 66.7

Dead 16 33.3

CDDP, cisplatin; ADR, adriamycin; HD-MTX, high-dose methotrexate; Ifos,

ifosfamide; Bleo, bleomycin; CPM, cyclophosphamide; ACTD, actinomycin-D;

VP16, etoposide.

19

Histological response and survival of the patients

There were no statistically significant associations between histological response

and gender, age (younger than 10 years vs. older than 10 years), primary tumor site,

histological subtype, metastasis at diagnosis, tumor volume (less than 125.6 cm3 vs.

more than 125.6 cm3) or types of neoadjuvant chemotherapy (including high-dose

MTX or not). EFS and OS were significantly associated with histological response

(P=0.016 and P=0.034) (Figure 2). Cox regression analysis for EFS and OS also

showed significant associations with histological response (OR 0.383, 95% CI

0.161-0.915, P= 0.031, and OR 0.263, 95% CI 0.074-0.942, P= 0.040, respectively).

Age, gender, histological subtype, primary tumor site, presence of metastasis, tumor

volume and types of chemotherapy did not influence survival.

20

Figure 2. Event-free survival (A) and overall survival curves (B) of patients

with osteosarcoma according to histological response.

0 50 100 150 200 250 300

Months from diagnosis (OS)

0.0

0.2

0.4

0.6

0.8

1.0

Cu

mu

lati

ve

surv

ival

P=0.034

Good response

Poor response

B

0 50 100 150 200 250 300

Months from diagnosis (EFS)

0.0

0.2

0.4

0.6

0.8

1.0

Cu

mu

lati

ve

surv

iva

l

Good response

Poor response

P=0.016

A

21

Toxicity after high-dose MTX therapy

High-dose MTX induced toxicity was recorded and graded according to CACTE.

At least one episode of grade 3-4 liver toxicity was experienced by 27 patients

(56.3%), grade 3-4 kidney toxicity was observed in 3 patients (6.3%). Over grade 3

of neurotoxicity was recorded in only one patient (2.1%), and over grade 3 of

stomatitis was experienced by 6 patients (12.5%).

Genotypes of folate pathway genes

SNP genotype results of multiplex analysis were compared with genotype analyses

of standard sequencing method, and both results were entirely consistent. In seven

patients, peripheral blood and tissue samples were analyzed concurrently using

multiplex-PCR, and their SNP results coincided with each other. Average DNA

yields of paraffin embedded tumor tissues were low, and there was a difficulty in

obtaining adequate amounts of DNA for multiplex-PCR analysis for some patients.

Genotype frequencies of polymorphisms are listed in Table 5. In an analysis of

AMPD1 34C>T, most patients showed CC genotype (97.3%), and this SNP was

excluded from further analysis. Genetic distributions of RFC1 80G>A were 19% for

GG, 31% for GA, and 50% for AA genotype. For MTHFR, CT genotype was the

most common (51%) in 677C>T, and AA genotype (65%) was the most common in

1298A>C polymorphism. For DHFR 829C>T, the frequency of CT genotype (89%)

was much more than that of CC genotype (11%). For ATIC 347C>G and ITPA

94C>A, homozygous alleles of CC predominated. Genotypes showed no association

with age, gender, primary tumor site, or metastasis at diagnosis.

22

Table 5. Genotype frequencies of patients with osteosarcoma

Polymorphism Genotype No. of Patients (%)

RFC1 80G>A GG 9 (18.8)

GA 15 (31.3)

AA 24 (50)

DHFR 829C>T CC 5 (11.1)

CT 40 (88.9)

TT 0 (0)

MTHFR 677C>T CC 12 (26.7)

CT 23 (51.1)

TT 10 (22.2)

MTHFR 1298A>C AA 31 (64.6)

AC 16 (33.3)

CC 1 (2.1)

ATIC 347C>G CC 21 (67.7)

CG 8 (25.8)

GG 2 (6.5)

AMPD1 34C>T CC 36 (97.3)

CT 1 (2.7)

TT 0

ITPA 94C>A CC 24 (85.7)

CA 4 (14.3)

AA 0 (0)

23

Correlation between genotyping and event-free and overall survival

In univariate analysis using log-rank test and Cox-regression analysis, there were

no significant associations between these SNPs and overall survival. However,

decreased EFS was observed in the carriers of DHFR 829CC homozygous allele

(P=0.045 in log-rank test and OR 2.88, 95% CI 0.971-8.55, P=0.057 in Cox-

regression analysis) (Figure 3), and this statistical significance was increased in an

analysis on 25 patients who received neoadjuvant chemotherapy including high-

dose MTX (P=0.0018 in log-rank test and OR 21.49, 95% CI 1.34-343.70, P= 0.030

in Cox regression analysis).

24

Figure 3. Event-free survival of patients with osteosarcoma according to

dihydrofolate reductase polymorphism. Event-free survival significantly differed

by polymorphisms of DHFR 829C>T. Patients with the CC genotype showed lower

EFS than patients with the CT genotype.

0 50 100 150 200 250 300

Months from diagnosis (EFS)

0.0

0.2

0.4

0.6

0.8

1.0

Cu

mu

lati

ve

surv

ival

DHFR 829 CC genotype

DHFR 829 CT genotype

P=0.045

25

Correlation between genotyping and histological response after neoadjuvant

chemotherapy

This analysis was conducted on 25 patients who received neoadjuvant

chemotherapies including high-dose MTX. Among these patients, 7 patients showed

good response (more than 90% necrosis), and 18 patients showed poor histological

response (less than 90% necrosis). In the analyses of the relationship between

histological response and various genotypes in these 25 patients, there was no

significantly associated polymorphism referring to histological response. While,

poor histological response showed a trend of increasing in the patients with variants

of MTHFR 677C>T (P=0.078). The associations between each polymorphism and

histological response are presented in Table 6.

26

Table 6. Associations between various polymorphisms and histological response

to neoadjuvant chemotherapy including high-dose methotrexate

Polymorphism Genotype No. of

Patients (%)

Histological

response, P-value

Poor histological

response, OR [95% CI]

RFC1 80G>A GG 6 (24)

1.000

GA 9 (36)

AA 10 (40)

GA/AA 19 (76) 0.74 1.4 [0.19-10.14]

DHFR 829C>T CC 3 (12)

CT 22 (88)

TT 0

CT/TT 22 (88)) 0.636 0.67 [0.22-2.01]

MTHFR 677C>T CC 5 (22)

0.222

CT 11 (48)

TT 7 (30)

CT/TT 18 (78) 0.078 3.5 [0.84-14.56]

MTHFR 1298A>C AA 16 (67)

0.389

AC 7 (29)

CC 1 (4)

AC/CC 8 (33) 0.937 0.95 [0.28-3.19]

ATIC 347C>G CC 17 (68)

0.130

CG 6 (24)

GG 2 (8)

CG/GG 8 (32) 0.154 0.17 [0.007-3.89]

ITPA 94C>A CC 21 (84)

1.000

CA 4 (16)

AA 0

CA/AA 4 (16) 0.826 1.31 [0.115-14.93]

27

Correlation between MTX concentration and genotyping

Plasma MTX concentrations were measured at 24, 48 and 72 hours from the start

of infusion of high-dose MTX. Because there were quite a few missing data, the

statistical analyses of plasma levels of MTX did not involve all 48 patients. The

median MTX concentration at 24 hours (24hr MTX) was 4.66 µmol/L (range, 0.19-

378.6 µmol/L) in 24 patients, and median MTX concentrations at 48 hours (48hr

MTX) and 72 hours (72hr MTX) were 0.65 µmol/L (range, 0.09-97.3 µmol/L) in 36

patients and 0.21 µmol/L (range, 0.02-9.75 µmol/L) in 32 patients, respectively. An

analysis of association between genotypes and MTX concentration showed that

48hr MTX significantly increased in variants of RFC1 80G>A (P=0.0275). While

other polymorphisms of ATIC 347C>G, DHFR 829C>T, ITPA 94C>A, MTHFR

677C>T and MTHFR 1298A>C did not show any association with serial plasma

MTX levels (Table 7).

28

Table 7. Genotypic associations with methotrexate concentration at 48 hours

after high-dose methotrexate therapy

Polymorphism Genotype No. of patients

Median 48 hr

MTX (µmol/L) SD P-value

ATIC 347C>G CC 18 1.71 2.33

0.8984 CG 7 0.62 0.39

GG 2 0.94 1.03

DHFR 829C>T CC 4 1.16 1.24 0.5746

CT 30 1.25 1.86

ITPA 94C>A CC 22 1.21 2 0.1886

CA 4 1.83 2.11

MTHFR 677C>T CC 8 0.72 0.36

0.9118 CT 17 7.06 23.36

TT 9 1.5 1.61

MTHFR 1298A>C AA 21 5.68 21.02

0.3906 AC 14 1.4 2.45

AC/CC 1 1.36 .

RFC1 80G>A GG 8 0.55 0.51

0.0275 GA 15 2.22 2.36

AA 13 8.79 26.67

29

Correlation between genotyping and toxicity after high-dose MTX therapy

Significant genotypic associations with grade 3-4 toxicity after high-dose MTX

therapy are displayed in Table 8. RFC1 80 G>A was associated with over grade 3

stomatitis (P=0.012), and carriers of MTHFR 677 C>T polymorphisms had a

tendency towards grade 3-4 liver toxicity (P=0.067). MTHFR 1298 A>C were not

associated with liver, kidney, CNS or GI toxicities. DHFR 829 C>T were not

associated with any severe toxicities, either. Although ATIC 347C>G was associated

with grade 3-4 liver toxicity (P=0.043), another polymorphisms of adenosine

pathway genes did not correlate with significant toxicities. Grade 3-4 kidney

toxicity and neurological toxicity developed in only 3 and 1 patients, respectively,

and no significant association with these SNPs was found in this study.

30

Table 8. Genotypic associations with grade 3-4 toxicities after high-dose

methotrexate therapy

Toxicity Polymorphism Genotype Toxicity,

P-value

Toxicity,

OR [95% CI]

Stomatitis RFC1 80G>A GG

0.008

GA

AA

GA/AA 0.012 7.5 [1.7-33.8]

Liver toxicity MTHFR 677C>T CC

0.093

CT

TT

CT/TT 0.069 1.68 [0.8-3.6]

ATIC 347C>G CC

0.043

CG

GG

CG/GG 0.083 3.5 [0.66-18.5]

31

DISCUSSION

Methotrexate is an effective anti-folate agent which is successfully used for the

treatement of various diseases, but the wide array of applications of the treatment

has hampered the establishment of definite conclusions with respect to clinical

impact of genetic polymorphisms. Due to the diversity of usage, greatly different

doses and treatment protocols have been tested, even for the same disease [e.g.,

high-dose MTX vs. maintenance dose of MTX in acute lymphoblastic leukemia

(ALL)], which makes direct comparisons across a range of studies difficult.

Folate metabolism plays an essential role in both DNA synthesis and methylation.

Several functional polymorphisms in the genes encoding enzymes and transporters

in the folate pathway affect the risk of various malignancies (2, 21-23). However,

for osteosarcoma, the subject hitherto has received but scant attention, and not much

is known about the influence of genetic polymorphisms on susceptibility to

osteosarcoma, or indeed toxicity and response to chemotherapy. Understanding and

overcoming the inter-individual differences in drug response and toxicity remains a

major challenge in osteosarcoma chemotherapy.

This study searched diverse kinds of genetic polymorphisms in the folate-MTX

metabolic pathway and investigated possible associations between these

polymorphisms and clinical data. The selection of candidate polymorphisms was

based on established pharmacological pathways of methotrexate and associations

which had previously been reported in literature. Although this study is limited by a

small sample size, due largely to the retrospective nature of this study and the rarity

32

of this tumor, all patients were treated with the same dose of MTX and standardized

leucovorin rescue, as well as having the same ethnicity. Herein, this study observed

several novel polymorphic associations, as well as confirming several previously

reported findings. In addition, this study observed that frequencies of some

polymorphisms differed from the reported genotype frequencies. In most SNPs,

their frequencies were consistent with previously reported studies. However,

analysis of AMPD1 34C>T showed the dominance of the CC genotype (97.3%)

unlike other studies described that the genetic distributions of AMPD1 34C>T were

74% for CC, 25% for CT and 1% for TT genotype (24, 25). Also, unlike a previous

report of CC dominant distribution of DHFR 829C>T in the general population (26),

the CT genotype was much more prevalent than CC genotype. Indeed, there exist

ethnic-related differences in the frequency distribution of genetic polymorphisms in

the folate pathway genes (27-29). Furthermore, because genetic variations not only

affect treatment response, but also the risk of developing malignancies (2, 21, 23, 28,

30, 31), further studies comparing these polymorphisms with a normal control

population in Korean are warranted.

Genetic polymorphisms of folate pathway and treatment outcome

For osteosarcoma, increased DHFR expression was reported to be associated with

metastatic or recurrent disease (13, 15). One of the important mechanisms of MTX

resistance is an increase in DHFR activity due to amplification of the DHFR gene or

decreased binding of MTX to DHFR due to mutations in the DHFR gene (12, 15).

This suggests that genetic polymorphisms which affect the expression of DHFR

33

may modulate the pharmacological response to MTX. Although, in comparison with

other genes involved in the folate pathway, the polymorphisms of DHFR gene have

received relatively little attention. DHFR 829C>T is known to increase the

expression of DHFR, but the clinical role of this SNP in osteosarcoma has not yet

been evaluated (26, 32). This study could not find any significant difference in the

frequencies of DHFR 829C>T SNPs between the patients with and without

metastasis at diagnosis. However, interestingly enough, this study found that

patients with the CT genotype had better EFS than patients with the CC genotype. T

allele, which has been regarded to increase the expression of DHFR, showed better

EFS in this analysis. A similar conclusion about this correlation between

unfavorable EFS and low DHFR expression has been made by a CCG report of

Levy et al. (33). In his study of 40 children with newly diagnosed ALL, he found

that low DHFR was associated with poor outcome. DHFR expression was inversely

related to proliferative cell nuclear antigens necessary for G1-S transit, and it

signified that DHFR was increased in the S phase. He suggested that DHFR

expression might be a marker for cell proliferation in patient’s blasts other than drug

resistance. The results of this study also reflect a hypothesis that childhood high-

grade osteosarcoma composed of fast dividing cells in the S phase, which have high

DHFR activity, might be more susceptible to multi-agent chemotherapy including

high-dose MTX. This study is the first to report on the DHFR 829C>T

polymorphism as a pharmacogenetic determinant of treatment outcome for

osteosarcoma. This study suggests that this genetic polymorphism of DHFR might

34

be an important prognostic factor in osteosarcoma. Additional studies are necessary

in order to clarify the mechanisms for the correlation of DHFR 829 CC homozygote

and poor outcome.

The effects of MTX on adenosine metabolism have recently received a lot of

attention. Although polymorphisms of ITPA 94C>A and ATIC 347C>G were

reported to affect the treatment outcome in rheumatoid diseases (24, 34, 35), this

study failed to find any significant association between these SNPs in the adenosine

pathway and osteosarcoma disease outcome. The anti-inflammatory effect of MTX

via this adenosine pathway might not be enough to affect the treatment outcome in

osteosarcoma patients

Genetic polymorphisms of folate pathway and histological response

The relationship between poor histological response and inferior survival has been

well established in osteosarcoma (36-38). Many researchers have tried to find a

means of identifying patients who are at risk of poor response at diagnosis, and

some factors, including genetic variations, have been suggested to be associated

with poor responses to chemotherapy (9, 38, 39). In this study, MTHFR 677T allele

showed a tendency towards poor histological response. Although this finding did

not reach statistical significance, considering that the MTHFR 677T allele is related

to poor pharmacological response and a negative prognostic value in hematological

malignancies (40-43), it might suggest a correlation between MTHFR 677T allele

and poor histological response in osteosarcoma.

35

Decreased RFC1 expression has been suggested as another mechanism of

methotrexate resistance in osteosarcoma (13, 15, 44). In some studies of childhood

ALL, the 80A variant of RFC1 was found to result in the impaired intracellular

transport of MTX, and this was related to poor prognosis (33, 45). However, a

search for their association did not return any significant results in this study. RFC1

polymorphisms did not affect the tumor necrosis rate after neoadjuvant

chemotherapy. Although this might be attributable, in part, to the limited numbers of

patients in this analysis, histological response to high-dose MTX can occur as a

result of many mechanisms involved in the MTX-folate pathway, moreover,

histological response is not due to MTX alone but rather to the combined effect of

many chemotherapeutic agents, including MTX, adriamycin, and cisplatin (39, 46).

Additionally, the MTX transport capacity of RFC1 might significantly influence the

MTX effect in low-dose MTX settings, whereas the trivial difference of this

capacity might not be so important in this high-dose MTX setting for osteosarcoma,

as with the use of high-dose MTX, as the difference in propensity for MTX-

polyglutamation has less influence on cure rates (47).

Genetic polymorphisms of folate pathway and MTX concentration

Plasma levels of MTX at 48 hours after MTX administration were significantly

higher in patients with the RFC1 80A allele, providing additional support for

differential carrier activity among those with the variant allele. RFC1 is a major

route of entry for MTX into the cell. A polymorphism in the RFC1 gene (80G>A,

Arg27His) was found to be associated with decreased carrier function or affinity for

36

folate (4, 48). The A allele was associated with higher plasma folate levels, and the

G allele correlated with lower plasma folate and higher homocysteine levels (49,

50). Our result indicates a decrease in the MTX uptake capacity of RFC1 in carriers

of the 80A allele as compared to 80G allele, and it is consistent with the previous

report in ALL which showed that patients with a homozygous AA genotype had

significantly higher concentrations of MTX than the other genotype groups (45).

Genetic polymorphisms of folate pathway and toxicity after high-dose MTX

therapy

High-dose MTX therapy causes significant side effects in some patients. The early

identification of patients at risk of severe toxicity may facilitate improved

monitoring and early intervention to minimize complications. This study identified

that several polymorphisms influenced MTX toxicities in osteosarcoma. RFC1 80

G>A was associated with severe stomatitis, ATIC 347 C>G was associated with

liver toxicity, and MTHFR 677 C>T showed a tendency towards increased liver

toxicity.

Some studies pointed to 80A allele of RFC1 as a marker of increased occurrence

of adverse reactions (51-53), but this finding regarding an association with RFC1

80G>A and stomatitis in osteosarcoma has not been previously reported. The risk of

stomatitis is related to a long duration of MTX exposure and high plasma levels of

MTX (54-56), and it might be caused by the vulnerability of the mucosal membrane

to MTX (57).

37

The majority of studies about the relationship between polymorphisms in the

adenosine pathway and outcome of MTX treatment have been based on rheumatoid

arthritis and psoriasis. Although many studies still hold widely different views on

the impact of the ATIC 347G allele on MTX efficacy, with regard to toxicity, ATIC

347G allele has been associated with a greater likelihood of developing significant

toxicities (24, 48, 58). This study also showed that the G allele of ATIC 347C>G

has a higher risk of developing liver toxicity after high-dose MTX in osteosarcoma

patients, and this finding has not been previously reported.

MTHFR has two well-described, non-synonymous SNPs, 677C>T and 1298A>C.

The variant alleles for both of these polymorphisms have been shown to result in

decreased enzyme activity, and therefore, to affect the toxicity of MTX (43, 59, 60).

MTHFR 677C>T has been associated with a 40% decrease in enzyme activity in

heterozygous carriers, and up to a 70% decrease in homozygous carriers. There is a

growing body of evidence of association between the 677T allele and a higher risk

of MTX toxicity in various diseases, including acute leukemia, non-Hodgkin

lymphoma, solid tumors and rheumatoid arthritis (40, 61-63). Our results also show

that the carriers of this 677T allele had an increased risk of liver toxicity compared

to the individuals with the 677CC homozygous allele. On the other hand, the

functional impact of the MTHFR 1298A>C polymorphism has been relatively less

well characterized. This 1298C allele also seems to decrease enzyme activity but to

a lesser degree than 677T, and the results of studies on the impact of this SNP on

MTX related toxicity and efficacy have been inconsistent (64-66). With regard to

38

toxicity, under conditions of extreme folate depletion, such as by high-dose MTX

therapy, the effect of this SNP might be clinically relevant. Though, this study did

not reveal any significant association between this SNP and toxicity after high-dose

MTX.

Many of the studies about genetic polymorphisms undertaken to date, including

this study, have been limited by small sample size. While the appropriate research

object number determined for this study was more than 150 patients for each

analysis, this study was limited due to retrospective recruitment and the rarity of

osteosarcoma. Also, this study was limited by inadequate DNA yields of paraffin

embedded tumor tissues, and thus, for some of patients, there was difficulty

obtaining an adequate amount of DNA for multiplex-PCR analysis, and all

genotypic information of these 48 patients could not be obtained. In addition, due to

the characteristics of the retrospective study, there was a considerable loss of

clinical data. However, despite the small number of patients and retrospective

nature of the analysis, strengths of this study include the extensive genotype data

and clinical and toxicity data from diagnosis to disease outcome, and that some

results may have important implications for patient management and deserve

validation in a larger, prospective cohort.

In order to identify combinations of genotypes that may influence the clinical

response to MTX, future research needs to consider various genetic polymorphisms

in the folate pathway, which are known to alter enzyme function, alone and in

combination, in a much larger cohort of patients. Additionally, in the near term,

39

analyses of various polymorphisms in the genes for the enzymes involved in the

metabolic pathways of chemotherapeutic agents may directly provide gene-based

information that predicts drug response to treatment of cancer patients, and such

information which may ultimately allow for tailored chemotherapy regimens.

40

CONCLUSIONS

In this study of 48 children with osteosarcoma who were treated with high-dose

MTX, it was identified that common genetic polymorphisms of the folate metabolic

pathway could affect the treatment outcome and toxicity after high-dose MTX

therapy. Patients with DHFR 829CC genotype had significant lower EFS than

patients with the 829CT genotype. MTHFR 677C>T showed a tendency towards

poor histological response to neoadjuvant chemotherapy including high-dose MTX.

Children with the RFC1 80A allele had higher plasma levels of MTX and a higher

risk of severe stomatitis. Patients with lower MTHFR activity (MTHFR 677 CT and

TT genotypes) were subject to greater hepatic toxicity after high-dose MTX therapy.

With regard to adenosine pathway genes, there were no significant associations

between SNPs and the outcome of MTX therapy, except ATIC 347C>G. and liver

toxicity. This study provides considerable information which will further increase

the knowledge of how to use host genetic variations to tailor chemotherapy for

individuals with osteosarcoma.

41

REFERENCES

1. Das PM, Singal R. DNA methylation and cancer. Journal of clinical

oncology : official journal of the American Society of Clinical Oncology.

2004;22(22):4632-42.

2. de Jonge R, Tissing WJ, Hooijberg JH, Jansen G, Kaspers GJ, Lindemans

J, et al. Polymorphisms in folate-related genes and risk of pediatric acute

lymphoblastic leukemia. Blood. 2009;113(10):2284-9.

3. Blount BC, Mack MM, Wehr CM, MacGregor JT, Hiatt RA, Wang G, et

al. Folate deficiency causes uracil misincorporation into human DNA and

chromosome breakage: implications for cancer and neuronal damage.

Proceedings of the National Academy of Sciences of the United States of

America. 1997;94(7):3290-5.

4. Robien K, Boynton A, Ulrich CM. Pharmacogenetics of folate-related drug

targets in cancer treatment. Pharmacogenomics. 2005;6(7):673-89.

5. Castaldo P, Magi S, Nasti AA, Arcangeli S, Lariccia V, Alesi N, et al.

Clinical pharmacogenetics of methotrexate. Current drug metabolism.

2011;12(3):278-86.

6. Schmiegelow K. Advances in individual prediction of methotrexate

toxicity: a review. British journal of haematology. 2009;146(5):489-503.

7. Meyers PA, Schwartz CL, Krailo M, Kleinerman ES, Betcher D, Bernstein

ML, et al. Osteosarcoma: a randomized, prospective trial of the addition of

ifosfamide and/or muramyl tripeptide to cisplatin, doxorubicin, and high-

dose methotrexate. Journal of clinical oncology : official journal of the

American Society of Clinical Oncology. 2005;23(9):2004-11.

8. Ferrari S, Smeland S, Mercuri M, Bertoni F, Longhi A, Ruggieri P, et al.

Neoadjuvant chemotherapy with high-dose Ifosfamide, high-dose

methotrexate, cisplatin, and doxorubicin for patients with localized

osteosarcoma of the extremity: a joint study by the Italian and Scandinavian

Sarcoma Groups. Journal of clinical oncology : official journal of the

American Society of Clinical Oncology. 2005;23(34):8845-52.

42

9. Bacci G, Ferrari S, Delepine N, Bertoni F, Picci P, Mercuri M, et al.

Predictive factors of histologic response to primary chemotherapy in

osteosarcoma of the extremity: study of 272 patients preoperatively treated

with high-dose methotrexate, doxorubicin, and cisplatin. Journal of clinical

oncology : official journal of the American Society of Clinical Oncology.

1998;16(2):658-63.

10. Delepine N, Delepine G, Bacci G, Rosen G, Desbois JC. Influence of

methotrexate dose intensity on outcome of patients with high grade

osteogenic osteosarcoma. Analysis of the literature. Cancer.

1996;78(10):2127-35.

11. Bertino JR, Goker E, Gorlick R, Li WW, Banerjee D. Resistance

Mechanisms to Methotrexate in Tumors. The oncologist. 1996;1(4):223-6.

12. Gorlick R, Goker E, Trippett T, Waltham M, Banerjee D, Bertino JR.

Intrinsic and acquired resistance to methotrexate in acute leukemia. The New

England journal of medicine. 1996;335(14):1041-8.

13. Serra M, Reverter-Branchat G, Maurici D, Benini S, Shen JN, Chano T,

et al. Analysis of dihydrofolate reductase and reduced folate carrier gene

status in relation to methotrexate resistance in osteosarcoma cells. Annals of

oncology : official journal of the European Society for Medical Oncology /

ESMO. 2004;15(1):151-60.

14. Scionti I, Michelacci F, Pasello M, Hattinger CM, Alberghini M, Manara

MC, et al. Clinical impact of the methotrexate resistance-associated genes C-

MYC and dihydrofolate reductase (DHFR) in high-grade osteosarcoma.

Annals of oncology : official journal of the European Society for Medical

Oncology / ESMO. 2008;19(8):1500-8.

15.Guo W, Healey JH, Meyers PA, Ladanyi M, Huvos AG, Bertino JR, et al.

Mechanisms of methotrexate resistance in osteosarcoma. Clinical cancer

research : an official journal of the American Association for Cancer

Research. 1999;5(3):621-7.

16. Yang R, Qin J, Hoang BH, Healey JH, Gorlick R. Polymorphisms and

methylation of the reduced folate carrier in osteosarcoma. Clinical

orthopaedics and related research. 2008;466(9):2046-51.

43

17. Marina N, Bielack S, Whelan J, Smeland S, Krailo M, Sydes MR, et al.

International collaboration is feasible in trials for rare conditions: the

EURAMOS experience. Cancer treatment and research. 2009;152:339-53.

18. Benjamin RS, Chawla SP, Carrasco CH, Raymond AK, Murray JA,

Armen T, et al. Preoperative chemotherapy for osteosarcoma with

intravenous adriamycin and intra-arterial cis-platinum. Annals of oncology :

official journal of the European Society for Medical Oncology / ESMO.

1992;3 Suppl 2:S3-6.

19. Provisor AJ, Ettinger LJ, Nachman JB, Krailo MD, Makley JT, Yunis EJ,

et al. Treatment of nonmetastatic osteosarcoma of the extremity with

preoperative and postoperative chemotherapy: a report from the Children's

Cancer Group. Journal of clinical oncology : official journal of the American

Society of Clinical Oncology. 1997;15(1):76-84.

20. Kung FH, Desai SJ, Dickerman JD, Goorin AM, Harris MB, Inoue S, et

al. Ifosfamide/carboplatin/etoposide (ICE) for recurrent malignant solid

tumors of childhood: a Pediatric Oncology Group Phase I/II study. Journal of

pediatric hematology/oncology. 1995;17(3):265-9.

21. Skibola CF, Forrest MS, Coppede F, Agana L, Hubbard A, Smith MT, et

al. Polymorphisms and haplotypes in folate-metabolizing genes and risk of

non-Hodgkin lymphoma. Blood. 2004;104(7):2155-62.

22. Ulrich CM, Bigler J, Bostick R, Fosdick L, Potter JD. Thymidylate

synthase promoter polymorphism, interaction with folate intake, and risk of

colorectal adenomas. Cancer research. 2002;62(12):3361-4.

23. Kim HN, Lee IK, Kim YK, Tran HT, Yang DH, Lee JJ, et al.

Association between folate-metabolizing pathway polymorphism and non-

Hodgkin lymphoma. British journal of haematology. 2008;140(3):287-94.

24. Wessels JA, Kooloos WM, De Jonge R, De Vries-Bouwstra JK, Allaart

CF, Linssen A, et al. Relationship between genetic variants in the adenosine

pathway and outcome of methotrexate treatment in patients with recent-onset

rheumatoid arthritis. Arthritis and rheumatism. 2006;54(9):2830-9.

25. de Groote P, Mouquet F, Dallongeville J, Lamblin N, Bauters C. The

impact of the AMPD1 gene polymorphism on exercise capacity, other

44

prognostic parameters, and survival in patients with stable congestive heart

failure. A study on 686 consecutive patients. Am Heart J. 2007;153(5):e15.

26. Goto Y, Yue L, Yokoi A, Nishimura R, Uehara T, Koizumi S, et al. A

novel single-nucleotide polymorphism in the 3'-untranslated region of the

human dihydrofolate reductase gene with enhanced expression. Clinical

cancer research : an official journal of the American Association for Cancer

Research. 2001;7(7):1952-6.

27. Hughes LB, Beasley TM, Patel H, Tiwari HK, Morgan SL, Baggott JE,

et al. Racial or ethnic differences in allele frequencies of single-nucleotide

polymorphisms in the methylenetetrahydrofolate reductase gene and their

influence on response to methotrexate in rheumatoid arthritis. Ann Rheum

Dis. 2006;65(9):1213-8.

28. Koppen IJ, Hermans FJ, Kaspers GJ. Folate related gene polymorphisms

and susceptibility to develop childhood acute lymphoblastic leukaemia. Br J

Haematol. 2010;148(1):3-14.

29. Zanrosso CW, Hatagima A, Emerenciano M, Ramos F, Figueiredo A,

Felix TM, et al. The role of methylenetetrahydrofolate reductase in acute

lymphoblastic leukemia in a Brazilian mixed population. Leuk Res.

2006;30(4):477-81.

30. Krajinovic M, Costea I, Primeau M, Dulucq S, Moghrabi A. Combining

several polymorphisms of thymidylate synthase gene for pharmacogenetic

analysis. The pharmacogenomics journal. 2005;5(6):374-80.

31. Krajinovic M, Lamothe S, Labuda D, Lemieux-Blanchard E, Theoret Y,

Moghrabi A, et al. Role of MTHFR genetic polymorphisms in the

susceptibility to childhood acute lymphoblastic leukemia. Blood.

2004;103(1):252-7.

32. Gervasini G. Polymorphisms in methotrexate pathways: what is clinically

relevant, what is not, and what is promising. Current drug metabolism.

2009;10(6):547-66.

33. Levy AS, Sather HN, Steinherz PG, Sowers R, La M, Moscow JA, et al.

Reduced folate carrier and dihydrofolate reductase expression in acute

45

lymphocytic leukemia may predict outcome: a Children's Cancer Group

Study. Journal of pediatric hematology/oncology. 2003;25(9):688-95.

34. Wessels JA, van der Kooij SM, le Cessie S, Kievit W, Barerra P, Allaart

CF, et al. A clinical pharmacogenetic model to predict the efficacy of

methotrexate monotherapy in recent-onset rheumatoid arthritis. Arthritis and

rheumatism. 2007;56(6):1765-75.

35. Fransen J, Kooloos WM, Wessels JA, Huizinga TW, Guchelaar HJ, van

Riel PL, et al. Clinical pharmacogenetic model to predict response of MTX

monotherapy in patients with established rheumatoid arthritis after DMARD

failure. Pharmacogenomics. 2012;13(9):1087-94.

36. Janeway KA, Barkauskas DA, Krailo MD, Meyers PA, Schwartz CL,

Ebb DH, et al. Outcome for adolescent and young adult patients with

osteosarcoma: a report from the Children's Oncology Group. Cancer.

2012;118(18):4597-605.

37. Craft AW. Osteosarcoma: the European Osteosarcoma Intergroup (EOI)

perspective. Cancer Treat Res. 2009;152:263-74.

38. Kim MS, Lee SY, Lee TR, Cho WH, Song WS, Koh JS, et al. Prognostic

nomogram for predicting the 5-year probability of developing metastasis

after neo-adjuvant chemotherapy and definitive surgery for AJCC stage II

extremity osteosarcoma. Ann Oncol. 2009;20(5):955-60.

39. Ochi K, Daigo Y, Katagiri T, Nagayama S, Tsunoda T, Myoui A, et al.

Prediction of response to neoadjuvant chemotherapy for osteosarcoma by

gene-expression profiles. International journal of oncology. 2004;24(3):647-

55.

40. Gemmati D, Ongaro A, Tognazzo S, Catozzi L, Federici F, Mauro E, et

al. Methylenetetrahydrofolate reductase C677T and A1298C gene variants in

adult non-Hodgkin's lymphoma patients: association with toxicity and

survival. Haematologica. 2007;92(4):478-85.

41. Aplenc R, Thompson J, Han P, La M, Zhao H, Lange B, et al.

Methylenetetrahydrofolate reductase polymorphisms and therapy response in

pediatric acute lymphoblastic leukemia. Cancer research. 2005;65(6):2482-7.

46

42. Krajinovic M, Lemieux-Blanchard E, Chiasson S, Primeau M, Costea I,

Moghrabi A. Role of polymorphisms in MTHFR and MTHFD1 genes in the

outcome of childhood acute lymphoblastic leukemia. The

pharmacogenomics journal. 2004;4(1):66-72.

43. Eissa DS, Ahmed TM. C677T and A1298C polymorphisms of the

methylenetetrahydrofolate reductase gene: effect on methotrexate-related

toxicity in adult acute lymphoblastic leukaemia. Blood Coagul Fibrinolysis.

2012.

44. Patino-Garcia A, Zalacain M, Marrodan L, San-Julian M,

Sierrasesumaga L. Methotrexate in pediatric osteosarcoma: response and

toxicity in relation to genetic polymorphisms and dihydrofolate reductase

and reduced folate carrier 1 expression. The Journal of pediatrics.

2009;154(5):688-93.

45. Laverdiere C, Chiasson S, Costea I, Moghrabi A, Krajinovic M.

Polymorphism G80A in the reduced folate carrier gene and its relationship to

methotrexate plasma levels and outcome of childhood acute lymphoblastic

leukemia. Blood. 2002;100(10):3832-4.

46. Mintz MB, Sowers R, Brown KM, Hilmer SC, Mazza B, Huvos AG, et

al. An expression signature classifies chemotherapy-resistant pediatric

osteosarcoma. Cancer research. 2005;65(5):1748-54.

47. Whitehead VM, Shuster JJ, Vuchich MJ, Mahoney DH, Jr., Lauer SJ,

Payment C, et al. Accumulation of methotrexate and methotrexate

polyglutamates in lymphoblasts and treatment outcome in children with B-

progenitor-cell acute lymphoblastic leukemia: a Pediatric Oncology Group

study. Leukemia : official journal of the Leukemia Society of America,

Leukemia Research Fund, UK. 2005;19(4):533-6.

48. Stamp LK, Roberts RL. Effect of genetic polymorphisms in the folate

pathway on methotrexate therapy in rheumatic diseases. Pharmacogenomics.

2011;12(10):1449-63.

49. Chango A, Emery-Fillon N, de Courcy GP, Lambert D, Pfister M,

Rosenblatt DS, et al. A polymorphism (80G->A) in the reduced folate carrier

gene and its associations with folate status and homocysteinemia. Molecular

genetics and metabolism. 2000;70(4):310-5.

47

50. Drozdzik M, Rudas T, Pawlik A, Gornik W, Kurzawski M, Herczynska

M. Reduced folate carrier-1 80G>A polymorphism affects methotrexate

treatment outcome in rheumatoid arthritis. Pharmacogenomics J.

2007;7(6):404-7.

51. Campalani E, Arenas M, Marinaki AM, Lewis CM, Barker JN, Smith

CH. Polymorphisms in folate, pyrimidine, and purine metabolism are

associated with efficacy and toxicity of methotrexate in psoriasis. The

Journal of investigative dermatology. 2007;127(8):1860-7.

52. Warren RB, Smith RL, Campalani E, Eyre S, Smith CH, Barker JN, et al.

Genetic variation in efflux transporters influences outcome to methotrexate

therapy in patients with psoriasis. The Journal of investigative dermatology.

2008;128(8):1925-9.

53. Kishi S, Cheng C, French D, Pei D, Das S, Cook EH, et al. Ancestry and

pharmacogenetics of antileukemic drug toxicity. Blood. 2007;109(10):4151-

7.

54. Widemann BC, Adamson PC. Understanding and managing methotrexate

nephrotoxicity. The oncologist. 2006;11(6):694-703.

55. Maiguma T, Hayashi Y, Ueshima S, Kaji H, Egawa T, Chayama K, et al.

Relationship between oral mucositis and high-dose methotrexate therapy in

pediatric acute lymphoblastic leukemia. Int J Clin Pharmacol Ther.

2008;46(11):584-90.

56. Kanbayashi Y, Nomura K, Okamoto K, Matsumoto Y, Horiike S, Takagi

T, et al. Statistical examination to determine whether only 48-h value for

serum concentration during high-dose methotrexate therapy is a predictor for

clinical adverse events using ordered logistic regression analysis. Ann

Hematol. 2010;89(10):965-9.

57. Cheng KK. Association of plasma methotrexate, neutropenia, hepatic

dysfunction, nausea/vomiting and oral mucositis in children with cancer.

European journal of cancer care. 2008;17(3):306-11.

58. Weisman MH, Furst DE, Park GS, Kremer JM, Smith KM, Wallace DJ,

et al. Risk genotypes in folate-dependent enzymes and their association with

48

methotrexate-related side effects in rheumatoid arthritis. Arthritis and

rheumatism. 2006;54(2):607-12.

59. Yang L, Hu X, Xu L. Impact of methylenetetrahydrofolate reductase

(MTHFR) polymorphisms on methotrexate-induced toxicities in acute

lymphoblastic leukemia: a meta-analysis. Tumour Biol. 2012;33(5):1445-54.

60. Haase R, Elsner K, Merkel N, Stiefel M, Mauz-Korholz C, Kramm CM,

et al. High dose methotrexate treatment in childhood ALL: pilot study on the

impact of the MTHFR 677C>T and 1298A>C polymorphisms on MTX-

related toxicity. Klin Padiatr. 2012;224(3):156-9.

61. Chiusolo P, Reddiconto G, Farina G, Mannocci A, Fiorini A, Palladino

M, et al. MTHFR polymorphisms' influence on outcome and toxicity in

acute lymphoblastic leukemia patients. Leukemia research.

2007;31(12):1669-74.

62. Toffoli G, Russo A, Innocenti F, Corona G, Tumolo S, Sartor F, et al.

Effect of methylenetetrahydrofolate reductase 677C-->T polymorphism on

toxicity and homocysteine plasma level after chronic methotrexate treatment

of ovarian cancer patients. International journal of cancer Journal

international du cancer. 2003;103(3):294-9.

63. van Ede AE, Laan RF, Blom HJ, Huizinga TW, Haagsma CJ, Giesendorf

BA, et al. The C677T mutation in the methylenetetrahydrofolate reductase

gene: a genetic risk factor for methotrexate-related elevation of liver

enzymes in rheumatoid arthritis patients. Arthritis and rheumatism.

2001;44(11):2525-30.

64. Kantar M, Kosova B, Cetingul N, Gumus S, Toroslu E, Zafer N, et al.

Methylenetetrahydrofolate reductase C677T and A1298C gene

polymorphisms and therapy-related toxicity in children treated for acute

lymphoblastic leukemia and non-Hodgkin lymphoma. Leuk Lymphoma.

2009;50(6):912-7.

65. Windsor RE, Strauss SJ, Kallis C, Wood NE, Whelan JS. Germline

genetic polymorphisms may influence chemotherapy response and disease

outcome in osteosarcoma: a pilot study. Cancer. 2012;118(7):1856-67.

49

66. Lee YH, Song GG. Associations between the C677T and A1298C

polymorphisms of MTHFR and the efficacy and toxicity of methotrexate in

rheumatoid arthritis: a meta-analysis. Clin Drug Investig. 2010;30(2):101-8.

50

국문 초록

배경 및 목적: 골육종은 소아청소년기에 가장 많이 발생하는 악성

골종양이다. Methotrexate, adriamycin, cisplatin을 포함하는 다 약제

병합요법은 괄목할 만한 치료성적의 향상을 가져왔으나, 이러한 약물의

효과는 약물대사에 관여하는 여러 대사과정에 의해 영향을 받는다. 특히,

methotrexate는 대표적인 folic acid 길항체로서 골육종 치료에

사용되는 중요한 약제이다. Folate 대사과정에 관여하는 유전자의

다양성은 소아골육종 환자에서 고용량 methotrexate 치료 후 반응 및

독성에 중대한 영향을 미칠 것으로 예상된다.

대상 및 방법: 48명의 소아 골육종 환자를 대상으로 혈액과 조직 검체를

이용하여 DNA를 추출하여 분석하였다. 19명의 환자에서 혈액 검체를

이용하였고, 22명의 환자에서 paraffin 보관 처리된 종양 조직 검체를

이용하였으며, 7명의 환자에서는 종양 조직과 혈액 검체 모두에서

DNA를 추출하여 양 검체 간의 유전자 다형성의 차이가 있는지

확인하였다. 환자들은 골육종 진단을 받고 고용량 methotrexate가

포함된 항암치료를 받았고, 현재 치료를 모두 종료한 환자들을 대상으로

하였다. Methotrexate 및 folate의 대사에 관여하는 6개의 유전자를

대상으로 유전자 다형성을 검사하였다. RFC1 유전자의 80G>A, DHFR

51

유전자의 829C>T, MTHFR 유전자의 677C>T와 1298A>C, AMPD1

유전자의 34C>T, ATIC 유전자의 347C>G, ITPA 유전자의 94C>A를

각각 분석하였고, 각 유전자 다형성이 골육종 환자들의 생존율, 고용량

methotrexate를 포함하는 선행항암치료 후 조직학적 괴사 정도,

methotrexate 치료 이후의 부작용 등에 미치는 영향을 비교 분석하였다.

결과: 전체 생존율에 대한 분석에서, DHFR유전자의 발현을

증가시킨다고 알려져 있는 DHFR 829C>T 변이형을 가진 환자의

무병생존율이 CC 유전형을 가지고 있는 환자보다 유의하게 높은 것을

관찰하였다(P=0.045). 선행항암치료 후 조직학적 반응(종양의 괴사

정도)과 통계적인 유의성을 보이는 유전자 다형성은 관찰되지 않았다.

그러나, MTHFR 677C>T 변이형에서 조직학적 반응이 떨어지는 것을

관찰하였다(P=0.078). 고용량 methotrexate 치료 48시간 후 혈중

methotrexate의 농도는 RFC1 80G>A 변이형에서 유의하게

높았고(P=0.027), RFC1 80G>A 변이형에서 grade 3 이상의 구내염이

발생할 위험 역시 유의하게 높았다(P=0.012). 통계적인 유의성은

떨어지나 MTHFR 677C>T 변이형에서 고용량 methotrexate 치료 후

grade 3 이상의 간독성이 발생할 위험이 높았고(P=0.069), 그 외

ATIC 347C>G 변이형에서 간독성과의 연관성이 관찰되었다(P=0.043).

결론: 본 연구는 folate 대사과정에 관여하는 여러 가지 유전자의

다형성이 골육종 환자들의 치료반응, 임상적 결과, 혈중

52

methotrexate 의 농도 및 독성 부작용의 발생 등에 유의한 영향을 미칠

수 있음을 보여주었다. 더 많은 환자를 대상으로 추가적인 연구가

필요하며, 이러한 유전적 다형성과 임상적 결과와의 관련성이 기반이

되어, 향후 골육종 환자의 치료 시, 환자 개개인의 유전적 다형성은

임상적 치료 결과에 대한 유전적 예측인자로 사용될 수 있을 것이며,

개별화된 항암치료를 가능하게 할 것 이다.

주요어: methotrexate, folate, 유전적, 다형성

학번: 2006-30540

53