Study Towards Carotenoid 1,2-Hydratase and Oleate Hydratase as Novel Biocatalysts
Aida HISENI
Study Towards Carotenoid 1,2-Hydratase and Oleate Hydratase as Novel Biocatalysts
PROEFSCHRIFT
ter verkrijging van de graad van doctor
aan de Technische universiteit Delft,
op gezag van de Rector Magnificus prof. ir. K.C.A.M Luyben,
voorzitter van het College voor promoties,
in het openbaar te verdedigen op dinsdag 22 april 2014 om 10:00 uur
door
Aida HISENI
Diplom-Biologin, Heinrich-Heine-Universität Düsseldorf
geboren te Doboj, Bosnië en Hercegovina.
Dit proefschrift is goedgekeurd door de promotor:
Prof. dr. I.W.C.E Arends
Samenstelling promotiecommissie:
Rector Magnificus voorzitter
Prof. dr. I.W.C.E. Arends Technische Universiteit Delft, promotor
Prof. dr. U. Hanefeld Technische Universiteit Delft
Prof. dr. J.H. de Winde Universiteit Leiden
Prof. dr. G. Muijzer Universiteit van Amsterdam
Prof. dr. R. Wever Universiteit van Amsterdam
Dr. L.G. Otten Technische Universiteit Delft
Dr. P. Dominguez De Maria Sustainable Momentum
Prof. dr. S. de Vries Technische Universiteit Delft, reservelid
This project is financially supported by The Netherlands Ministry of Economic Affairs and the B-Basic partner organizations (http://www.b-basic.nl) through B-Basic, a public-private NWO-ACTS programme [Advanced Chemical Technologies for Sustainability (ACTS)].
ISBN
Copyright © 2014 by Aida HISENI
All rights reserved. No part of this publication may be reproduced or distributed in any form or by any means, or stored in a database or retrieval system, without any prior permission of the copyright owner.
To my father Ismet Nukičić
vii
Table of Contents
1 General introduction .................................................................................................. 1
1.1 Enzymes and biocatalysis ............................................................................................................... 2
1.2 Enzymes as industrial biocatalysts ................................................................................................. 3
1.3 Enzyme engineering ....................................................................................................................... 6
1.4 Hydro-Lyases ................................................................................................................................. 8 1.4.1 Non-enzymatic water addition to a carbon-carbon double bond ............................................... 8 1.4.2 Enzymatic water addition to a carbon-carbon double bond ....................................................... 9 1.4.3 Carotenoid 1,2-hydratase ......................................................................................................... 11 1.4.4 Oleate hydratase ...................................................................................................................... 14
1.5 Scope and objectives .................................................................................................................... 22
1.6 Supplementary figures.................................................................................................................. 24
1.7 References .................................................................................................................................... 26
2 Biochemical Characterization of the Carotenoid 1,2-Hydratases (CrtC) from Rubrivivax gelatinosus and Thiocapsa roseopersicina ................................................... 33
Abstract ..................................................................................................................................................... 34
2.1 Introduction.................................................................................................................................. 35
2.2 Materials and methods ................................................................................................................. 36 2.2.1 Construction of pET15b_CrtCRg and pET15b_CrtCTr expression vectors ............................ 36 2.2.2 Expression and purification of recombinant proteins .............................................................. 37 2.2.3 Tandem MS analysis ............................................................................................................... 37 2.2.4 CrtC activity assay and analysis of the products ..................................................................... 38 2.2.5 Substrate specificity ................................................................................................................. 38 2.2.6 Effects of pH and temperature on CrtC activity ...................................................................... 39 2.2.7 Effects of inhibitors and metal ions on enzyme activity .......................................................... 39 2.2.8 Circular dichroism (CD) spectroscopy .................................................................................... 39 2.2.9 Metal analysis using USN-ICP-OES ....................................................................................... 40
2.3 Results .......................................................................................................................................... 40 2.3.1 Expression and purification of the carotenoid 1,2-hydratases ................................................. 40 2.3.2 Hydratase activity .................................................................................................................... 41 2.3.3 Enzyme kinetics ....................................................................................................................... 41 2.3.4 Substrate specificity ................................................................................................................. 43 2.3.5 Effect of pH and temperature on hydratase activity and stability ............................................ 43
2.4 Discussion .................................................................................................................................... 46
2.5 Acknowledgments ......................................................................................................................... 49
2.6 Supplementary information .......................................................................................................... 50
2.7 References .................................................................................................................................... 57
3 Structural Characterization of the Carotenoid 1,2-Hydratases (CrtC) from Rubrivivax gelatinosus and Thiocapsa roseopersicina ................................................... 59
Abstract ..................................................................................................................................................... 60
viii
3.1 Introduction .................................................................................................................................. 61
3.2 Materials and methods ................................................................................................................. 63 3.2.1 In silico analysis ...................................................................................................................... 63 3.2.2 Cloning of carotenoid 1,2-hydratase genes .............................................................................. 63 3.2.3 Construction of CrtC mutants .................................................................................................. 64
3.2.3.1 Single point mutations .................................................................................................... 64 3.2.3.2 N-terminally truncated Rg- and TrCrtC’s ....................................................................... 65
3.2.4 Recombinant expression of CrtC’s .......................................................................................... 65 3.2.5 CrtC purification ...................................................................................................................... 66 3.2.6 Determination of enzyme activity ............................................................................................ 66
3.3 Results and discussion .................................................................................................................. 67 3.3.1 Comparative in silico analysis of crtC genes ........................................................................... 67 3.3.2 Production of recombinant wildtype and mutant CrtC’s and enzymatic activity .................... 72
3.4 Conclusion ................................................................................................................................... 80
3.5 Acknowledgements ....................................................................................................................... 81
3.6 References .................................................................................................................................... 82
4 Oleate hydratase as model enzyme to design and evaluate high-throughput screening assay for alcohol detection ............................................................................. 85
Abstract ..................................................................................................................................................... 86
4.1 Introduction .................................................................................................................................. 87
4.2 Materials and methods ................................................................................................................. 89 4.2.1 Standard curves and Z-factor determination ............................................................................ 89 4.2.2 Large scale production of 10-HSA .......................................................................................... 90 4.2.3 Growth conditions in 96-well deep well plates ........................................................................ 90 4.2.4 Liquid handling ........................................................................................................................ 91 4.2.5 Assay conditions ...................................................................................................................... 91 4.2.6 Preparation of ohyA mutant libraries ....................................................................................... 92 4.2.7 Expression of ohyA variants .................................................................................................... 93 4.2.8 Library screening ..................................................................................................................... 93
4.3 Results and discussion .................................................................................................................. 94 4.3.1 Method performance and linearity with small substrates......................................................... 94 4.3.2 Method performance for larger substrates and reaction simulation ......................................... 95 4.3.3 Precision and accuracy (Z-factor) ............................................................................................ 98 4.3.4 Optimization of protein expression conditions ...................................................................... 100
4.4 References .................................................................................................................................. 106
5 Preparation and properties of immobilized oleate hydratase as a cross-linked enzyme aggregate (CLEA) ............................................................................................ 109
Abstract ................................................................................................................................................... 110
5.1 Introduction ................................................................................................................................ 111
5.2 Materials and Methods .............................................................................................................. 113 5.2.1 Bacterial strain, growth conditions and cell disruption .......................................................... 113 5.2.2 Precipitation procedure .......................................................................................................... 113 5.2.3 Cross-linking procedure ......................................................................................................... 113 5.2.4 Activity assay......................................................................................................................... 114 5.2.5 Storage stability ..................................................................................................................... 115 5.2.6 pH activity and temperature stability ..................................................................................... 115 5.2.7 Biocatalyst recovery .............................................................................................................. 115
ix
5.3 Results and discussion ............................................................................................................... 115 5.3.1 Selection of the best precipitating agent for CLEA preparation ............................................ 116 5.3.2 Cross-linking and the effect of glutaraldehyde concentration ............................................... 117 5.3.3 Thermal stability and pH profile of OHase CLEA’s ............................................................. 120 5.3.4 Storage stability of OHase CLEA’s ....................................................................................... 122 5.3.5 Recycling of OHase CLEA’s ................................................................................................. 124 5.3.6 Space-time yields ................................................................................................................... 125
5.4 Conclusion ................................................................................................................................. 125
5.5 Supplemental Information ......................................................................................................... 127
5.6 References .................................................................................................................................. 128
6 Conclusions and future prospects ......................................................................... 131
6.1 Carotenoid 1,2-hydratase .......................................................................................................... 132
6.2 Oleate hydratase ........................................................................................................................ 134
6.3 High-throughput screening assay .............................................................................................. 135
6.4 References .................................................................................................................................. 138
Summary/Samenvatting ................................................................................................ 141
Summary ................................................................................................................................................. 142
Samenvatting ........................................................................................................................................... 145
Acknowledgements ........................................................................................................ 149
Curriculum vitae ............................................................................................................ 151
Chapter 1
1 General introduction
General introduction
2
1.1 Enzymes and biocatalysis
Enzymes play a pivotal role in the metabolism of all living organisms. Nearly all
biochemical reactions are accomplished and controlled by enzymes. By lowering the
activation energy required for a reaction to occur, enzymes are able to dramatically
accelerate the reaction rate (up to 1012-fold [1]) for reactions that otherwise would proceed
very slowly or not at all. In addition, enzymes are capable of accepting a wide array of
complex substrates, are highly selective (enantio-, regio- and chemoselective) and usually
operate under mild conditions [2].
Enzymes found in nature have been used since ancient times in the production of food,
alcoholic beverages, and manufacturing of commodities such as leather and linen. Jöns
Jakob Berzelius, a Swedish chemist, observed in the early nineteenth century that a
chemical reaction could be accelerated in the presence of specific compounds. At that time
he also coined the term ‘proteins’, without even being aware of the existence of enzymes
[3]. Only in the twentieth century, the first enzyme (urease) could be isolated in pure form
by James B. Sumner, an American chemist [4]. Since then, enzymes have captured special
attention of many researchers.
According to Wikipedia, ‘biocatalysis is the use of natural catalysts, such as protein
enzymes, to perform chemical transformations on organic compounds. Both enzymes that
have been more or less isolated and enzymes still residing inside living cells are employed
for this task’. Historically, catalysis is divided into two categories: homogeneous and
heterogeneous [5]. Enzymes, however, do not fit into the classical definitions of these two
categories. They are usually regarded as a separate class. On the other hand, the
development of the biomimetic organocatalysis is causing fading of the boundaries between
the catalysis domains. For instance, chemical catalysts are produced, which mimic the
natural features of enzymes and also, artificial enzymes are synthesized with specific
properties optimized for the targeted application.
Despite the early discovery of the catalytic nature of enzymes, their application in industrial
processes was not always competitive with chemical catalysis or vice versa [5]. Better
understanding of enzyme structure-function relationships and the possibility to tailor their
properties have significantly decreased the gap between chemical and enzymatic catalysis
[6].
1.2 Enzymes as industrial biocatalysts
3
1.2 Enzymes as industrial biocatalysts
The evolution of modern biotechnology over the last four decades and the emergence of a
key technology – genetic engineering - have opened new horizons in the fields of
biocatalysis and industrial biotechnology. Today’s novel techniques allow not only the
manufacturing of enzymes as purified, well-characterized preparations even on a large
scale, but they also make it possible to produce tailor-made enzymes that are designed for
a specific and often non-natural application. The application of enzymes as biocatalysts is
recognized as a significant complement to the use of chemical reagents. [7] Enzymes are
increasingly being utilized for both environmental and economic reasons in a number of
industries including agro-food, animal feed, detergent, textile and specialty chemical
industry [8, 9] (Table 1.1).
Table 1.1 Enzymes used in various industrial segments and their application, adapted from [10]. Industry Enzyme class Application
Detergent
(laundry and dish wash)
Protease Protein stain removal
Amylase Starch stain removal
Lipase Lipid stain removal
Cellulase Cleaning, color clarification, anti-redeposition
(cotton)
Mannanase Mannanan stain removal (reappearing stains)
Starch and fuel Amylase Starch liquefaction and saccharification
Amyloglucosidase Saccharification
Pullulanase Saccharification
Glucose isomerase Glucose to fructose conversion
Cyclodextrin-
glycosyltransferase
Cyclodextrin production
Xylanase Viscosity reduction (fuel and starch)
Protease Free amino nitrogen production (yeast nutrition -
fuel)
Food
(including dairy)
Protease Milk clotting, infant formulas (low allergenic),
flavor
Lipase Cheese flavor
Lactase Lactose removal (milk)
Pectin methyl esterase Firming fruit-based products
Pectinase Fruit-based products
General introduction
4
Transglutaminase Modify visco-elastic properties
Baking Amylase Bread softness and volume, flour adjustment
Xylanase Dough conditioning
(Phospho)Lipase Dough stability and conditioning (in situ
emulsifier)
Glucose oxidase Dough strengthening
Lipoxygenase Dough strengthening, bread whitening
Protease Biscuits, cookies
Transglutaminase Laminated dough strength
Animal feed Phytase Phytate digestibility - phosphorus release
Xylanase Digestibility
β-Glucanase Digestibility
Beverage Pectinase De-pectinization, mashing
Amylase Juice treatment, low calorie beer
β-Glucanase Mashing
Acetolactate decarboxylase Maturation (beer)
Laccase Clarification (juice), flavor (beer), cork stopper
treatment
Textile Cellulase Denim finishing, cotton softening
Amylase De-sizing
Pectate lyase Scouring
Catalase Bleach termination
Laccase Bleaching
Peroxidase Excess dye removal
Pulp and paper Lipase Pitch control, contaminant control
Protease Biofilm removal
Amylase Starch-coating, de-inking, drainage improvement
Xylanase Bleach boosting
Cellulase De-inking, drainage improvement, fiber
modification
Fats and oils Lipase Transesterification
Phospholipase De-gumming, lyso-lecithin production
Organic synthesis Lipase Resolution of chiral alcohols and amines
Acylase Synthesis of semi-synthetic penicillin
Nitrilase Synthesis of enantiopure carboxylic acids
Nitrile hydratase Synthesis of acrylamide
Fumarase Synthesis of malate
Leather Protease Unhairing, bating
1.2 Enzymes as industrial biocatalysts
5
Lipase De-pickling
Personal care Amyloglucosidase Antimicrobial (combined with glucose oxidase)
Glucose oxidase Bleaching, antimicrobial
Peroxidase Antimicrobial
The main benefits offered by enzymes are: (i) waste and energy reduction; enzymes usually
work at mild conditions, thereby circumventing the need for harsh chemicals and extreme
working conditions; (ii) cleaner products; enzymes are highly specific, resulting in less/no
unwanted side reactions and byproducts; (iii) environmental sustainability; enzymes are
biodegradable and thereby have no environmental footprint by definition. The synthesis of
the drug cortisone is an excellent example of the possibilities of enzyme technology [11,
12]. Here, the number of process steps needed to produce the drug could significantly be
reduced from 31 steps (chemical synthesis) to only 5 steps by utilizing enzymes
(Figure 1.1).
Figure 1.1 Chemical (upper reaction) and biochemical (lower reaction) route to cortisone (adapted from [5]).
The interest in industrial biocatalysis has increased rapidly and it still continues to grow. It
has been estimated that the global market for industrial enzymes is going to reach $6 billion
by 2016. Consequently, much effort has been devoted to the development of cleaner
alternative technologies where enzymes are utilized as biocatalysts.
General introduction
6
1.3 Enzyme engineering
Despite the huge potential of enzymes in the field of biotechnology, their application is
often limited by low stability and/or catalytic activity of these enzymes under process
conditions. This is one of the reasons why the use of hydrolases on industrial scale prevails
(Figure 1.2). For instance, lipases which act carboxylic ester bonds, are very versatile
enzymes with, among others, broad substrate specificity and stability, and can therefore be
utilized in many different industrial applications, such as food, detergent and pharmaceutics
[13].
Figure 1.2 Pie chart illustrating the utilization of different enzyme classes (EC) on industrial scale, based on
Table 1.1.
Therefore, the utilization of enzymes as biocatalysts in industrial processes requires an
intensive study and optimization of enzyme properties, such as stability, specific activity
and selectivity, beforehand.
The development of strategies to overcome the limitations of natural enzymes as
biocatalysts has received an enormous boost during the last years [6]. Protein engineering
techniques, among others, offer solutions to removing the impediments of widespread
application of enzymes in industrial processes. These techniques include random
mutagenesis and (semi)rational design/focused mutagenesis (Figure 1.3).
EC 1 (Oxidoreductases)
14%EC 2
(Transferases)5%
EC 3 (Hydrolases)
75%
EC 4 (Lyases)4%
EC 5 (Isomerases)
2%
1.3 Enzyme engineering
7
Figure 1.3 Strategies in protein engineering and prerequisites in terms of structural information. Recent
methods in diversity generation have been assigned to two categories: (semi)rational design and directed
evolution.
The prerequisite for rational design is a detailed structural and mechanistic knowledge of
the target enzyme. However, for many enzymes that have been discovered, the X-ray
crystal structure or even a viable homology model is not available yet, so that rational
mutagenesis of these enzymes is not an option. In contrast, for random mutagenesis,
knowledge of the structure-function relationship is not required. In this case, libraries
containing a large number of randomly generated mutants with potentially improved and/or
novel properties can be produced in a short time.
A crucial step in this so-called directed evolution approach is the development of a high-
throughput screening (HTS) or a selection assay. The assay allows rapid identification of
mutants with the desired properties from a large number of random mutants within a
reasonable timeframe [14]. In general, it needs to be sensitive, easy to perform, robust and
has to have high throughput. Preferably, screening assays are performed in plate readers,
where colorimetric changes or fluorescence formation can be detected upon enzymatic
activity. Selection only yields variants that have an advantage over the wild type enzyme
in contrast to screens, where the activity of each variant is monitored [15]. In addition,
screening methods allow the use of the actual substrate and desired reactions conditions. In
the end, “you get what you screened for” [16]).
General introduction
8
1.4 Hydro-Lyases
As indicated above (Figure 1.2), the main EC class that is successfully used in industrial
biocatalytic processes is the class of hydrolases (EC 3.-.-.-). Lyases (EC 4.-.-.-), the subject
of this thesis, on the other hand, are underrepresented and only a few group members are
amenable to be used for industrial scale reactions, including nitrile hydratase (EC 4.2.1.84)
for the production of acrylamide [9] and fumarase (EC 4.2.1.2) to produce malate [17].
Hydro-lyases (EC 4.2.1.-), also called hydratases, are a subclass of carbon-oxygen lyases
(EC 4.2.-.-). As a lyase, they catalyze the non-hydrolytic and non-oxidative addition and/or
removal of a group to a carbon-carbon double bond. The ‘hydro’ relates to the added or
removed group, and is in this case a water molecule.
1.4.1 Non-enzymatic water addition to a carbon-carbon double bond
The addition of a water molecule to a non-activated carbon-carbon double bond to yield an
alcohol is a very non-selective reaction that requires harsh conditions in traditional
chemistry [18]. The non-enzymatic hydration reaction is usually performed by using strong
acids, high temperatures and high pressures, or transition metals as a catalyst. Furthermore,
the hydration often does not proceed with the desired positional specificity. The acid-
catalyzed hydration of an alkene follows the Markovnikov’s rule [19]. It states that the
acidic proton binds to the carbon with the greater number of hydrogen atoms, whereas the
alcohol group prefers the carbon with the most carbon-carbon bonds (Figure 1.4). The basis
of the reaction is the formation of the most stable carbocation, which is subsequently
attacked by the nucleophilic water to form the oxonium-ion. Another water molecule takes
up the extra proton from the attached oxygen and an alcohol is formed.
Figure 1.4 Acid-catalyzed alkene hydration
1.4 Hydro-Lyases
9
Depending on the structure of the alkene used, unwanted side products and product
rearrangements can occur, especially with unsymmetrical alkenes. The chemical reaction
is therefore limited to alkenes that cannot undergo rearrangement upon hydration.
1.4.2 Enzymatic water addition to a carbon-carbon double bond
The enzymatic hydration of carbon-carbon double bonds is catalyzed by hydro-lyases [20].
The alcohol is produced under very mild conditions in a neutral aqueous environment. Due
to the inherent high selectivity (enantio-, regio- and chemospecificity) of enzymes, alcohols
can be obtained in high yields and without undesired side products.
The enzyme database BRENDA [21] counts 153 hydro-lyases (as at December 5, 2013),
which catalyze the (de)hydration of a large number of different substrates. Most of these
hydro-lyases act on conjugated carbon-carbon double bonds [20, 22]. In contrast to the
hydration of isolated carbon-carbon double bond, which is subject to hydronium-ion
catalysis (Figure 1.4), a Michael-type hydration occurs for activated double bonds. In this
case, the carbon-carbon bond is activated by an electron withdrawing group such as
carboxylic acid, thioester or a phosphate group, making it more electrophilic for the
nucleophilic addition by water (Figure 1.5).
Figure 1.5 Michael addition of a water molecule to an α,β-unsaturated carbonyl compound.
An excellent overview of these enzymes was recently presented in literature [20]. However,
in this thesis, we are aiming for the so far underrepresented class of hydro-lyases acting on
isolated carbon-carbon double bonds. Most of the (de)hydratases are cofactor dependent
(Table 1.2). These cofactors have several functions in the (de)hydration mechanism of
(de)hydratases. Next to the direct participation in substrate binding by, for instance,
coordination (metal ions, iron-sulfur clusters), the co-factors can also be involved in the
General introduction
10
stabilization of the carbocation intermediate (e.g. pyridoxal phosphate) or are producers of
radicals, as found in the dehydration mechanism of diol dehydratase [23].
Table 1.2 Reported activity requirements for hydratases/dehydratases.
Activity requirement Enzyme name Reference
Metal ions Carbonate dehydratase (Zn2+)
Phosphopyruvate hydratase (Mg2+)
3-Dehydroshikimate dehydratase (Mn2+)
O-succinylbenzoate synthase (Mn2+ or Mg2+)
1,5-Anhydro-D-fructose dehydratase (Ca2+ or Na+ or Mg2+)
[24]
[25]
[26]
[27]
[28]
Coenzyme Propanediol dehydratase (Cyanocobalamin)
Tryptophan synthase (Pyridoxal 5'-phosphate)
[29]
[30]
Iron-sulfur Aconitate hydratase
2-Methylcitrate dehydratase
Methanogen homoaconitase
Fumarase (Class I)
[31]
[32]
[33]
[34]
CoA activated substrates Enoyl-CoA hydratase
Long-chain-enoyl-CoA hydratase
[35]
[36]
Heme-thiolate Hydroperoxide dehydratase
Colneleate synthase
[37]
[38]
NAD(P)+ / NAD(P)H CDP-glucose 4,6-dehydratase
UDP-N-acetylglucosamine 4,6-dehydratase
[39]
[40]
FAD 4-Hydroxybutanoyl-CoA dehydratase [41]
Electron carriers such as NAD+ and NADP+ are usually involved in redox reactions.
Therefore, one would not expect to find these cofactors in hydratases (Table 1.2), as the
catalytic mechanism of hydratase does not involve a net oxidation or reduction. From a
functional point of view, NAD+ behaves as a prosthetic group in hydratases rather than as
coenzyme, when it is tightly bound to the enzyme, such as in CDP-glucose 4,6-dehydratase
[39]. In this case it initiates the dehydration reaction by oxidation of the substrate and
reduction once the substrate has been dehydrated by the enzyme. The catalytic reaction is
independent of the NAD+/NADH ratio because of the non-dissociable character of the
prosthetic group. The same has been reported for flavoproteins, which catalyze reactions
with no net redox change [42].
From an industrial point of view, however, enzymes without the requirement of any
cofactor are preferred. The reason is the simplification of the process and no need for the
usually expensive cofactors or development of a cofactor regeneration system.
1.4 Hydro-Lyases
11
The following two paragraphs describe two newly discovered hydratases that are cofactor
independent and act on isolated carbon-carbon double bonds. Therewith, these are
potentially interesting biocatalysts for industrial applications.
1.4.3 Carotenoid 1,2-hydratase Carotenoid 1,2-hydratase (also known as CrtC) is a member of hydro-lyase group EC
4.2.1.131 and occurs in the biosynthetic pathway of carotenoids [43]. From a chemical
point of view, CrtC’s are able to perform a very challenging chemical reaction, namely the
addition of water to an isolated carbon-carbon double bond [20]. The reaction proceeds
with no assistance from electron withdrawing groups, or transition metal cations and does
not occur at all under mild conditions in vitro [44].
Carotenoids, which represent one of the most abundant natural pigments with structural
and protective properties [45], play an essential role in the photosynthetic machinery of
phototrophic organisms such as purple bacteria [46] and higher plants [47]. However, they
have also been identified in fungi and some non-photosynthetic bacteria [48]. Depending
on the producing organism, carotenoids can be acyclic, monocyclic or bicyclic. CrtC
introduces a tertiary hydroxyl group into a carotenoid molecule by addition of water to the
carbon-carbon double bond at the C-1 position. The substrate specificity of CrtC’s varies
between species. For example, the substrate specificity of the CrtC from Rhodobacter
capsulatus is very limited and the enzyme accepts only acyclic carotenoids, which possess
two -end groups (acyclic C9 end group according to nomenclature of carotenoids), such
as neurosporene and lycopene (Figure 1.6). Once one of the two -end groups is hydrated,
the enzyme is not able to use the monohydroxylated carotenoid as a substrate [49]. In
contrast, the CrtC’s from Rubrivivax gelatinosus (Rg) and Thiocapsa roseopersicina (Tr)
are able to also hydrate monohydroxylated acyclic carotenoids [50]. Next to acyclic
carotenoids, the CrtC’s from the purple sulfur bacteria Thiodictyon sp. CAD16 [51] and
from the green sulfur bacteria Chlorobium tepidum [52] showed activity towards cyclic
carotenoids such as γ-carotene and chlorobactene (Figure 1.6). The substrate specificity of
the CrtC and other enzymes involved in the biosynthetic pathway of carotenoids, determine
the final structure of accumulated carotenoids in the organism.
CrtC belongs to the Pfam family PF07143 that encompasses members from several
photosynthetic bacteria. Up to now, several carotenoid 1,2-hydratases have been identified
in photosynthetic [52-56] as well as in non-photosynthetic bacteria [57, 58]. Recently,
carotenoid 1,2-hydratases have been identified in the non-photosynthetic bacterium
General introduction
12
Deinococcus [58], which are able to hydrate γ-carotene, a mono-cyclic substrate, but no
acyclic carotenoids.
OH
OH
OH
OCH3
OCH3
OH
Lycopene
1-HO-Lycopene
Neurosporene
1-HO-Neurosporene
Demethylspheroidene
Spheroidene
1-CH3O-3,4-didehydrolycopene
1-HO-3,4-didehydrolycopene
-Carotene
HOGeranylgeraniol (?)
Chlorobactene
Figure 1.6 Substrates accepted by carotenoid 1,2-hydratases. The shaded portions of each structure are
hydrated to yield a tertiary alcohol group. Next to differences in one end group of each carotenoid, the number
of double bonds in the molecules differs as well (circled).
They are, however, evolutionary very distinct from the PF07143 members [58] and hence,
they have been given the name CruF. Interestingly, cruF homologues are found in a wide
variety of carotenoid-synthesizing bacteria that lack a crtC gene [59]. For example, it was
found in cyanobacterium Synechococcus sp. [59] and in Herpetosiphon aurantiacus [60].
To our knowledge no published data exist on the catalytic mechanism of CrtC’s, nor has
the 3D structure been elucidated yet. However, the 3D structure of the first representative
of the Pfam family PF09410 (putative AttH) has been solved, a family which is distantly
related to the CrtC family PF07143 [61]. The mechanism of lycopene hydration to hydroxyl
compounds, which involves proton attack at C-2 and C-2′ with a carbocation intermediate
and the introduction of the hydroxyl group at C-1 and C-1′, was established from 2H2O-
labeling studies with intact cells [62, 63]. Until now no mutagenesis studies have been
1.4 Hydro-Lyases
13
published on CrtC, so we identified and mutagenized potential key residues in RgCrtC and
TrCrtC. The results of the mutagenesis study together with modeling of a 3D structure with
putative AttH led to the hypothesis that the hydration of lycopene is initiated by an acidic
residue, Asp268 in RgCrtC and Asp266 in TrCrtC, followed by quenching with solvent
water molecules present in the close proximity. From these findings it becomes clear that
the complete structure of the enzymes, through crystallization studies, will be pivotal to
further unravel the mechanism for this intriguing enzyme. Nevertheless, the results of the
study described in chapter 3 shed for the first time light on structure-activity relationships
of carotenoid 1,2-hydratases.
Whereas CrtC’s from photosynthetic bacteria act on acyclic carotenoids, the CruF’s from
non-photosynthetic bacteria only catalyze the hydration of mono-cyclic carotenoids.
Protein sequence alignment of CrtC from Rubrivivax gelatinosus and CruF from
Deinococcus radiodurans R1 did not reveal any structural similarities (Supplementary
figure 1.1). Moreover, they showed substantial differences in the secondary structure.
While the CrtC mainly consists of β-strands, the CruF contains notably α-helices
(Supplementary figure 1.2). The catalytic and structural features, that determine hydratase
activity and specificity of these two distinct families remains hypothetic or unknown.
Recently, we recombinantly expressed and characterized two representatives of the
PF07143 family, the CrtC from purple non-sulfur Betaproteobacteria Rubrivivax
gelatinosus and purple sulfur Gammaproteobacteria Thiocapsa roseopersicina [50].
Biochemical studies revealed that these enzymes are able to convert cofactor independently
lycopene into 1-HO-lycopene and 1,1’-(HO)2-lycopene. In addition, they showed some
activity towards the unnatural substrate geranylgeraniol, a C20 molecule that resembles the
natural substrate lycopene. However, the obtained product could not yet be identified as a
hydration product. Furthermore, Steiger et al. [49] have shown that the CrtC from R.
gelatinosus also has the ability to hydrate neurosporene, 1-HO-neurosporene and a few
other carotenoids [49]. Both CrtC’s are located in the membrane fraction after the
heterologous expression in E. coli. The analysis of the amino acid sequence with
transmembrane prediction program TMHMM [64] did not reveal any transmembrane
segments. However, amino acid region from ca. 120 to 140 is largely hydrophobic in both
CrtC’s, which suggest that the enzymes is rather bound to the membrane through an anchor
so that a close distance to the substrate, which is synthesized in the cell membranes, is
facilitated.
General introduction
14
1.4.4 Oleate hydratase Oleate hydratase (OHase) catalyzes the conversion of oleic acid (OA) into (R)-10-
hydroxystearic acid (10-HSA). The enzymatic hydration of OA into 10-HSA (Figure 1.7)
was first described in a Pseudomonas strain [65].
Figure 1.7 Conversion of oleic acid into 10-hydroxystearic acid.
Since then reports followed for a series of different bacterial and eukaryotic
microorganisms, such as Corynebacterium [66], Saccharomyces cerevisiae [67],
Sphingobacterium thalpophilum [68] and Stenotrophomonas nitritireducens [69].
However, no enzyme responsible for this hydration reaction could be identified. Only
recently, Bevers et al. [70] succeeded in finding the enzyme and isolating the corresponding
gene sequence using the primer walking method. The enzyme was isolated from
Elizabethkingia meningoseptica (formerly known as Pseudomonas sp. 3266), the same
strain that Davis et al. [71] described 43 years ago. After the recombinant expression in E.
coli the enzyme indeed was able to cofactor independently form 10-HSA by hydrating the
substrate OA. It is a monomeric 70 kDa soluble enzyme containing one non-essential Ca2+-
ion. This hydratase, as well as the carotenoid 1,2-hydratase, represents a new type of hydro-
lyase as it is able to hydrate an isolated carbon-carbon double bond.
Following its disclosure, OHase has become a favorite topic of many researchers. A number
of putative enzymes have been recombinantly expressed, characterized and identified as
oleic acid hydratase or fatty acid hydratase. So far, the enzyme has been cloned from
Streptococcus pyogenes [72], Bifidobacterium breve [73], Lysinibacillus fusiformi [74, 75],
Stenotrophomonas maltophilia [76, 77], Macrococcus caseolyticus [78], Lactobacillus
rhamnosus LGG, Lactobacillus plantarum ST-III, Lactobacillus acidophilus NCFM and
Bifidobacterium animalis subsp. lactis BB12 [79]. Table 1.3 shows an overview of all
characterized OHases and the tested substrates. The results indicate that in all cases, (i) the
1.4 Hydro-Lyases
15
carboxylic group, (ii) a minimum distance of nine carbons between the double bond and
the acid group, (iii) a minimum chain length of C-14 and (iv) a cis-conformation, are
required for conversion of the substrate. For instance, all tested OHases were able to convert
the OA into the 10-HSA, while no product was detected when the trans-isomer was used.
Furthermore, differences in specificity were observed for the M. casolyticus OHase. In
contrast to other OHases, this enzyme introduced a second hydroxyl-group at the C-12
position next to the hydroxyl-group at the C-9 position of the substrate gamma-linolenic
acid (C18:3, 6Z, 9Z, 12Z). This could either indicate a true difference in substrate
specificity or insufficient incubation time for other OHases, which might have lower
reaction rates with this particular substrate.
The molecular weight of all reported OHases is ~67 kDa, with B. animalis OHase being
the exception with a molecular weight of 82 kDa. OHases from L. fusiformi, S. maltophilia
and M. caseolyticus were shown to consist of a dimeric conformational structure upon
purification. Although, the OHase from E. meningoseptica is monomeric upon purification,
it dimerizes after some time. Furthermore, in our lab it has been established now that the
OHase from E. meningoseptica does contain a flavin adenine dinucleotide (FAD) cofactor
(Figure 1.8), as well as has been demonstrated for all other oleate hydratases. With the
multiple sequences alignment a motif indicative of FAD binding has been identified in all
reported and characterized oleic acid hydratases, including that from E. meningoseptica
(Figure 1.9). They all share the common conserved sequence motif
GxGxxG(S/A/N)(x)15E(K/D)(x)5E(D/G/S) (where x denotes any amino acid) at the N-terminal part
of the sequence, known to bind the FAD cofactor. The first part of the motif (containing
the GxGxxG sequence) is the well-known Rossmann fold, a common fold in the FAD-
containing glutathione reductase family (GR) [80].
Figure 1.8 Flavin adenine dinucleotide (FAD) cofactor.
General introduction
16
Sub
stra
te
Pro
duct
Bifidobacterium animalis subsp. Lactis BB12 [79]
Bifidobacterium breve [73]
Elizabethkingia meningoseptica [70]
Lactobacillus acidophilus NCFM [79]
Lactobacillus plantarum ST-III [79]
Lactobacillus rhamnosus LGG [79]
Lysinibacillus fusiformi [74,75]
Macrococcus caseolyticus [78]
Stenotrophomonas maltophilia [76, 77]
Streptococcus pyogenes [72]
Lau
ric
acid
(C
12, n
o do
uble
bon
d)
- -
- -
- -
- -
N
- M
yris
tic
acid
(C
14, n
o do
uble
bon
d)
- -
- -
- -
- -
N
- M
yris
tole
ic a
cid
(C14
:1, 9
Z)
10-H
ydro
xym
yris
tic
acid
-
N
- -
- -
Y
Y
Y
N
Pal
mit
ic a
cid
(C16
, no
doub
le b
ond)
-
- -
- -
- -
- N
-
Pal
mit
olei
c ac
id (
C16
:1, 9
Z)
10-H
ydro
xyhe
xade
cano
ic a
cid
- Y
-
- -
- Y
Y
Y
Y
S
tear
ic a
cid
(C18
, no
doub
le b
ond)
-
- -
- -
- -
- N
-
Pet
rose
lini
c ac
id (
C18
:1, 6
Z)
- -
- -
- -
- -
N
- E
laid
ic a
cid
(C18
:1, 9
E)
N
- -
N
N
N
- -
N
N
Ole
ic a
cid
(C18
:1, 9
Z)
10-H
ydro
xyoc
tade
cano
ic a
cid
Y
Y
Y
Y
Y
Y
Y
Y
Y
Y
Ric
inol
eic
acid
(C
18:1
, 9Z
, 12-
OH
) 10
,12-
Dih
ydro
xyst
eari
c ac
id
- -
- -
- -
Y
- -
-
Vac
ceni
c ac
id (
C18
:1, 1
1Z)
- -
- -
- -
- -
N
- co
njug
ated
-Lin
olei
c ac
id (
C18
:2, 9
E, 1
1E)
- -
- -
- -
- -
N
- co
njug
ated
-Lin
olei
c ac
id (
C18
:2, 9
Z, 1
1E)
- -
- -
- -
- -
N
- L
inol
eic
acid
(C
18:2
, 9Z
, 12Z
) 10
-Hyd
roxy
-12(
Z)-o
ctad
ecen
oic
acid
10
,13-
Dih
ydro
xyoc
tade
cano
ic a
cid
Y
N
Y
N
- Y
N
Y
N
Y
N
Y
N
Y
Y
Y
N
Y
N
L
inol
eic
acid
met
hyl e
ster
(C
18:2
, 9Z
, 12Z
) -
N
- -
- -
- -
- -
conj
ugat
ed-L
inol
eic
acid
(C
18:2
, 10E
, 12Z
)
- -
- -
- -
- -
N
- ga
mm
a-L
inol
enic
aci
d (C
18:3
, 6Z
, 9Z
, 12Z
) 10
-Hyd
roxy
-6(Z
),12
(Z)-
octa
deca
dien
oic
acid
10
,13-
Dih
ydro
xy-6
(Z)-
octa
dece
noic
aci
d
- -
- -
- -
Y
N
Y
Y
Y
N
Y
N
alph
a-L
inol
enic
aci
d (C
18:3
, 9Z
, 12Z
, 15Z
) 10
-Hyd
roxy
-12(
Z),1
5(Z)
-oct
adec
adie
noic
aci
d 10
,13-
Dih
ydro
xy-1
5(Z
)-oc
tade
ceno
ic a
cid
- -
- -
- -
Y
N
Y
Y
Y
N
N
Y
Ara
chid
ic a
cid
(C20
, no
doub
le b
ond)
-
- -
- -
- -
- N
-
Eic
osat
rien
oic
acid
(C
20:3
, 3Z
, 6Z
, 9Z
) -
- -
- -
- -
- -
N
Ara
chid
onic
aci
d (C
20:4
, 5Z
, 8Z
, 11Z
, 14Z
) -
- -
- -
- -
- -
N
Eru
cic
acid
(C
22:1
, 13Z
) -
- -
- -
- -
- N
-
Ner
voni
c ac
id (
C22
:1, 1
5Z)
- -
- -
- -
- -
N
- D
ilin
oleo
ylph
osph
atid
ylch
olin
e -
- -
- -
- -
- -
N
Tri
lino
leyl
glyc
erol
-
- -
- -
- -
- -
N
Tab
le 1
.3 O
verv
iew
of
the
subs
trat
es te
sted
with
ole
ate
hydr
atas
es r
ecom
bina
ntly
exp
ress
ed E
. col
i. N
, no
prod
uct d
etec
ted;
Y, p
rodu
ct d
etec
ted,
-, n
ot
dete
rmin
ed.
1.4 Hydro-Lyases
17
Although distinct conserved sequence motifs were identified in all four FAD families (GR,
ferredoxin reductase (FR), p-cresol methylhydroxylase (PCMH) and pyruvate oxidase
(PO)), the GxGxxG sequence is the most conserved one and is found in proteins across all
four families. The importance of the glycine residues was described by Wierenga et al.
[81]. In their study they have been able to derive an amino acid sequence fingerprint, which
can be attributed to the so-called βαβ-unit with ADP-binding properties (Figure 1.10). The
hydrophobic amino acids of the fingerprint sequence form the hydrophobic core between
the β-strand and the α-helix, while the first and the second glycine residues allow a sharp
turn and a close approach of the pyrophosphate of the FAD cofactor to the N-terminus of
the α-helix, respectively. The acid side-chain at the end of the fingerprint sequence forms
a hydrogen bond with the hydroxyl group of the adenine moiety. The amino acid sequence
as found in oleate hydratase reveals a slightly different motif compared to the described
βαβ-unit with ADP-binding properties (Figure 1.10). It comprises two instead of one acid
side-chain. Joo et al. [78] demonstrated by mutagenesis studies the importance of the
second acid side-chain in the GxGxxG(S/A/N)(x)15E(K/D)(x)5E(D/G/S) motif (acid side-chain
underlined) for the catalytic activity of the oleate hydratase from M. caseolyticus. While a
mutant, with the first acid side-chain being substituted by an alanine, retained 60-85% of
the wild-type activity, the mutation of the second acid side-chain by an alanine resulted in
a fully inactivated enzyme. As already pointed out, the presence of the highly conserved
GxGxxG motif in all FAD protein families indicates a crucial role for the molecular
recognition of the pyrophosphate moiety. In contrast, residues involved in the binding of
the isoalloxazine- and adenine moiety are less conserved and show higher diversity
between all the FAD- family members. The isoalloxazine ring structure of the FAD cofactor
is involved in the catalytic function in enzymes which catalyze redox reactions. The absent
conserved motif for the binding of this part of the FAD molecule within the reported oleate
hydratase sequences is consistent with the known fact that the hydration mechanism of
these enzyme does not involve any redox reactions [82]. The partly conserved FAD-binding
motif and the experimental data on cofactor removal by heat precipitation [78] show that
the cofactor in oleate hydratases is held together by weak non-covalent rather than covalent
bonds.
General introduction
18
* * *
* *
1.4 Hydro-Lyases
19
Figure 1.9 Multiple sequence alignment showing conserved amino acids of the oleate hydratase (OHase)
protein sequences from various bacteria. Identical amino acids are highlighted in black. Sequences analyzed:
Elizabethkingia meningoseptica (GI 380877058), Lysinibacillus fusiformis (GI 424736965), Macrococcus
caseolyticus (GI 222150326), Lactobacillus acidophilus (GI 58336974), Stenotrophomonas maltophilia (GI
459793677), Streptococcus pyogenes (GI 383479572), Bifidobacterium breve (GI 290048343),
Bifidobacterium animalis (GI 384190730), Lactobacillus plantarum (GI 308179305), Lactobacillus
rhamnosus (GI 258507498). The predicted FAD binding residues (G70, G72, G75, K91 and E97 of oleate
hydratase from Elizabethkingia meningoseptica) are indicated with an asterisk.
Furthermore, through mutagenesis studies of the glycine residues in the oleate hydratase
from M. caseolyticus [78] the crucial role for the binding of the cofactor was demonstrated.
The molecular interaction of the obtained mutants with FAD was significantly reduced and
resulted in inactivation of the enzymatic activity.
Figure 1.10 Schematic drawing of the βαβ-fold from spiny dogfish lactate dehydrogenase with ADP-binding
properties, adapted from [81]. The properties of the amino acid residues are indicated with symbols (triangle,
hydrophilic or basic; square, hydrophobic and small).
The structural and mechanistic data of oleate hydratases were not available until only
recently. Volkov et al. [83] succeeded in determining the crystal structure of oleate
hydratase from L. acidophilus, which shares 40% and 57% amino acid sequence identity
and similarity, respectively, with that from E. meningoseptica (the enzyme we use in this
General introduction
20
research). The enzyme has been crystallized in apo and product-bound (linoleic acid) form
and is shown to consist of two stably bound monomers. Upon dimerization, 9.7% of the
surface of each monomer becomes buried. Based on the structural similarity to other FAD-
binding proteins four different domains were identified (Figure 1.11). Domain 1 (D1)
consists of four regions throughout the whole gene and resembles a variant of the Rossmann
fold. Domain 2 (D2) is shown to contain the FAD-substrate binding sites in concert with
D1. Domain 3 (D3) and domain 4 (D4) comprise only α-helices. The latter was shown to
have structural similarity with the N-terminal lid domain of the long-chain acylglycerol
lipase from Archaeoglobus fulgidus. Based on the comparison of the obtained apo- and
product-bound OHase structures, a displacement of 2 α-helices at the C-terminal region in
D4 is observed upon binding of the substrate linoleic acid. This led the authors to the
hypothesis that a cavity forming the entrance to a channel is generated, which runs from
the surface down to a cleft at the interface of D1 and D3.
Figure 1.11 Crystal structure of Lactobacillus acidophilus hydratase, adapted from [83]. Domains 1, 2 and 3
are shown in marine, light green and red color, respectively. The ‘flexible’ domain 4 is depicted in yellow.
Solvent molecules are shown in ball-and-stick representation and are colored cyan. Channel leading to a
putative active site and a putative FAD-binding site are depicted as transparent and yellow surfaces,
respectively.
The interior of the channel mainly contains hydrophobic side chains, which accommodate
the long fatty acid chain, while positively charged residues at the entrance of the channel
(D4) possibly facilitate the recruitment of fatty acids by making a salt bridge to its carboxyl
D1
D2 D3
D4
1.4 Hydro-Lyases
21
group. The inability of oleate hydratases to convert substrates lacking the carboxylic group,
such as methyl linoleate [72, 73], argue in favor of the substrate recognition at the entrance
of the channel.
Due to the fact that the crystallization of the hydratase with the bound cofactor FAD was
not successful, the FAD-binding domains were only identified through structural
similarities to other FAD-binding proteins. Residues involved in the binding of the cofactor
are similarly arranged as depicted in Figure 1.10. While the first two glycines are located
in the loop region between the first β-strand and α-helix, and help the positioning of the
sugar group of the cofactor, the third glycine is positioned in the loop region where the
isoalloxazine ring resides. The acid-side chain glutamate (corresponds to E97 in E.
meningoseptica OHase), located right after the second β-strand, forms a hydrogen bond to
the hydroxyl group of the sugar moiety of the FAD molecule. The here proposed
architecture of the FAD binding site is in agreement with the above described.
With the availability of the first crystal structure of an oleate hydratase, it was possible to
use it as a template in order to generate a model for oleate hydratase from E.
meningoseptica. As mentioned earlier, the amino acid similarity of these two hydratases is
57%, which should be sufficient for a reasonable alignment. A model has been generated
with an estimated accuracy of 0.63 ± 0.14 (model with a score > 0.5 is considered a good
model). Figure 1.12 is a 3D representation of the superimposed structures of oleate
hydratases from L. acidophilus and E. meningoseptica and is based on sequence alignment.
Overall, both enzymes seem to share similar topology, indicating that these structures are
closely related. The topology of the C-terminal region (D4) and D2 region comprising the
FAD-binding site, however, has diverged. Volkov et al. [83] proposed the D4 region, which
consist of 2 α-helices, as the entrance of the substrate to the active site. In case of E.
meningoseptica oleate hydratase one of the two helices is extended, which might indicate
different substrate specificity.
General introduction
22
Figure 1.12 Superimposed 3D structures of oleate hydratases from L. acidophilus (cyan) and E.
meningoseptica (green), which are based on sequence alignment.
1.5 Scope and objectives
“We do not inherit the earth from our ancestors; we borrow it from our children” (Native
American proverb). This quote perfectly pictures the motivation of the research described
in this thesis. The environmental change has long-reaching consequences and now, it has
been recognized that the development of sustainable and green technologies is of vital
importance for our future. As has been introduced in this chapter, enzymes have a great
potential in the field of industrial biotechnology. Specifically, hydratases could make very
valuable biocatalysts for the chemical industry.
The aim of the research described in this thesis was to gain knowledge on structure-function
relationship of two newly discovered hydratases, namely carotenoid 1,2-hydratase and
oleate hydratase. Based on that, the objective was to map the potential of these two
hydratases for their use as biocatalysts in industrial processes.
Chapter 2 describes the characterization of carotenoid 1,2- hydratases from photosynthetic
bacteria Rubrivivax gelatinosus and Thiocapsa roseopersicina. The biochemical properties
D1
D2 D3
D4
1.5 Scope and objectives
23
of the recombinant enzymes and their substrate specificities were studied. In Chapter 3,
the two hydratases described in chapter 2 were subjected to protein engineering techniques
site-directed evolution and semi-rational mutagenesis in order to identify relevant amino
acids in the active site and their contribution to enzymatic activity. Homology modeling
together with mutagenesis study helped to gain insight into the enzymatic mechanism of
these enzymes. Chapter 4 focuses on the development of a high-throughput screening
assay for the detection of alcohols, products of hydrating enzymes such as carotenoid 1,2-
hydratase and oleate hydratase (OHase). For this study, OHase from Elizabethkingia
meningoseptica was used as the model enzyme. The assay allows for screening of mutant
libraries generated by directed evolution. A continuation of the characterization work of
OHase that was performed by Loes Bevers, included the study of OHase immobilization as
cross-linked enzyme aggregates (CLEA) with the goal to develop OHase into a useful and
efficient biocatalyst for high-added value compounds (Chapter 5). In Chapter 6, the main
findings described in this thesis are evaluated with the respect to the implications of the
work to the fundamental knowledge on carotenoid 1,2-hydratases and oleate hydratases.
Next to that, perspectives for future research are presented. Finally, the main findings of
this thesis are summarized.
General introduction
24
1.6 Supplementary figures
Supplementary figure 1.1 Sequence alignment and secondary structure prediction (PRALINE software) of
carotenoid 1,2-hydratase (CrtC) from Rubrivivax gelatinosus and the evolutionary distinct carotenoid 1,2-
hydratase (CruF) from Deinococcus radiodurans R1[46].
1.6 Supplementary figures
25
Supplementary figure 1.2 Sequence alignment and secondary structure prediction (PRALINE software) of
carotenoid 1,2-hydratases from Rubrivivax gelatinosus and Thiocapsa roseopersicina.
General introduction
26
1.7 References
[1] E. T. Farinas, et al., "Directed enzyme evolution," Current Opinion in Biotechnology, vol. 12, pp.
545-551, 2001.
[2] M. T. Reetz, "Biocatalysis in organic chemistry and biotechnology: Past, present, and future,"
Journal of the American Chemical Society, vol. 135, pp. 12480-12496, 2013.
[3] J. Wisniak, "Jöns Jacob Berzelius A Guide to the Perplexed Chemist," The Chemical Educator, vol.
5, pp. 343-350, 2000/12/01 2000.
[4] J. B. Sumner, "The isolation and crystallization of the enzyme urease: Preliminary paper," Journal
of Biological Chemistry, vol. 69, pp. 435-441, August 1, 1926 1926.
[5] R. Yuryev and A. Liese, "Biocatalysis: The Outcast," ChemCatChem, vol. 2, pp. 103-107, 2010.
[6] U. T. Bornscheuer, et al., "Engineering the third wave of biocatalysis," Nature, vol. 485, pp. 185-
194, 2012.
[7] N. Ran, et al., "Recent applications of biocatalysis in developing green chemistry for chemical
synthesis at the industrial scale," Green Chemistry, vol. 10, pp. 361-372, 2008.
[8] S. S. Dewan, "Enzymes in Industrial Applications: Global Markets," Report BIO030G, BCC
Research, Wellesley, MD, USA, 2012.
[9] K. R. Jegannathan and P. H. Nielsen, "Environmental assessment of enzyme use in industrial
production-a literature review," Journal of Cleaner Production, vol. 42, pp. 228-240, 2013.
[10] O. Kirk, et al., "Industrial enzyme applications," Current Opinion in Biotechnology, vol. 13, pp.
345-351, 2002.
[11] L. H. Sarett, "Partial synthesis of pregnene-4-triol-17(β),20(β),21-dione-3,11 and pregnene-4-diol-
17(β),21-trione-3,11,20 monoacetate," Journal of Biological Chemistry, vol. 162, pp. 601-631,
March 1, 1946 1946.
[12] O. K. Sebek and D. Perlman, "Chapter 14 - Microbial transformation of steroids and sterols," in
Microbial Technology (Second Edition), H. J. Peppler and D. Perlman, Eds., ed: Academic Press,
1979, pp. 483-496.
[13] A. Houde, et al., "Lipases and their industrial applications: An overview," Applied Biochemistry and
Biotechnology - Part A Enzyme Engineering and Biotechnology, vol. 118, pp. 155-170, 2004.
[14] J.-L. Reymond, Enzyme assays: High-throughput screening, genetic selection and fingerprinting:
Whiley-VCH, 2006.
[15] M. Goldsmith and D. S. Tawfik, "Directed enzyme evolution: Beyond the low-hanging fruit,"
Current Opinion in Structural Biology, vol. 22, pp. 406-412, 2012.
[16] L. You and F. H. Arnold, "Directed evolution of subtilisin E in Bacillus subtilis to enhance total
activity in aqueous dimethylformamide," Protein Engineering, vol. 9, pp. 77-83, 1996.
[17] A. V. Presečki and D. Vasić-Rački, "Production of L-malic acid by permeabilized cells of
commercial Saccharomyces sp. strains," Biotechnology Letters, vol. 27, pp. 1835-1839, 2005.
1.7 References
27
[18] M. L. Bender and K. A. Connors, "A non-enzymatic olefinic hydration under neutral conditions.
The kinetics of the hydration of fumaric acid monoanion," Journal of the American Chemical
Society, vol. 83, pp. 4099-4100, 1961.
[19] G. Jones, "The Markovnikov rule," Journal of Chemical Education, vol. 38, p. 297, 1961/06/01
1961.
[20] J. F. Jin and U. Hanefeld, "The selective addition of water to C=C bonds; enzymes are the best
chemists," Chemical Communications, vol. 47, pp. 2502-2510, 2011.
[21] I. Schomburg, et al., "BRENDA in 2013: integrated reactions, kinetic data, enzyme function data,
improved disease classification: new options and contents in BRENDA," Nucleic Acids Research,
vol. 41, pp. D764-D772, January 1, 2013 2013.
[22] C. Wuensch, et al., "Asymmetric enzymatic hydration of hydroxystyrene derivatives," Angewandte
Chemie - International Edition, vol. 52, pp. 2293-2297, 2013.
[23] T. Toraya, "Radical catalysis in coenzyme B12-dependent isomerization (eliminating) reactions,"
Chemical Reviews, vol. 103, pp. 2095-2128, 2003/06/01 2003.
[24] X. Zhang, et al., "Kinetics and mechanism of the hydration of CO2 and dehydration of HCO3 -
catalyzed by a Zn(II) complex of 1,5,9-triazacyclododecane as a model for carbonic anhydrase,"
Inorganic Chemistry, vol. 32, pp. 5749-5755, 1993.
[25] N. Saito, "Purification and properties of bacterial phosphopyruvate hydratase," Journal of
Biochemistry, vol. 61, pp. 59-69, 1967.
[26] B. F. Pfleger, et al., "Structural and functional analysis of AsbF: Origin of the stealth 3,4-
dihydroxybenzoic acid subunit for petrobactin biosynthesis," Proceedings of the National Academy
of Sciences of the United States of America, vol. 105, pp. 17133-17138, 2008.
[27] T. B. Thompson, et al., "Evolution of enzymatic activity in the enolase superfamily: Structure of o-
succinylbenzoate synthase from Escherichia coli in complex with Mg2+ and o-succinylbenzoate,"
Biochemistry, vol. 39, pp. 10662-10676, 2000/09/01 2000.
[28] A. J. Morgan, et al., "1, 5-Anhydro-D-fructose dehydratase," ed: Google Patents, 2002.
[29] T. Toraya, et al., "Propanediol dehydratase system. Role of monovalent cations in binding of vitamin
B12 coenzyme or its analogs to apoenzyme," Biochemistry, vol. 10, pp. 3475-3484, 1971.
[30] P. Bartholmes, et al., "Cooperative and noncooperative binding of pyridoxal 5′-phosphate to
tryptophan synthase from Escherichia coli," Biochemistry, vol. 15, pp. 4712-4717, 1976.
[31] M. M. Werst, et al., "Characterization of the [4Fe-4S]+ cluster at the active site of aconitase by 57Fe,
33S, and 14N electron nuclear double resonance spectroscopy," Biochemistry, vol. 29, pp. 10533-
10540, 1990.
[32] T. L. Grimek and J. C. Escalante-Semerena, "The acnD genes of Shewenella oneidensis and Vibrio
cholerae encode a new Fe/S-dependent 2-methylcitrate dehydratase enzyme that requires prpF
function in vivo," Journal of Bacteriology, vol. 186, pp. 454-462, 2004.
[33] R. M. Drevland, et al., "Methanogen homoaconitase catalyzes both hydrolyase reactions in
coenzyme B biosynthesis," Journal of Biological Chemistry, vol. 283, pp. 28888-28896, 2008.
[34] B. M. A. van Vugt-Lussenburg, et al., "Identification of two [4Fe-4S]-cluster-containing hydro-
lyases from Pyrococcus furiosus," Microbiology, vol. 155, pp. 3015-3020, 2009.
General introduction
28
[35] H. A. Hofstein, et al., "Role of glutamate 144 and glutamate 164 in the catalytic mechanism of enoyl-
CoA hydratase," Biochemistry, vol. 38, pp. 9508-9516, 1999/07/01 1999.
[36] J. C. Fong and H. Schulz, "Purification and properties of pig heart crotonase and the presence of
short chain and long chain enoyl coenzyme A hydratases in pig and guinea pig tissues," Journal of
Biological Chemistry, vol. 252, pp. 542-547, 1977.
[37] Y. Shibata, et al., "Fatty acid hydroperoxide lyase is a heme protein," Biochemical and Biophysical
Research Communications, vol. 207, pp. 438-443, 1995.
[38] A. N. Grechkin, "Hydroperoxide lyase and divinyl ether synthase," Prostaglandins and Other Lipid
Mediators, vol. 68-69, pp. 457-470, 2002.
[39] X. He, et al., "Probing the coenzyme and substrate binding events of CDP-D-glucose 4,6-
dehydratase: Mechanistic implications," Biochemistry, vol. 35, pp. 4721-4731, 1996.
[40] J. P. Morrison, et al., "Mechanistic studies on PseB of pseudaminic acid biosynthesis: A UDP-N-
acetylglucosamine 5-inverting 4,6-dehydratase," Bioorganic Chemistry, vol. 36, pp. 312-320, 2008.
[41] U. Müh, et al., "4-Hydroxybutyryl-CoA dehydratase from Clostridium aminobutyricum:
Characterization of FAD and iron−sulfur clusters involved in an overall non-redox reaction,"
Biochemistry, vol. 35, pp. 11710-11718, 1996/01/01 1996.
[42] S. Bornemann, "Flavoenzymes that catalyse reactions with no net redox change," Natural Product
Reports, vol. 19, pp. 761-772, 2002.
[43] D. Umeno, et al., "Diversifying carotenoid biosynthetic pathways by directed evolution,"
Microbiology and Molecular Biology Reviews, vol. 69, pp. 51-78, Mar 2005.
[44] C. M. Evans and A. J. Kirby, "A model for olefin hydration: Intramolecular nucleophilic addition of
phenolate oxygen to the unactivated double bond," Journal of the Chemical Society, Perkin
Transactions 2, pp. 1259-1267, 1984.
[45] G. A. Armstrong and J. E. Hearst, "Carotenoids .2. Genetics and molecular biology of carotenoid
pigment biosynthesis," Faseb Journal, vol. 10, pp. 228-237, Feb 1996.
[46] S. L. Jensen, et al., "Biosynthesis of carotenoids in purple bacteria : A re-evaluation based on
considerations of chemical structure," Nature, vol. 192, pp. 1168-1172, 1961.
[47] C. I. Cazzonelli, "Carotenoids in nature: insights from plants and beyond," Functional Plant Biology,
vol. 38, pp. 833-847, 2011.
[48] G. A. Armstrong, "Genetics of eubacterial carotenoid biosynthesis: A colorful tale," Annual Review
of Microbiology, vol. 51, pp. 629-659, 1997.
[49] S. Steiger, et al., "Heterologous expression, purification, and enzymatic characterization of the
acyclic carotenoid 1,2-hydratase from Rubrivivax gelatinosus," Archives of Biochemistry and
Biophysics, vol. 414, pp. 51-58, Jun 1 2003.
[50] A. Hiseni, et al., "Biochemical characterization of the carotenoid 1,2-hydratases (CrtC) from
Rubrivivax gelatinosus and Thiocapsa roseopersicina," Applied Microbiology and Biotechnology,
vol. 91, pp. 1029-1036, 2011.
[51] K. Vogl and D. A. Bryant, "Elucidation of the biosynthetic pathway for okenone in Thiodictyon sp.
CAD16 leads to the discovery of two novel carotene ketolases," Journal of Biological Chemistry,
vol. 286, pp. 38521-38532, November 4, 2011 2011.
1.7 References
29
[52] N. U. Frigaard, et al., "Genetic manipulation of carotenoid biosynthesis in the green sulfur bacterium
Chlorobium tepidum," Journal of Bacteriology, vol. 186, pp. 5210-5220, Aug 2004.
[53] G. A. Armstrong, et al., "Nucleotide-sequence, organization, and nature of the protein products of
the carotenoid biosynthesis gene-cluster of Rhodobacter-capsulatus," Molecular & General
Genetics, vol. 216, pp. 254-268, Apr 1989.
[54] H. P. Lang, et al., "Complete DNA-sequence, specific Tn5 insertion map, and gene assignment of
the carotenoid biosynthesis pathway of Rhodobacter-sphaeroides," Journal of Bacteriology, vol.
177, pp. 2064-2073, Apr 1995.
[55] A. T. Kovacs, et al., "Genes involved in the biosynthesis of photosynthetic pigments in the purple
sulfur photosynthetic bacterium Thiocapsa roseopersicina," Applied and Environmental
Microbiology, vol. 69, pp. 3093-3102, Jun 2003.
[56] E. Giraud, et al., "Two distinct crt gene clusters for two different functional classes of carotenoid in
Bradyrhizobium," Journal of Biological Chemistry, vol. 279, pp. 15076-15083, Apr 9 2004.
[57] J. A. Botella, et al., "A cluster of structural and regulatory genes for light-iduced carotenogenesis in
Myxococcus-xanthus," European Journal of Biochemistry, vol. 233, pp. 238-248, Oct 1995.
[58] Z. T. Sun, et al., "A novel carotenoid 1,2-hydratase (CruF) from two species of the non-
photosynthetic bacterium Deinococcus," Microbiology-Sgm, vol. 155, pp. 2775-2783, Aug 2009.
[59] J. E. Graham and D. A. Bryant, "The biosynthetic pathway for myxol-2′ fucoside
(myxoxanthophyll) in the cyanobacterium Synechococcus sp. strain PCC 7002," Journal of
Bacteriology, vol. 191, pp. 3292-3300, 2009.
[60] H. Kiss, et al., "Complete genome sequence of the filamentous gliding predatory bacterium
Herpetosiphon aurantiacus type strain (114-95 T)," Standards in Genomic Sciences, vol. 5, pp. 356-
370, 2011.
[61] H. J. Chiu, et al., "Structure of the first representative of Pfam family PF09410 (DUF2006) reveals
a structural signature of the calycin superfamily that suggests a role in lipid metabolism," Acta
Crystallographica Section F: Structural Biology and Crystallization Communications, vol. 66, pp.
1153-1159, 2010.
[62] N. J. Patel, et al., "Use of deuterium labelling from deuterium oxide to demonstrate carotenoid
transformations in photosynthetic bacteria," BBA - General Subjects, vol. 760, pp. 92-96, 1983.
[63] A. A. Yeliseev and S. Kaplan, "Anaerobic carotenoid biosynthesis in Rhodobacter sphaeroides
2.4.1: H2O is a source of oxygen for the 1-methoxy group of spheroidene but not for the 2-oxo group
of spheroidenone," Febs Letters, vol. 403, pp. 10-14, 1997.
[64] E. L. Sonnhammer, et al., "A hidden Markov model for predicting transmembrane helices in protein
sequences," Proceedings / ... International Conference on Intelligent Systems for Molecular
Biology ; ISMB. International Conference on Intelligent Systems for Molecular Biology, vol. 6, pp.
175-182, 1998.
[65] L. L. Wallen, et al., "The microbiological production of 10-hydroxystearic acid from oleic acid,"
Archives of Biochemistry and Biophysics, vol. 99, pp. 249-253, 1962.
[66] C. W. Seo, et al., "Hydration of squalene and oleic-acid by Corynebacterium sp. S-401,"
Agricultural and Biological Chemistry, vol. 45, pp. 2025-2030, 1981.
General introduction
30
[67] S. H. Elsharkawy, et al., "Microbial oxidation of oleic-acid," Applied and Environmental
Microbiology, vol. 58, pp. 2116-2122, Jul 1992.
[68] T. M. Kuo and W. E. Levinson, "Biocatalytic production of 10-hydroxystearic acid, 10-ketostearic
acid, and their primary fatty amides," Journal of the American Oil Chemists Society, vol. 83, pp.
671-675, Aug 2006.
[69] B. N. Kim, et al., "Conversion of oleic acid to 10-hydroxystearic acid by whole cells of
Stenotrophomonas nitritireducens," Biotechnology Letters, vol. 33, pp. 993-997, May 2010.
[70] L. E. Bevers, et al., "Oleate hydratase catalyzes the hydration of a nonactivated carbon-carbon
bond," Journal of Bacteriology, vol. 191, pp. 5010-5012, Aug 2009.
[71] E. N. Davis, et al., "Microbial hydration of cis-9-alkenoic acids " Lipids, vol. 4, pp. 356-362, 1969.
[72] A. Volkov, et al., "Myosin cross-reactive antigen of Streptococcus pyogenes M49 encodes a fatty
acid double bond hydratase that plays a role in oleic acid detoxification and bacterial virulence,"
Journal of Biological Chemistry, vol. 285, pp. 10353-10361, 2010.
[73] E. Rosberg-Cody, et al., "Myosin-cross-reactive antigen (MCRA) protein from Bifidobacterium
breve is a FAD-dependent fatty acid hydratase which has a function in stress protection," Bmc
Biochemistry, vol. 12, 2011.
[74] B. N. Kim, et al., "Production of 10-hydroxystearic acid from oleic acid and olive oil hydrolyzate
by an oleate hydratase from Lysinibacillus fusiformis," Applied Microbiology and Biotechnology,
vol. 95, pp. 929-937, 2012.
[75] M.-H. Seo, et al., "Production of a novel compound, 10,12-dihydroxystearic acid from ricinoleic
acid by an oleate hydratase from Lysinibacillus fusiformis," Applied Microbiology and
Biotechnology, pp. 1-9, 2013/02/03 2013.
[76] Y. C. Joo, et al., "Production of 10-hydroxystearic acid from oleic acid by whole cells of
recombinant Escherichia coli containing oleate hydratase from Stenotrophomonas maltophilia,"
Journal of Biotechnology, vol. 158, pp. 17-23, 2012.
[77] E. Y. Jeon, et al., "Bioprocess engineering to produce 10-hydroxystearic acid from oleic acid by
recombinant Escherichia coli expressing the oleate hydratase gene of Stenotrophomonas
maltophilia," Process Biochemistry, vol. 47, pp. 941-947, 2012.
[78] Y. C. Joo, et al., "Biochemical characterization and FAD-binding analysis of oleate hydratase from
Macrococcus caseolyticus," Biochimie, vol. 94, pp. 907-915, 2012.
[79] B. Yang, et al., "Myosin-cross-reactive antigens from four different lactic acid bacteria are fatty acid
hydratases," Biotechnology Letters, vol. 35, pp. 75-81, 2013.
[80] O. Dym and D. Eisenberg, "Sequence-structure analysis of FAD-containing proteins," Protein
Science, vol. 10, pp. 1712-1728, 2001.
[81] R. K. Wierenga, et al., "Prediction of the occurrence of the ADP-binding βαβ-fold in proteins, using
an amino acid sequence fingerprint," Journal of Molecular Biology, vol. 187, pp. 101-107, 1986.
[82] W. G. Niehaus Jr, et al., "Stereospecific hydration of the delta-9 double bond of oleic acid," Journal
of Biological Chemistry, vol. 245, pp. 3790-3797, 1970.
1.7 References
31
[83] A. Volkov, et al., "Crystal structure analysis of a fatty acid double-bond hydratase from
Lactobacillus acidophilus," Acta Crystallographica Section D: Biological Crystallography, vol. 69,
pp. 648-657, 2013.
Chapter 2
2 Biochemical Characterization of the Carotenoid 1,2-Hydratases (CrtC) from
Rubrivivax gelatinosus and Thiocapsa roseopersicina
Aida Hiseni, Isabel W.C.E. Arends and Linda G. Otten
Appl Microbiol Biotechnol. Aug 2011; 91(4): 1029–1036
Biochemical Characterization of the Carotenoid 1,2-Hydratases (CrtC) from Rubrivivax gelatinosus and Thiocapsa roseopersicina
34
Abstract
Two carotenoid 1,2-hydratase (crtC) genes from the photosynthetic bacteria Rubrivivax
gelatinosus and Thiocapsa roseopersicina were cloned and expressed in Escherichia coli
in an active form and purified by affinity chromatography. The biochemical properties of
the recombinant enzymes and their substrate specificities were studied. The purified CrtC’s
catalyze cofactor independently the conversion of lycopene to 1-HO- and 1,1′-(HO)2-
lycopene. The optimal pH and temperature for hydratase activity was 8.0 and 30ºC,
respectively. The apparent Km and Vmax values obtained for the hydration of lycopene were
24 µM and 0.31 nmol h-1 mg-1 for RgCrtC and 9.5 µM and 0.15 nmol h-1 mg-1 for TrCrtC,
respectively. SDS-PAGE analysis revealed two protein bands of 44kDa and 38kDa for
TrCrtC, which indicate protein processing. Both hydratases are also able to convert the
unnatural substrate geranylgeraniol (C20 substrate), which functionally resembles the
natural substrate lycopene.
2.1 Introduction
35
2.1 Introduction
Optically pure tertiary alcohols are highly valuable building blocks for the synthesis of
several bioactive natural products and pharmaceuticals [1]. However, the synthesis of
optically pure tertiary alcohols in high yield without undesired side products is still a
challenging task in traditional chemical synthesis [2]. Much effort has therefore been
devoted to the development of cleaner alternative technologies. The application of
biocatalysts is recognized as a significant complement to the use of chemical reagents.
Biocatalysts such as enzymes and whole microbial cells are increasingly being utilized for
both environmental and economic reasons in a number of industries including agro-food,
animal feed, detergent, textile and specialty chemical industry. The market for enzymes has
increased in an almost exponential manner from 1960s to 2000 [3]. This is due to the well-
known benefits of enzymes. They are remarkable catalysts capable of accepting a wide
array of complex substrates, are highly selective (enantio-, regio- and chemoselective) and
operate efficiently under mild conditions.
The possibility of using enzymes for the production of tertiary alcohols has generated our
interest in the enzyme class of hydro-lyases (EC 4.2.1-), which catalyze the reversible
addition of water to a carbon-carbon double bond. Although more than 100 hydro-lyases
have been discovered to date, only a few examples have been used in industrial applications
[4, 5]. For example, for the production of R-γ-dodeca-lactone, an essential flavor in whisky,
oleate hydratase has been utilized, which catalyzes the conversion of oleic acid to form (R)-
γ-hydroxy-stearate, which again is converted to the end product by baker’s yeast [6-8].
Carotenoid 1,2-hydratase (CrtC), another member of the hydro-lyases group, occurs in the
biosynthetic pathway of different acyclic carotenoids in photosynthetic bacteria. CrtC
introduces a tertiary hydroxy group into a carotenoid molecule by addition of water to the
carbon-carbon double bond at the C-1 position. Several carotenoid 1,2-hydratases have
been identified in photosynthetic [9-13] as well as in non-photosynthetic bacteria [14, 15].
Recently, a novel carotenoid 1,2-hydratase (CruF) has been described in the non-
photosynthetic bacterium Deinococcus [15], which catalyzes C-1′,2′ hydration of γ-
carotene. This enzyme though, is evolutionarily distinct from the CrtC family in
photosynthetic bacteria.
The CrtC from the purple non-sulfur photosynthetic bacterium Rubrivivax gelatinosus has
been partially characterized and it was found to be a membrane-bound enzyme with a
Biochemical Characterization of the Carotenoid 1,2-Hydratases (CrtC) from Rubrivivax gelatinosus and Thiocapsa roseopersicina
36
molecular weight of 44 kDa [16]. In vitro assay showed that the enzyme was able to hydrate
the carbon-carbon double bond at the ψ-end group of several natural substrates such as
neurosporene and lycopene to the corresponding products 1-HO- and 1,1′-(HO)2-
neurosporene and 1-HO- and 1,1′-(HO)2-lycopene without the use of any cofactor. Through
genetic analysis and characterization of the pigment biosynthesis genes in the purple sulfur
photosynthetic bacterium Thiocapsa roseopersicina a putative protein was found that
showed high identity to CrtC from R. gelatinosus [11]. Gene cluster analysis of T.
roseopersicina (Gammaproteobacteria) revealed a significant identity (55 %) of the crtC
gene product to the CrtC from R. gelatinosus (Betaproteobacteria), although the
arrangement of the pigment biosynthesis gene cluster resembles more that of Rhodobacter
species (Alphaproteobacteria) [17]. However, so far the enzyme has not been isolated or
characterized in any detail, which makes it a potential candidate for a hydro-lyase with new
properties.
In order to make this group of enzymes more attractive for green hydration reactions in
industrial applications, we have investigated parameters that could be of major importance
to that field. Herein we report on the detailed biochemical characterization of the two
CrtC’s from R. gelatinosus and T. roseopersicina. This provides an insight into their
potential to be used as biocatalysts. The broad stability and activity profiles of both
enzymes are promising for industrial biocatalysis.
2.2 Materials and methods
2.2.1 Construction of pET15b_CrtCRg and pET15b_CrtCTr expression vectors
The crtCRg and crtCTr genes were amplified with primers Rg_fw/Rg_rv
(GGGAGTACCATATGCGAGCAGCGGAGTC and ATACACTCGAGATGTATACG
TCAAGCGCGG) and Tr_fw/Tr_rv (GGAGTAATCATATGCGAGCAGCGGGC and
CCCTCGAGAACTATGTCTTCT-CAGCCGCC), respectively, containing restriction
sites for NdeI (forward) and XhoI (reverse) (restriction sites are underlined). Amplification
reactions were done under standard PCR conditions using plasmids pPQE30crtCRg and
pTcrt3 respectively, as template (Supplementary table 2.1). Using NdeI/XhoI restriction
sites the digested and purified fragment was ligated into the same sites of the pET15b vector
2.2 Materials and methods
37
and transformed into E. coli TOP10 competent cells. The insertion of the crtC gene was
verified by restriction analysis with NdeI/XhoI enzymes and DNA sequencing (BaseClear).
2.2.2 Expression and purification of recombinant proteins E. coli BL21 (DE3) was the host for the pET15_CrtC plasmids. Cultures were grown at
37°C in LB-broth with 100 µg ml-1 ampicillin until an OD600 value of 0.6-0.8 was reached.
Protein expression was induced by addition of isopropyl-β-D-thiogalactopyranoside
(IPTG) to a final concentration of 0.1 mM, followed by cultivation at 25°C overnight. The
induced cells were harvested by centrifugation at 10.000 rpm for 10 min at 4°C (Sorvall),
washed once with 50 mM Na2HPO4 buffer (pH 8.0) and suspended in the binding buffer
(50 mM Na2HPO4, 300 mM NaCl, 20 mM imidazole, pH 8.0). Cell-free extract (CFE) was
obtained after lysis of the cells with 1 mg ml-1 lysozyme for 1 h at 4ºC followed by cell
disruption at the pressure of 2.4 kBar (Constant systems, IUL instruments) and
centrifugation at 10.000 rpm for 20 min at 4°C. The separation of the CFE into membrane
fraction and supernatant was done by centrifugation at 45.000 rpm for 1 h at 4ºC.
CFE’s were filtered through 0.45 µm filter (Whatman, FP 30/0, 45 CA-S) and each extract
was applied separately onto Ni-NTA HisTrap HP column (1.6 x 2.5 cm, 5 ml, GE
Healthcare) previously equilibrated with binding buffer. The purification and the loading
of the samples onto the column were performed with the HPLC-system in conjunction with
the LCsolution software (Shimadzu). Unbound proteins were washed from the column with
a gradient of 50-75 mM imidazole in washing buffer (50 mM Na2HPO4, 300 mM NaCl,
pH 8.0). Then, the CrtC protein was eluted from the column with a gradient of 75-300 mM
imidazole in elution buffer (50 mM Na2HPO4, 300 mM NaCl, pH 8.0). Enzyme fractions
were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE;
10% Bis-Tris, BioRad) and visualized by staining with SimplyBlue SafeStain (Invitrogen).
Fractions containing CrtC were combined and concentrated using Amicon Ultra-30 filters
(Millipore). The concentrated sample was applied onto a PD-10 desalting column (GE
Healthcare) previously equilibrated with 50 mM Na2HPO4 buffer (pH 8.0). The eluted
enzyme sample was frozen in liquid nitrogen and stored in aliquots at -80ºC.
2.2.3 Tandem MS analysis The concentrated CrtC sample was further purified by SDS-PAGE. The protein band was
excised from the gel and subjected to in-gel proteolytic digestion as previously described
[18].
Biochemical Characterization of the Carotenoid 1,2-Hydratases (CrtC) from Rubrivivax gelatinosus and Thiocapsa roseopersicina
38
2.2.4 CrtC activity assay and analysis of the products Enzyme activity was determined either with the purified enzyme or with the CFE. The
assay was performed with 50-100 µg enzyme in 200 µl 50 mM Na2HPO4 buffer (pH 8.0),
containing 10 mg ml-1 L-α-phosphatidylcholine (from egg yolk) and 20 µM lycopene
(Lanospharma Laboratories Co., Ltd) from a stock in acetone. After incubation at 28ºC and
shaking at 800 rpm in the dark the substrate and products were extracted from the aqueous
layer after a desired time interval. Prior to the extraction 50 µl of saturated NaCl solution
was added and the carotenoids extracted with one volume of dichloromethane. The
mixtures were shaken for 5 min at 1400 rpm, centrifuged for 1 min at 13.200 rpm
(Eppendorf) and 150 µl of the dichloromethane phase was dried with a Speed Vac
Concentrator (Thermo). The dried carotenoids were dissolved in 10 µl dichloromethane,
diluted 1:10 with 100% acetonitrile and analyzed with HPLC. Separation was performed
with a Merck 4.6x50 mm Chromolith TM SpeedROD RP-18e 2µm-column with acetonitrile
/ water (95:5, v/v) as the eluent. Lycopene and the corresponding products were detected
at 470 nm (SPD-20A, Shimadzu). Marker carotenoids were obtained as described by
Steiger et al. [19] and used for the identification of the reaction products.
The lycopene concentration in the assay was quantified from the calibration curve
constructed by diluting a stock of lycopene in dichloromethane with acetone. A second
calibration curve, which was used to quantify the reaction products, was constructed in the
same way as the standard assay, including the extraction step.
For the determination of enzyme kinetic parameters, the purified enzyme was incubated for
4 hours with different concentrations of lycopene (0.5-35 µM) in 50 mM Na2HPO4 buffer
(pH 8.0), containing 10 mg ml-1 L-α-phosphatidylcholine. Each reaction was performed in
duplicate. The affinity constant (Km) and the maximal velocity (Vmax) were calculated from
the experimental data points using OriginPro 8 SR1 software.
2.2.5 Substrate specificity Substrate specificity was assayed using the following acyclic alkenes: 2-methyl-2-butene
(79 mM), 2-methyl-2-pentene (68 mM), farnesol (33 mM) and geranylgeraniol (14.3 mM),
as substrates. Reactions were carried out using standard assay conditions. E. coli carrying
the empty pET15-b vector was used as negative control reaction. Substrates and products
were extracted from aqueous layer with one volume of ethyl acetate. The samples were
dried with Na2SO4 prior to their injection. Separation and identification of the components
2.2 Materials and methods
39
was effected with a Shimadzu GC-MS coupled to a QP-2010S with a FactorFour VF-
WAXms column (length 30 m, diameter 0.25 mm, and film thickness 0.25 µm).
2.2.6 Effects of pH and temperature on CrtC activity In order to investigate the pH effect on the CrtC activity, the reactions were carried out in
buffers with varying pH values. The buffers used for pH test were sodium acetate (100 mM,
pH 3.0-6.0), potassium phosphate (100 mM, pH 6.0-8.0) and Tris-HCl (50 mM, pH 8.0-
9.0). The measurements were conducted at 28ºC and lycopene (20 µM) was used as
substrate, as described in the section “CrtC activity assay and analysis of the products”.
The pH stability of the enzyme was performed by measuring the remaining activity at pH
8.0 after the enzyme had been incubated in the corresponding buffers for 30 min.
The optimum temperature for CrtC activity was determined by testing enzyme activity at
temperatures ranging from 0 to 50ºC using the standard activity assay. The thermal stability
was investigated by pre-incubating the enzyme at various temperatures (5-50ºC) in the
absence of substrate for 30 min, cooling the enzyme on ice, and then measuring the residual
activity in a standard assay with lycopene as substrate.
2.2.7 Effects of inhibitors and metal ions on enzyme activity The inhibitory effects on enzyme activity were investigated by performing activity assay
under standard conditions in the presence of several metal ions (MgCl2, MnCl2, CoCl2,
ZnCl2, CaCl2 and CuSO4) and chemicals (NAD+, NADH, protease inhibitor “Complete”
(Roche)) with a final concentration of 1 mM. Lycopene (20 µM) was used as substrate and
the activity was measured as described above. Reaction mixture without any additive was
used as control reaction and was designated as 100% activity.
2.2.8 Circular dichroism (CD) spectroscopy The purified RgCrtC and TrCrtC were diluted to 0.04 and 0.03 mg ml-1, respectively, in 10
mM Na2HPO4, pH 8.0. Samples were incubated for 5 min at temperatures from 5 to 90ºC
(5°C steps) and after each incubation samples were scanned. CD spectra were collected
from 190 to 250 nm as an average of five spectra, with a data pitch of 1 nm. A band width
of 1 nm was used with a detector response time of 0.25 sec and scanning speed of 100 nm
min-1. CD spectra were recorded on a Jasco J-810 spectrometer equipped with a Peltier
temperature control unit in 0.1 cm path length cuvette [20].
Biochemical Characterization of the Carotenoid 1,2-Hydratases (CrtC) from Rubrivivax gelatinosus and Thiocapsa roseopersicina
40
2.2.9 Metal analysis using USN-ICP-OES The metal content from purified protein sample and the buffer solution was measured using
Perkin-Elmer 4300 dual view inductively coupled plasma (ICP) with optical emission
spectroscopy (OES) spectrometer, coupled with ultrasonic nebulizer (USN) U-6000 AT,
Cetac. Measurements were performed for different metals and at different wavelengths, as
following: Co (228 nm and 238 nm), Fe (238 nm and 239 nm), Mo (202 nm and 203 nm),
Ni (231 nm and 221 nm) and Zn (206 nm and 213 nm).
2.3 Results
2.3.1 Expression and purification of the carotenoid 1,2-hydratases
For biochemical characterization of the carotenoid 1,2-hydratases and comparison of their
catalytic activities, the two crtC genes from R. gelatinosus and T. roseopersicina were
cloned into the expression vector pET15-b. The constructed pET15b_CrtCRg and
pET15b_CrtCTr plasmids were sequenced and the results confirmed that the genes were
successfully inserted in frame with the N-terminal His6-tag. In order to express the
recombinant CrtC’s, E. coli BL21 (DE3) was transformed with the expression plasmids.
SDS/PAGE analysis revealed in both cases a 44 kDa band (Figure 2.1), which is consistent
with the value calculated from the deduced amino acid sequence.
Figure 2.1 SDS-PAGE (10%) analysis of expression and IMAC purification for RgCrtC (lane 1-3) and TrCrtC
(lane 4-6). M: precision plus protein standard; a: whole cells before induction; b: whole cells after induction
with 0.1 mM IPTG and expression overnight at 25ºC; c: purified CrtC’s.
The expression level of RgCrtC was around 2 times higher than that of TrCrtC expressed
under the same conditions. In the case of TrCrtC an additional faint band around 38 kDa
was detected after induction (Figure 2.1, lane 5), which is absent in the non-induced sample
(Figure 2.1, lane 4).
2.3 Results
41
CrtC’s were purified from CFE’s by a single step IMAC column and led to a nearly
homogenous band of 44 kDa in the case of RgCrtC and bands of 38 kDa and 44 kDa in the
case of TrCrtC (Figure 2.1, lanes 3 and 6). However, the larger band could not be detected
again, once the sample was stored at -20ºC for a few days (Figure 2.1, lane 6).
2.3.2 Hydratase activity Activity measurements of the purified enzymes with lycopene as substrate demonstrated
functional expression of the recombinant CrtC’s in E. coli. The purified enzymes catalyze
the conversion of lycopene into both 1-HO-lycopene and 1,1′-(HO)2-lycopene. For both
CrtC’s the conversion rate was 30% and the ratio between mono- and dihydroxylated
product was 2:1. USN-ICP-OES metal analysis showed that the protein samples did not
contain any significant amounts of iron, zinc, cobalt, nickel or molybdenum (data not
shown). Furthermore, it was observed that the addition of coenzymes NAD+/NADH or
protease inhibitors had no detectable influence on enzyme activity. Although the effect of
various metal ions on the hydratase activity was tested, no firm conclusion could be drawn
from these data as the metals have a degrading effect on the substrate lycopene [21].
2.3.3 Enzyme kinetics In order to compare the catalytic activities of the two expressed CrtC’s, in vitro activity
studies were performed. Since the conversion of lycopene to 1-HO-lycopene and 1,1′-
(HO)2-lycopene with isolated enzyme was very slow, the reactions were carried out with
CFE’s (Figure 2.2). Kinetic parameters Km, Vmax, Vmax/Km and kcat/Km were determined by
activity assay using lycopene as substrate at 28ºC (Table 2.1). The results are shown in a
Michaelis-Menten plot (Figure 2.3) as the reaction rate versus the substrate concentration.
Table 2.1 Kinetic parameters for recombinant Rubrivivax gelatinosus CrtC and Thiocapsa roseopersicina
CrtC
Name Vmax (nmol h-1 mg-1) Km (µM) Vmax/Km (x 102) kcat/Km (h-1 nmol-1)
RgCrtC 0.32 ± 0.08 24.7 ± 12.7 1.3 0.57
TrCrtC 0.15 ± 0.02 9.8 ± 4 1.6 0.71
Biochemical Characterization of the Carotenoid 1,2-Hydratases (CrtC) from Rubrivivax gelatinosus and Thiocapsa roseopersicina
42
Figure 2.2 Reaction catalyzed by Rubrivivax gelatinosus and Thiocapsa roseopersicina carotenoid 1,2-
hydratase; the conversion of lycopene into 1-HO-lycopene and 1,1′-(HO)2-lycopene (A). HPLC separation of
carotenoids formed in vitro by E.coli extract expressing the RgCrtC (solid line) and TrCrtC (dashed line).
Peak 1, 1,1′-(HO)2-lycopene; peak 2, 1-HO-lycopene; peak 3, lycopene (B).
The affinity constant (Km) for recombinant RgCrtC and TrCrtC was calculated as 24 and
9.5 µM, respectively, and Vmax was 0.31 and 0.15 nmol h-1 mg-1, respectively. The substrate
specificity values were calculated as Vmax/Km and the results show a slightly higher
specificity of TrCrtC with 1.6 x 102 compared to RgCrtC with 1.3 x 102 for lycopene.
Furthermore, the catalytic efficiency values for TrCrtC (0.71 h-1 nmol-1) and RgCrtC (0.57
h-1 nmol-1) revealed no significant difference for lycopene hydration.
0 2 4 6 8 10
0
1000
2000
3000
4000
5000
Inte
nsit
y [m
V]
Time [min]
RgCrtC TrCrtC
(A)
(B)
1
2
3
2.3 Results
43
Figure 2.3 Michaelis-Menten plot of recombinant RgCrtC (●) and TrCrtC (○). The cell-free extracts were
assayed with various lycopene concentrations (0.5-40 µM) in 50 mM Na2HPO4 sodium phosphate (pH 8.0)
at 28ºC for 4 h. The rates of product formation (1-HO-lycopene plus 1,1′-(OH)2-lycopene) are plotted against
varying substrate concentrations. Kinetic constants are listed in Table 2.1.
2.3.4 Substrate specificity Substrate specificity was tested with acyclic alkenes of different chain length, which
possess the same alkenyl functional group like lycopene, the natural substrate of CrtC
(Supplementary figure 2.1). No activity was detected for the C5, C6 and C15 substrate
using standard assay conditions. However, a product was detected with the C20 substrate
geranylgeraniol for both RgCrtC and TrCrtC, which was absent in the control experiment.
The conversion was very low, approximately 5% (Supplementary figure 2.2).
2.3.5 Effect of pH and temperature on hydratase activity and stability
The dependence of the activity of recombinant RgCrtC and TrCrtC at different pH values
and temperatures was investigated using lycopene as substrate. The optimum pH for
hydratase activity appeared to be pH 8.0 (Figure 2.4A). While RgCrtC has a broader pH
optimum ranging from pH 7.0-8.0, a significant decrease was observed for TrCrtC with
0 5 10 15 20 25 30 35 400,00
0,05
0,10
0,15
0,20
RgCrtC
V [
nmol
h-1
mg-1
]
Lycopene [M]
TrCrtC
Biochemical Characterization of the Carotenoid 1,2-Hydratases (CrtC) from Rubrivivax gelatinosus and Thiocapsa roseopersicina
44
only 50% activity at pH 7.0. No activity could be detected at pH 4.0-5.0 for both enzymes.
At higher pH values, both enzymes showed rapid decrease of activity, although 50% of the
relative activity was still detected at pH 9.0. Both enzymes retained much residual activity
after 30 min incubation at pH 4.0-8.0, indicating that the CrtC’s are stable in both slightly
alkaline and acid environments (Supplementary figure 2.3A). However, compared with
RgCrtC, the TrCrtC stability decreases in the range from pH 6.5-9.0 to only 56% of the
residual activity, whereas RgCrtC still remains 95% activity at pH 9.0. Despite no detected
activity at pH 4.0-5.0 (Figure 2.4A) both enzymes seem to be stable at that pH range and
still show 75%-80% of residual activity.
The effect of temperature on hydratase activity from 0 to 50ºC is depicted in Figure 2.4B.
The favorable temperature range was from 25 to 35ºC with an optimum at 30ºC. Enzyme
activity for RgCrtC and TrCrtC was significantly lower at 20ºC (55 and 42%, respectively)
and 40ºC (47 and 31%, respectively). A negligible activity was found at 5ºC (around 10%).
Thermal stability was investigated by pre-incubating hydratases for 30 min at different
temperatures and subsequently testing residual activity under standard assay conditions
(Supplementary figure 2.3B).
2.3 Results
45
Figure 2.4 Effect of pH (A) and temperature (B) on activity of RgCrtC (●) and TrCrtC (○). For pH effect
measurements were performed with lycopene under standard assay conditions using different buffers: 100
mM acetate (pH 3.6, 4.0 and 5.0), 100 mM potassium phosphate (pH 6.0, 7.0 and 8.0) and 50 mM Tris-HCl
(pH 8.6 and 9.0). For temperature effect activity assays were performed with lycopene at various temperatures
(1-50ºC) under standard assay conditions.
4 5 6 7 8 90,00
0,05
0,10
0,15
0,20 RgCrtC TrCrtC
Enz
yme
acti
vity
[nm
ol h
-1 m
g-1]
pH
0 10 20 30 40 50 600,00
0,05
0,10
0,15
0,20 RgCrtC
Enz
yme
acti
vity
[nm
ol h
-1 m
g-1]
TrCrtC
Temperature [ºC]
(A)
(B)
Biochemical Characterization of the Carotenoid 1,2-Hydratases (CrtC) from Rubrivivax gelatinosus and Thiocapsa roseopersicina
46
Maximum stability was recorded at 5ºC. The enzymes did not show significant decrease of
the activity up to 40ºC. When pre-incubated at 45ºC they still showed relative high activity
(around 50 to 60%). However, RgCrtC was extremely sensitive at 50ºC retaining only 6%
activity after 30 min pre-incubation, while TrCrtC showed 30% residual activity at that
temperature. Additionally, the temperature stability of RgCrtC and TrCrtC was studied
using CD spectroscopy. It was not possible to obtain a good qualitative representation of
the CD spectra from RgCrtC, in contrast to TrCrtC, which is shown in Figure 2.5.
Figure 2.5 Enzyme stability of recombinant TrCrtC by CD spectroscopy. The purified CrtC was diluted to
0.03 mg/ml with 10 mM sodium phosphate, pH 8.0, and incubated for 5 min from 5 to 90ºC. CD assay was
performed by wavelength scan from 190 to 250 nm.
TrCrtC was found to be relatively stable below 50ºC. Significant change in the secondary
structure was observed at temperatures above 50ºC, which corresponds with the results
obtained in the activity assay (Figure 2.4B).
2.4 Discussion
This study reports on the purification and biochemical characterization of two
heterologously expressed carotenoid 1,2-hydratases (CrtC) from photosynthetic bacteria,
200 205 210 215 220 225 230 235 240 245 250-20
-15
-10
-5
0
5ºC 50ºC 70ºC 90ºC
Wavelength [nm]
CD
/CD
[m
deg]
2.4 Discussion
47
which are potential biocatalysts in the green hydration of carotenoid-like substrates. The
two crtC genes from R. gelatinosus (1221 bp) and T. roseopersicina (1218 bp) were cloned,
sequenced, and successfully expressed in E. coli BL21 (DE3). Many attempts have been
made to optimize expression levels and to reduce formation of inclusion bodies (data not
shown), as these enzymes are detected in the membrane fraction. Hydropathy plots,
determined with Kyte-Doolittle [22], did not reveal any putative transmembrane domain in
the two hydratases (Supplementary figure 2.5). However, it was noticed that the first 45-55
amino acids of RgCrtC and TrCrtC showed a significantly higher percentage of proline (13
and 16 %, respectively) whereas the rest of the sequence has the usual proline amount of 9
and 8%, respectively. Ouchane and co-workers described this already for RgCrtC [23].
Proline rich regions in proteins are widely found in prokaryotes and eukaryotes [24]. A
non-repetitive (XP)n sequence like identified in RgCrtC (10x) and TrCrtC (9x) can have
different functions as for instance stabilizing the enzyme by binding noncovalently to other
proteins, binding to other hydrophobic structures like hydrophobic substrates or function
as a “molecular trigger” passing signals to the inner membrane. Based on these findings
one may suggest that the hydrophobic N-terminus of the RgCrtC and TrCrtC could play a
role in stabilizing the enzyme in the hydrophobic membrane area. This hypothesis is
strengthened by the following data. On the nucleotide level the two crtC sequences
presented a relatively high identity of 70 % [25]. However, a significant difference was
observed after the heterologous expression in E. coli. Although the gene sequence predicts
a protein of 44 kDa (Supplementary figure 2.4B), the SDS/PAGE analysis of the expressed
enzymes showed a second band of about 38 kDa for TrCrtC, which was absent in RgCrtC
as well as in the empty vector control. Furthermore, membrane fractions with only a visible
38 kDa band showed good activity (data not shown) indicating that the lower band is active.
MS data of this band revealed that the N-terminal proline rich part is missing, thereby
supporting the hypothesis that this part is not important for biological activity or substrate
binding but for membrane association. Moreover, analysis of amino acid sequence
similarities of various known and putative CrtC’s also shows that the first part of the
sequence is missing in a number of the analyzed sequences (data not shown). As this
phenomenon of protein processing is not known from literature to occur in the CrtC family,
more experiments were performed. One approach currently under study, that addresses our
hypothesis, involves construction of mutants, which lack the N-terminal part of the
sequence. First results showed that the truncated CrtC’s are fully functional and catalyze
the conversion of lycopene to the corresponding products without any loss of activity
Biochemical Characterization of the Carotenoid 1,2-Hydratases (CrtC) from Rubrivivax gelatinosus and Thiocapsa roseopersicina
48
(Supplementary Figure 2.7). This observation confirms our hypothesis that the N-terminal
part is not involved in catalytic reaction nor in substrate binding. Furthermore, this means
that the truncated enzyme could be used in an industrial setting.
The RgCrtC and TrCrtC catalyze the conversion of lycopene with a Vmax of 0.31 and 0.15
nmol h-1 mg-1, respectively, and a Km of 24 and 9.5 µM, respectively, without the need of
any cofactor. The lower value of Km observed for TrCrtC shows that this enzyme presents
higher affinity for the substrate lycopene than RgCrtC. However, the catalytic efficiency
values were similar for both enzymes, despite TrCrtC presenting twofold lower Vmax.
Maximum activity was detected for both enzymes at pH 8.0 and at the temperature of 30ºC.
Moreover, they also presented quite good activities at temperatures ranging from 25 to
35ºC. However, temperatures above 50ºC caused denaturation of the protein structure and
therefore inactivation, which was confirmed by CD spectroscopy. Although both enzymes
are rather similar in their pH and temperature profile, RgCrtC is more stable at higher pH’s,
while TrCrtC is more stable at higher temperatures. This could be of importance when
choosing the right enzyme for a biocatalytic process.
The substrate scope study of CrtC’s is an important aspect as no investigation has been
made in this direction to date. Next to the substrate lycopene, activity measurements were
reported in literature with two other natural substrates neurosporene and spheroidene, as
demonstrated by Steiger et al. [16]. It was concluded that spheroidene, which possess a
terminal methoxy functional group, serves as the best substrate for RgCrtC. Furthermore,
this enzyme was also able to use monohydroxy carotenoids as substrates, which could not
be observed for Rhodobacter capsulatus CrtC [16]. Our primary objective with the
substrate specificity experiment was to investigate the possibility of using CrtC with
unnatural substrates to produce highly valuable compounds for industry. Based on the
observed activity with geranylgeraniol we postulate that the minimum size of the substrates
for both RgCrtC and TrCrtC is C20 (twenty carbon) chain. However, the low conversion
of about 5% clearly indicates that their substrate spectrum is limited. Since the crystal
structure of CrtC has not yet been solved, one can only speculate about the size of the active
site and the mechanism that is involved in the hydration of the substrates. Further structural
and biochemical characterization is necessary to achieve a full understanding of this
enzyme and its reaction mechanism.
2.5 Acknowledgments
49
In conclusion, both CrtC’s are stable at a broad and suitable temperature and pH range and
hydrate several long aliphatic substrates to give tertiary alcohols. Future studies will be
directed at improving the activity of these hydratases.
2.5 Acknowledgments
We thank Prof. Dr. Gerhard Sandmann and Prof. Dr. Kornél L. Kovács for providing the
plasmids. This project is financially supported by the Netherlands Ministry of Economic
Affairs and the B-Basic partner organizations (www.b-basic.nl) through B-Basic, a public-
private NWO-ACTS programme (ACTS = Advanced Chemical Technologies for
Sustainability).
Biochemical Characterization of the Carotenoid 1,2-Hydratases (CrtC) from Rubrivivax gelatinosus and Thiocapsa roseopersicina
50
2.6 Supplementary information
Supplementary table 2.1 Bacterial strains and plasmids used in this study
Strain and plasmid Relevant trait(s) Source or reference
Strains
E. coli BL21 (DE3) F– ompT gal dcm lon hsdSB(rB- mB
-) λ(DE3) Novagen
E. coli TOP10 F- mcrA Δ(mrr-hsdRMS-mcrBC) φ80lacZΔM15
ΔlacX74 nupG recA1 araD139 Δ(ara-leu)7697
galE15 galK16 rpsL(StrR) endA1 λ-
Invitrogen
Plasmids
pPQE30crtCRg pPQ30; carries the BamHI / KpnI fragment with
crtC from Rvi. gelatinosus
[16]
pTcrt3 pBluescript SK(+); carries the wild-type BamHI-
SacI fragment of the crtDC operon of Tca.
roseopersicina
[11]
pET15-b E. coli general expression vector with N-
terminal His tag; Ampr
Novagen
pET15b_CrtCRg pET15-b with 1252-bp NdeI / XhoI fragment
from pPQE30crtCRg
this work
pET15b_CrtCTr pET15-b with 1249-bp NdeI / XhoI fragment
from pTcrt3
this work
2.6 Supplementary information
51
Supplementary figure 2.1 Structure of substrates used for substrate specificity studies of Rvi. gelatinosus and
Tca. roseopersicina carotenoid 1,2-hydratase.
Supplementary figure 2.2 GC separation of products formed in vitro by Escherichia coli extract expressing
RgCrtC (pink line) and TrCrtC (blue line) using the substrate geranylgeraniol. Obtained product is indicated
with arrow (RT 41 min). Extract with empty plasmid pET15-b served as negative control (black line).
5.0 10.0 15.0 20.0 25.0 30.0 35.0 40.0 45.0 50.0 55.0 60.0 65.0 70.00.00
0.25
0.50
0.75
1.00
1.25
1.50
1.75
2.00
2.25
2.50
2.75
3.00
3.25
3.50
3.75
4.00
4.25
4.50
4.75
(x1,000,000)
Biochemical Characterization of the Carotenoid 1,2-Hydratases (CrtC) from Rubrivivax gelatinosus and Thiocapsa roseopersicina
52
Supplementary figure 2.3 Stability of RgCrtC (●) and TrCrtC (○) at different pH (A) and temperature (B)
values. The remaining activity was assayed under standard assay conditions after the cell-free extracts had
been incubated in the corresponding buffers (pH 3.6 to pH 9.0) or at the indicated temperature (5-50ºC) in 50
mM Na2HPO4 sodium phosphate (pH 8.0) for 30 min
3 4 5 6 7 8 9 100,00
0,01
0,02
0,03
0,04 RgCrtC
Enz
yme
activ
ity
[nm
ol h
-1 m
g-1]
pH
TrCrtC
0,00
0,05
0,10
0,15
0,20
0 10 20 30 40 50 60
RgCrtC
Enz
yme
acti
vity
[nm
ol h
-1 m
g-1]
TrCrtC
T [ºC]
(A)
(B)
2.6 Supplementary information
53
Supplementary figure 2.4 Amino acid sequence alignment of RgCrtC and TrCrtC (Clone Manager 9
Professional Edition). Identical amino acids are highlighted in red.
Biochemical Characterization of the Carotenoid 1,2-Hydratases (CrtC) from Rubrivivax gelatinosus and Thiocapsa roseopersicina
54
Supplementary figure 2.5 Hydropathy plot of the RgCrtC (A) and TrCrtC (B) amino acid sequence.
Hydropathy scores [22] for a window of 19 residues were averaged and assigned to the first amino acid of
the window. A hydropathy score greater than 1.6 indicates transmembrane region.
(A)
(B)
2.6 Supplementary information
55
Supplementary figure 2.6 DNA sequence alignment of RgCrtC and TrCrtC (Clone Manager 9 Professional
Edition). Identical bases are highlighted in red.
Biochemical Characterization of the Carotenoid 1,2-Hydratases (CrtC) from Rubrivivax gelatinosus and Thiocapsa roseopersicina
56
M 1a 1b 2a 2b 3a 3b 4a 4b 5a 5b
Supplementary figure 2.7 SDS-PAGE (10%) analysis (A) and amino acid sequence alignment of the wildtype
and the truncated CrtC (B). M: precision plus protein standard; a: whole cells before induction; b: whole cells
after induction with 0.1 mM IPTG and expression overnight at 25°C; 1: pET15-b; 2: TrCrtC wildtype; 3:
TrCrtC truncated; 4: RgCrtC wildtype; 5: RgCrtC truncated.
50
37
(A)
(B)
2.7 References
57
2.7 References
[1] R. Kourist, et al., "Enzymatic synthesis of optically active tertiary alcohols: Expanding the
biocatalysis toolbox," Chembiochem, vol. 9, pp. 491-498, Mar 3 2008.
[2] P. G. Cozzi, et al., "Enantioselective catalytic formation of quaternary stereogenic centers,"
European Journal of Organic Chemistry, pp. 5969-5994, Dec 2007.
[3] P. Fernandes, "Miniaturization in Biocatalysis," International Journal of Molecular Sciences, vol.
11, pp. 858-879, Mar 2010.
[4] D. Brady, et al., "Characterisation of nitrilase and nitrile hydratase biocatalytic systems," Applied
Microbiology and Biotechnology, vol. 64, pp. 76-85, Mar 2004.
[5] K. Rzeznicka, et al., "Cloning and functional expression of a nitrile hydratase (NHase) from
Rhodococcus equi TG328-2 in Escherichia coli, its purification and biochemical characterisation,"
Applied Microbiology and Biotechnology, vol. 85, pp. 1417-1425, Feb 2010.
[6] S. Gocho, et al., "BIOTRANSFORMATION OF OLEIC-ACID TO OPTICALLY-ACTIVE
GAMMA-DODECALACTONE," Bioscience Biotechnology and Biochemistry, vol. 59, pp. 1571-
1572, Aug 1995.
[7] A. Wanikawa, et al., "Detection of gamma-lactones in malt whisky," Journal of the Institute of
Brewing, vol. 106, pp. 39-43, Jan-Feb 2000.
[8] L. E. Bevers, et al., "Oleate hydratase catalyzes the hydration of a nonactivated carbon-carbon
bond," Journal of Bacteriology, vol. 191, pp. 5010-5012, Aug 2009.
[9] G. A. Armstrong, et al., "Nucleotide-sequence, organization, and nature of the protein products of
the carotenoid biosynthesis gene-cluster of Rhodobacter-capsulatus," Molecular & General
Genetics, vol. 216, pp. 254-268, Apr 1989.
[10] H. P. Lang, et al., "Complete DNA-sequence, specific Tn5 insertion map, and gene assignment of
the carotenoid biosynthesis pathway of Rhodobacter-sphaeroides," Journal of Bacteriology, vol.
177, pp. 2064-2073, Apr 1995.
[11] A. T. Kovacs, et al., "Genes involved in the biosynthesis of photosynthetic pigments in the purple
sulfur photosynthetic bacterium Thiocapsa roseopersicina," Applied and Environmental
Microbiology, vol. 69, pp. 3093-3102, Jun 2003.
[12] E. Giraud, et al., "Two distinct crt gene clusters for two different functional classes of carotenoid in
Bradyrhizobium," Journal of Biological Chemistry, vol. 279, pp. 15076-15083, Apr 9 2004.
[13] N. U. Frigaard, et al., "Genetic manipulation of carotenoid biosynthesis in the green sulfur bacterium
Chlorobium tepidum," Journal of Bacteriology, vol. 186, pp. 5210-5220, Aug 2004.
[14] J. A. Botella, et al., "A cluster of structural and regulatory genes for light-iduced carotenogenesis in
Myxococcus-xanthus," European Journal of Biochemistry, vol. 233, pp. 238-248, Oct 1995.
[15] Z. T. Sun, et al., "A novel carotenoid 1,2-hydratase (CruF) from two species of the non-
photosynthetic bacterium Deinococcus," Microbiology-Sgm, vol. 155, pp. 2775-2783, Aug 2009.
Biochemical Characterization of the Carotenoid 1,2-Hydratases (CrtC) from Rubrivivax gelatinosus and Thiocapsa roseopersicina
58
[16] S. Steiger, et al., "Heterologous expression, purification, and enzymatic characterization of the
acyclic carotenoid 1,2-hydratase from Rubrivivax gelatinosus," Archives of Biochemistry and
Biophysics, vol. 414, pp. 51-58, Jun 1 2003.
[17] N. Igarashi, et al., "Horizontal transfer of the photosynthesis gene cluster and operon rearrangement
in purple bacteria," Journal of Molecular Evolution, vol. 52, pp. 333-341, Apr 2001.
[18] A. M. Sevcenco, et al., "Development of a generic approach to native metalloproteomics: application
to the quantitative identification of soluble copper proteins in Escherichia coli," Journal of
Biological Inorganic Chemistry, vol. 14, pp. 631-640, May 2009.
[19] S. Steiger, et al., "Substrate specificity of the expressed carotenoid 3,4-desaturase from Rubrivivax
gelatinosus reveals the detailed reaction sequence to spheroidene and spirilloxanthin," Biochemical
Journal, vol. 349, pp. 635-640, Jul 15 2000.
[20] Y. H. Chen, et al., "Determination of secondary structures of proteins by Circular-Dichroism and
Optical Rotatory Dispersion," Biochemistry, vol. 11, pp. 4120-&, 1972.
[21] C. S. Boon, et al., "Role of Iron and Hydroperoxides in the Degradation of Lycopene in Oil-in-Water
Emulsions," Journal of Agricultural and Food Chemistry, vol. 57, pp. 2993-2998, Apr 2009.
[22] J. Kyte and R. F. Doolittle, "A Simple Method for Displaying the Hydropathic Character of a
Protein," Journal of Molecular Biology, vol. 157, pp. 105-132, 1982.
[23] S. Ouchane, et al., "Pleiotropic effects of puf interposon mutagenesis on carotenoid biosynthesis in
Rubrivivax gelatinosus - A new gene organization in purple bacteria," Journal of Biological
Chemistry, vol. 272, pp. 1670-1676, Jan 17 1997.
[24] M. P. Williamson, "The Structure and Function of Proline-Rich Regions in Proteins," Biochemical
Journal, vol. 297, pp. 249-260, Jan 15 1994.
[25] S. F. Altschul, et al., "Basic Local Alignment Search Tool," Journal of Molecular Biology, vol. 215,
pp. 403-410, Oct 5 1990.
Chapter 3
3 Structural Characterization of the Carotenoid 1,2-Hydratases (CrtC) from
Rubrivivax gelatinosus and Thiocapsa roseopersicina
Aida Hiseni, Linda G. Otten and Isabel W.C.E. Arends
Submitted
Structural Characterization of the Carotenoid 1,2-Hydratases (CrtC) from Rubrivivax gelatinosus and Thiocapsa roseopersicina
60
Abstract
Carotenoid 1,2-hydratases (CrtC) catalyze the selective addition of water to an isolated
carbon-carbon double bond. Although their involvement in the carotenoid biosynthetic
pathway is well understood, little is known about the mechanism by which these hydratases
transform carotenoids such as lycopene into corresponding hydroxyl compounds. To gain
insight into the enzymatic mechanism of CrtC’s point mutants of selected conserved amino
acids were generated. Rubrivivax gelatinosus CrtC point mutants in which each of the
amino acids His239, Trp241, Tyr266 and Asp268 were individually changed into Ala, and
the corresponding point mutants of Thiocapsa roseopersicina CrtC, were completely
inactive. This result suggests the identification of key residues which are directly involved
in the catalytic reaction. Furthermore, the analysis of a partial 3D structure of CrtC, which
was obtained by homology modeling with the putative AttH protein from Nitrosomonas
europaea, supported these results as all amino acids were in close distance to each other.
These results for the first time shed light on the potential catalytic mechanism of CrtC.
3.1 Introduction
61
3.1 Introduction
Carotenoids, which represent one of the most abundant natural pigments with structural
and protective properties [1], play an essential role in the photosynthetic machinery of
phototrophic organisms such as purple bacteria [2] and higher plants [3]. In addition, they
have been identified in fungi and some non-photosynthetic bacteria [4]. Carotenoid 1,2-
hydratase (also known as CrtC) is a member of hydro-lyases group EC 4.2.1.131. The
enzyme takes part in the biosynthetic pathway of carotenoids [5]. CrtC introduces a tertiary
hydroxyl group into an acyclic carotenoid molecule by addition of water to the carbon-
carbon double bond at the C-1 position. The enzyme belongs to the Pfam family PF07143
that encompasses members from several purple photosynthetic bacteria. On the other hand,
CrtC’s have been identified, which are able to hydrate mono-cyclic carotenoid gamma-
carotene. These are evolutionary very distinct from the PF07143 members [6] and they
have been given the name CruF.
Recently, two representatives of the PF07143 family, the CrtC’s from purple non-sulfur
Betaproteobacteria Rubrivivax gelatinosus and purple sulfur Gammaproteobacteria
Thiocapsa roseopersicina, respectively, were recombinantly expressed and characterized
[7]. Biochemical studies have revealed that these enzymes are able to convert cofactor
independently lycopene into 1-HO-lycopene and 1,1’-(HO)2-lycopene (Figure 3.1).
Figure 3.1 Reaction catalyzed by Rubrivivax gelatinosus and Thiocapsa roseopersicina carotenoid 1,2-
hydratase; the conversion of lycopene into 1-HO-lycopene and 1,1′-(HO)2-lycopene.
In addition, they showed some activity towards the unnatural substrate geranylgeraniol, a
C20 molecule that resembles the natural substrate lycopene (Figure 3.2).
Figure 3.2 Molecular structure of geranylgeraniol.
Structural Characterization of the Carotenoid 1,2-Hydratases (CrtC) from Rubrivivax gelatinosus and Thiocapsa roseopersicina
62
CrtC’s are appealing enzymes in the biotechnology field because they are able to make a
tertiary alcohol, a highly valuable building block for the synthesis of several bioactive
natural products and pharmaceuticals [8]. Furthermore, they possess an intrinsically high
stability at a wide pH and temperature range, which constitute useful properties for an
industrial application [7]. The subcellular location of this enzyme in the cell membrane
fraction (membrane-bound) allows for a straightforward isolation and simplified large scale
purification.
From a chemical point of view, CrtC’s are able to perform a challenging chemical reaction,
namely the selective addition of water to an isolated carbon-carbon double bond [9]. The
reaction proceeds without assistance of electron withdrawal groups, or transition metal
cations and in vitro requires harsh acidic conditions [10]. Furthermore, the CrtC’s from
photosynthetic bacteria act on acyclic carotenoids, whereas the CruF’s from non-
photosynthetic bacteria catalyze the hydration of mono-cyclic carotenoids. Nevertheless,
the catalytic and structural features, that determine hydratase activity and specificity of
these two distinct families remains unknown.
To our knowledge no published data exist on the catalytic mechanism of this group of
enzymes, nor has the 3D structure been elucidated yet. However, the 3D structure of the
first representative of the Pfam family PF09410 (putative AttH) has been solved, a family
which is distantly related to the CrtC family PF07143 [11]. The mechanism of lycopene
hydration, which involves proton attack at C-2 and C-2′ with a carbonium ion intermediate
and the introduction of the hydroxyl group at C-1 and C-1′, was established from 2H2O-
labeling studies with intact cells [12, 13]. For a hydration reaction, it is likely to assume
that the first step in the reaction is protonation of the alkene, leading to an intermediate
carbocation. Quenching of the carbocation by water will lead to the alcohol as product. The
protonation of hydrophobic long-chain alkenes has also been described for the enzyme
class of cyclases, of which the full mechanism is known [14, 15].
The objective of this study was to provide an insight into the possible hydration mechanism
of CrtC’s. Based on the better knowledge of the mechanistic reaction, it might be possible
to improve enzyme activity or substrate scope by for instance directed evolution or
(semi)rational design. Through multi-sequence alignment of several CrtC homologues,
highly conserved amino acids were identified, which could be functionally or structurally
important. The corresponding alanine mutants of these amino acids were produced and in
this way their involvement in the hydratase activity could be evaluated. Furthermore, a
3.2 Materials and methods
63
homology model of CrtC was obtained by using the putative AttH protein from
Nitrosomonas europaea as a template [11]. Following the identification of catalytically
active amino acid residues the aim was to propose a catalytic mechanism for CrtC catalyzed
water addition.
3.2 Materials and methods
3.2.1 In silico analysis BLAST [16] was used to select carotenoid 1,2-hydratase homologues. In order to look for
identities/similarities between the CrtC homologues, nucleotide and amino acid sequences
were aligned with the BioEdit Sequence Alignment Editor v.7.1.3.0
(www.mbio.ncsu.edu/bioedit/bioedit.html). In addition, protein sequences were subjected
to protein functional analysis using Conserved Domain Search (CDD) [17] and Pfam search
[18], and a protein phylogenetic tree was constructed with Phylogeny.fr [19, 20]. The CrtC
secondary structure prediction was carried out with the program PolyView 2D [21]. The
SWISS-MODEL program was used to model the structure of CrtC [22].
3.2.2 Cloning of carotenoid 1,2-hydratase genes Plasmids pET15b_CrtCRg and pET15b_CrtCTr containing CrtC from R. gelatinosus (Rg)
and T. roseopersicina (Tr), respectively, were constructed in a previous study [7]. Two
fosmids with crtC genes from metagenomic samples DelRiverFos06H03 (Fos06) and
DelRiverFos13D03 (Fos13), respectively, were kindly provided by Dr. Kirchman [23]. The
cosmid encoding CrtC from Bradyrhizobium (Br) was received from Dr. Dreyfus [24]. In
order to get sufficient DNA material for further studies, the fosmid- and cosmid DNA were
amplified in E. coli TOP 10 cells. After DNA isolation with the QIAprep Spin Miniprep
Kit (Qiagen) from the cells sufficient DNA was obtained for further research. The crtC’s
from Rhodospirillum rubrum (Rr) and Rhodopseudomonas palustris (Rp) were amplified
from genomic DNA. For that, genomic DNA of R. rubrum (Rr) was kindly provided by
Prof. Roberts (NCBI Reference Sequence: NC_007641.1). R. palustris cells (DSM No.
123) were obtained from DSMZ (Deutsche Sammlung von Mikroorganismen und
Zellkulturen), enriched in appropriate medium according to DSMZ instructions and gDNA
isolated using the UltraClean Soil DNA Isolation Kit (Mobio). Subsequently, primers were
designed for the isolation of all crtC genes (Table 3.1), which carry two restriction sites for
Structural Characterization of the Carotenoid 1,2-Hydratases (CrtC) from Rubrivivax gelatinosus and Thiocapsa roseopersicina
64
subsequent cloning: NdeI (forward) and XhoI (reverse). For BrcrtC the XhoI-site was
replaced with BamHI, because the XhoI-site was present in the gene itself. Amplification
reactions were done using standard PCR reactions. Using appropriate restriction sites, the
digested and purified fragment was ligated into the same sites of the pET15-b vector and
transformed into E. coli TOP10 competent cells. The insertion of the crtC gene was verified
by restriction analysis with the corresponding restriction enzymes (New England Biolabs)
and DNA sequencing (BaseClear).
Table 3.1 Primers used in this study. The respective restriction sites are underlined.
Name Sequence (5'→3') Restriction site
DRF06 FW GGGAGTACCATATGAGTGATGATGGCCAAC NdeI
DRF06 RV ATCCGCTCGAGATAATCTCAAGCCCGCCTCG XhoI
DRF13 FW GGGAGTACATATGGATGGCGTGTCAGAC NdeI
DRF13 RV CCGCTCGAGTAATGCTTAGGGCCACTTGGC XhoI
Br FW CGGACATCATATGTGCCCGCCAG NdeI
Br RV ATCCAGGATCCATCGCGTGAACTTCACCACC BamHI
Rp FW CGGGACTTCCATATGTCAGGAGCTGAGTTG NdeI
Rp RV ACCGCTCGAGTAACGTTCAGCGGAACGC XhoI
Rr FW GGGAAATTCCATATGCACCGCCCGGAC NdeI
Rr RV GCTCGAGTTCAATTAGCCCTTAACCGCCGC XhoI
3.2.3 Construction of CrtC mutants
3.2.3.1 Single point mutations Single amino acid exchange within the crtC genes of Rg and Tr was done by the
megaprimer PCR method introduced by Kammann et al. [25] and later modified by Sarkar
and Sommer [26] and Landt et al. [27]. The mismatch primers are listed in Table 3.2. In
the first PCR reaction, performed under standard reaction conditions, the megaprimer was
produced using the corresponding forward primer containing the desired base substitution
(Table 3.2) in combination with the reverse primer Rg_rv [7] and Tr_rv [7], respectively.
Plasmids pET15b_CrtCRg and pET15b_CrtCTr [7] were used as template. The size and
purity of the megaprimer was verified by agarose gel electrophoresis. In order to produce
the full length gene, a second PCR reaction was performed with the corresponding
megaprimer and Rg_fw [7] or Tr_fw [7], respectively. Subsequent steps were performed
as described in previous section. The insertion of the crtC gene and the presence of the
3.2 Materials and methods
65
desired mutation were verified by restriction analysis with NdeI/XhoI enzymes and DNA
sequencing (BaseClear).
Table 3.2 Primers for site directed mutagenesis. Mismatch points are underlined.
Amino acid
exchange Sequence (5'→3')
R. g
elat
inos
us
H239A AGCGGCGGACGCGCTCGCTG
W241A CATCGCGCGGGGCCGATCG
H264A CTGGAGCGGCGCCGCCTACC
Y266A GCCACGCCGCCCTCGACT
D268A CGCCTACCTCGCCTCGAACGAAG
T. r
oseo
pers
icin
a
H237A GATCCGGCGGAACGCGCAGTCTGGTGG
W239A CGCCATGTCGCGTGGCCGATC
H262A GCTGGAGCGGCGCTGGCTAT
D266A CATGGCTATCTCGCCTCAAA
S58V GCGTCCGTCGTCGCGCAGCA
S58Q GCGTCCCAGGTCGCGCAGCA
3.2.3.2 N-terminally truncated Rg- and TrCrtC’s Rg- and TrCrtC lacking the first 45 and 57 amino acids, respectively, were constructed
using primers Rg_45aa (Table 3.3)/Rg_rv [7] and Tr_57 (Table 3.3)/Tr_rv [7] under
standard PCR conditions. Plasmids pET15b_CrtCRg and pET15b_CrtCTr [7], respectively,
were used as template. Subsequent steps were performed as described in the section
“Cloning of carotenoid 1,2-hydratase genes”. The insertion of the crtC gene was verified
by restriction analysis with the corresponding restriction enzymes (New England Biolabs)
and DNA sequencing (BaseClear).
Table 3.3 Primers used for construction of truncated CrtC’s. The NdeI restriction sites are underlined.
Name Sequence (5'→3')
Rg_45aa AGTACCATATGGGCGACGCACGGCTGG
Tr_57aa AGTACCATATGTCCGTCGCGCAGCAAGG
3.2.4 Recombinant expression of CrtC’s E.coli BL21 (DE3) was the host for the pET15_CrtC plasmids. Cultures were grown at
37°C in Luria–Bertani broth with 100 μg ml−1 ampicillin until an OD600 value of 0.6–0.8
was reached. Unless otherwise stated, protein expression was induced by addition of
isopropyl-β-D-thiogalactopyranoside (IPTG) to a final concentration of 0.1 mM, followed
Structural Characterization of the Carotenoid 1,2-Hydratases (CrtC) from Rubrivivax gelatinosus and Thiocapsa roseopersicina
66
by cultivation at 25°C overnight. The cells were harvested by centrifugation at 10.000 rpm
for 10 min at 4°C (Sorvall), washed once with 50 mM Na2HPO4 buffer (pH 8.0), and
suspended in the same buffer. In case of subsequent purification, 10 mM imidazole was
added to the buffer. Crude extract (CE) from cultures >100 ml was prepared by adding 1
mg ml−1 lysozyme and incubating the cells for 1 h at 4°C, followed by cell disruption at the
pressure of 1.5 kBar (Constant systems, IUL instruments). For cultures <100 ml, the cells
were disrupted by sonication for 2 min while immersed in an ice-water bath using the
microtip probe of a sonicator (Branson Sonicator Cell Disruptor) set at 50% maximal
energy. In an effort to reduce the liquid viscosity caused by DNA molecules, 0.1 mg ml-1
of DNAse was added. With the subsequent centrifugation at 10.000 rpm for 20 min at 4°C,
cell-free extract (CFE) and pellet were separated. Protein content of the crude extract was
determined by BCA assay (Pierce) with bovine serum albumin as the reference protein.
3.2.5 CrtC purification Rg- and TrCrtC ‘active site’ point mutants were purified from the membrane fraction, while
the Tr ‘processing’ mutants (S58V, S58Q) were purified from the CFE. The membrane
fraction was obtained after the centrifugation of the CFE for 4 h at 13.200 rpm and 8°C.
Prior to the addition of Ni-NTA HisTrap HP (GE Healthcare) (previously equilibrated in
50 mM Na2HPO4 buffer, pH 8.0, with 300 mM NaCl and 10 mM imidazole), to the CFE
or membrane sample, the membranes were homogenized by ca. 20 passages through a 25G
needle. The mixtures were incubated for 1 h at RT, loaded into a polypropylene tube with
porous disc (GE Healthcare) and washed 3 times with washing buffer (50 mM Na2HPO4
buffer, pH 8.0, with 300 mM NaCl and 75 mM imidazole). Then, the CrtC protein was
eluted from the column with elution buffer containing 1 M imidazole (50 mM Na2HPO4
buffer, pH 8.0, with 300 mM NaCl). Enzyme fractions were separated by SDS-PAGE (10%
Bis-Tris, BioRad) and visualized by staining with SimplyBlue SafeStain (Invitrogen).
3.2.6 Determination of enzyme activity Enzymatic activities were determined with CE on lycopene and geranylgeraniol (GGOH)
according to the method described earlier [7], with few modifications. The assay was
carried out with 50 μl CE and 20 μM substrate, and 10 mg ml−1 L-α-phosphatidylcholine
in the case of lycopene, in a reaction volume of 200 μl. In addition to the GC-MS method,
the GGOH reaction products were also analyzed with a newly developed HPLC method.
Prior to the analysis, acetonitrile was added to the reaction mixture in a ratio of 60:40
3.3 Results and discussion
67
(ACN:H2O), the mixtures were shaken vigorously for 1 min and solids removed by
centrifugation for 1 min at 13.200 rpm. Separation of the reaction products was performed
with a Merck 4.6× 50 mm Chromolith TM SpeedROD RP-18e 2 μm column with
ACN/H2O (60:40, v/v) as the eluent. GGOH and the corresponding products were detected
at 214 nm (SPD-20A, Shimadzu).
3.3 Results and discussion
3.3.1 Comparative in silico analysis of crtC genes The RgcrtC nucleotide sequence was subjected to a BLAST search in order to identify
sequence similarity in different databases. 184 hits were identified, of which 111 were
representatives of Proteobacteria. Although, R. gelatinosus belongs to the
Betaproteobacteria, more than 77% of the identified 111 hits were from
Alphaproteobacteria and only 11% from Betaproteobacteria. Similarly, Igarashi et al. [28]
observed that most of the photosynthesis gene products from R. gelatinosus showed high
sequence identities to the gene products of R. palustris, an Alphaproteobacteria member.
They explain this occurrence as a result of horizontal transfer of the photosynthesis gene
clusters from an ancestral species belonging to the Alphaproteobacteria to that of the
Betaproteobacteria.
The selection of RgCrtC homologues for this study was based on sequence identity and
availability of the corresponding gene construct. They originate from all three
Proteobacteria subclasses (Alpha, Beta, Gamma) with two additional constructs originating
from metagenomic samples from the Delaware River (USA). Figure 3.1 displays a
phylogenetic analysis constructed with protein sequences of the selected CrtC homologues.
TrCrtC shows the closest relationship to RgCrtC, followed by BrCrtC (55% and 47%
sequence identity, respectively). The combined results of Pfam- and Conserved Domain
Search showed that all 7 CrtC’s belong to the PF07143 family consisting of several purple
photosynthetic bacterial hydroxyneurosporene synthase (CrtC) proteins.
Structural Characterization of the Carotenoid 1,2-Hydratases (CrtC) from Rubrivivax gelatinosus and Thiocapsa roseopersicina
68
Figure 3.1 Rooted phylogenetic tree showing the evolutionary relationship between the selected carotenoid
1,2-hydratases. TrCrtC, Thiocapsa roseopersicina (GI 31621263), BrCrtC, Bradyrhizobium sp. BTAi1 (GI
146403799), F06CrtC, uncultured Proteobacterium DelRiverFos06H03 (GI 61653228), F13CrtC, uncultured
Proteobacterium DelRiverFos13D03 (GI 61653190), RpCrtC, Rhodopseudomonas palustris (GI
115515977), RrCrtC, Rhodospirillum rubrum (GI 83574254) and RgCrtC, Rubrivivax gelatinosus (GI
29893477).
CrtC sequences were aligned in order to investigate if there are any conserved group-
clusters present (Figure 3.2). Indeed, they showed highly conserved regions of in total 64
amino acids. The conserved amino acids are distributed along the sequence ranging from
amino acid residues ~115 to ~405. Interestingly, the N-terminal part of the sequence does
not contain any conserved amino acids, indicating that this region is probably not necessary
for CrtC activity. This could also be the explanation for the absence and the shorter DNA
sequences for Fos06, Fos13 and partly RpCrtC, when compared to RgCrtC or TrCrtC. In
addition, we found little amino acid variety in 50 positions, as indicated within the boxes
in Figure 3.2.
Residues involved in the catalysis tend to be highly conserved in a set of homologous
proteins that exhibit the same reaction. On the other hand, sequence insertion and sections
of low sequence similarity tend to occur in the less important loop regions [29]. The
recognition of conserved blocks in CrtC homologues led to the obvious hypothesis that
these regions contain the amino acid residues most important for the hydratase activity,
specifically those involved in catalysis and substrate binding.
3.3 Results and discussion
69
Figure 3.2 Multiple sequence alignment showing conserved amino acids of the CrtC protein sequences from
various bacteria. Identical amino acids are highlighted in black. Positions with only two different amino acids
are surrounded by boxes.
The 3D structure of TrCrtC was built by homology modeling based on the only known 3D
structure, which showed some sequence identity (17%) to the CrtC (Figure 3.3). The
homologue is the putative AttH protein from Nitrosomonas europaea [11]. It belongs to a
protein family of unknown function (DUF2006), which has remote similarity to the family
PF07143 encompassing carotenoid 1,2-hydratases. The topology of the CrtC structure
shows similarity to lipocalins, proteins that bind and transport small hydrophobic molecules
[30]. Lipocalin fold is typically formed by a large, twisted beta-sheet that closes in the back
to form a central, internal, ligand-binding cavity. This folding motif is frequently found in
porins, transmembrane proteins or in general in proteins that bind hydrophobic
ligands/substrates [31]. Depending on the protein and the corresponding function, the
bound ligand will be entirely within the cavity or part of the ligand will protrude from the
cavity at the surface of the protein.
Structural Characterization of the Carotenoid 1,2-Hydratases (CrtC) from Rubrivivax gelatinosus and Thiocapsa roseopersicina
70
Figure 3.3 A homology model of CrtC from Thiocapsa roseopersicina based on the crystal structure of a
putative AttH (PDB id: 2ICH) from Nitrosomonas europaea. The ribbon diagrams depict front (left-hand
side) and back (right-hand side) view of CrtC. The structure is color-coded from the N-terminus (blue) to the
C-terminus (red).
In order to investigate if there is any relationship between the conserved regions and
specific locations in the homology model of CrtC, the conserved residues were visualized
(Figure 3.4). Six striking sequence motifs were selected (I – VI) and the results show that,
indeed, most of the conserved residues are located either at the bottom or upper part of the
cavity, with one motif (III) located outside the cavity. This order is very interesting and
might indicate regions in the CrtC structure, which are involved in the binding of the
substrates, while the other might contain amino acids that are directly involved in the
catalytic reaction. From a catalytic point of view, amino acids located in regions IV and V,
i.e. aspartic acid (D), tyrosine (Y) and histidine (H), are most probably involved in the
catalytic hydration, as these amino acids are commonly involved as active residues in acid-
base type catalyzed reactions in the active sites of enzymes (Figure 3.5) [32]. Furthermore,
they are all in close distance to each other, which is important for the contact with the
substrate. It would thus be interesting to analyze these positions by mutagenesis, in order
to confirm their involvement in the catalytic process of CrtC’s.
3.3 Results and discussion
71
RgCrtC …............SDDG…….GSVFSP.Y……...........GPS........H.W..........H.Y.D.........................PFY
TrCrtC …............SDDG…….GSVFSP.Y……...........GPS........H.W..........H.Y.D.........................PFY
BrCrtC …............SDDG…….GSVFSP.Y……...........GPS........H.W..........D.Y.D.........................PFY
RrCrtC …............SDDG…….GSVFSP.Y……...........GPS........H.W..........H.Y.D.........................PFY
RpCrtC …............SDDG…….GSVFSP.Y……...........GPS........H.W..........H.Y.D.........................PFY
Fos13CrtC.............SDDG…….GSVFSP.Y……...........GPS........H.W..........H.Y.D.........................PFY
Fos06CrtC.............SDDG…….GSVFSP.Y……...........GPS........H.W..........H.Y.D.........................PFY
Figure 3.4 CrtC conserved residues. Ribbon diagram of TrCrtC with marked regions that contain highly
conserved amino acid residues. The sequence motifs, which correspond to those regions, are shown in boxes
(I – VI). N and C indicate N-and C-terminus, respectively.
I II III IV V IV VI
I
II
III
V
IV
VI
N
C
Structural Characterization of the Carotenoid 1,2-Hydratases (CrtC) from Rubrivivax gelatinosus and Thiocapsa roseopersicina
72
Figure 3.5 View of the potential active site of TrCrtC. The conserved residues H237 (yellow), W239 (red),
Y264 (blue) and D266 (green) are show as sticks, with hydrogen bond as yellow dots (region IV).
3.3.2 Production of recombinant wildtype and mutant CrtC’s and enzymatic activity
6 out of the 7 selected CrtC’s were overexpressed from pET15b in E. coli (Figure 3.6).
Bands with apparent molecular weight of 32 kDa (Fos13CrtC), 38 kDa (RpCrtC) and 44
kDa (Rr-, Br-, Tr- and RgCrtC) were visualized on SDS-PAGE and were consistent with
the values calculated from the deduced amino acid sequences. TrCrtC is expressed as 44-
and 38 kDa protein [7].
Figure 3.6 SDS-PAGE (10%) analysis of CrtC expression in E. coli BL21. M, Precision plus protein standard.
First lane (a) of each sample shows cells before induction with 0.6 mM IPTG and the second lane (b) shows
cells after 4 h expression at 37°C. 1, pET15-b control; 2, Fos06CrtC (32 kDa); 3, Fos13CrtC (32 kDa); 4,
RpCrtC (38 kDa); 5, RrCrtC (44 kDa); 6, BrCrtC (44 kDa); 7, TrCrtC (44 kDa); 8, RgCrtC (44 kDa). The
indicated molecular weights are deduced from amino acid sequences. CrtC expression bands are indicated by
arrows.
M 1a 1b 2a 2b 3a 3b 4a 4b 5a 5b 6a 6b 7a 7b 8a 8b M
50
37
25
3.3 Results and discussion
73
No expression band could be identified for Fos06CrtC. Although, relatively good
expression was achieved for most of the CrtC’s, only two were active with lycopene as
substrate (data not shown). The fact that all CrtC’s share highly conserved regions in the
amino acid sequence (Figure 3.2) indicates that they are performing the same or similar
biochemistry. However, no activity whatsoever could be detected for 5 CrtC’s in the
standard lycopene hydration assay. At this point it is unclear whether this is due to reasons
of low activity in the cell-extract and/or substrate specificity.
In our previous study, the two active CrtC’s from R. gelatinosus and T. roseopersicina were
biochemically characterized and we showed that both CrtC’s have the ability to convert
acyclic carotenoid lycopene into hydroxyl derivatives [7]. Furthermore, we reported on the
activity of both CrtC’s with the substrate geranylgeraniol, a C20 acyclic alkene molecule
containing a hydroxyl group at one end and -group (acyclic C9 end group according to
nomenclature of carotenoids) at the other end of the chain [7]. Unfortunately, the product
could not be identified due to low yields.
In order to get more insight into the hydration mechanism of CrtC’s, selected amino acid
residues in regions IV and V (Figure 3.4) were substituted by the amino acid alanine. The
selection was based on the fact that amino acids such as aspartic acid and histidine occur
more frequently in enzyme active sites than others [32]. In addition, truncated (Tr- and
RgCrtC) and N-terminal point mutants (TrCrtC) were constructed and analyzed. In our
previous study we have shortly discussed the preliminary results on the importance of the
N-terminal part of CrtC for the catalytic activity. The activity of the truncated versions was
fully retained, thus indicating that this part of the enzyme is not essential for activity [7].
Furthermore, the observed cleavage of TrCrtC also supports this hypothesis. Despite the
still unknown reason for this occurrence, we were able to identify the cleavage site between
S57 and S58 by using MS analysis [7]. In order to exclude any protease background activity
from the expression host E. coli, the S58 position was modified by substitution with valine
(same size, different chemical features) and glutamine (different size, same chemical
features). All mutants (Table 3.2, 3.3) were successfully cloned and expressed in E. coli
BL21 (Figure 3.7A). However, clear difference in expression levels was observed.
Therefore, all mutants were purified from the membrane fraction in order to ensure that
CrtC was present in the cells. As can be seen in Figure 3.7B, all mutants could be purified
and showed a band at 38- or 44 kDa, which was absent in the control sample (pET15b).
The introduction of mutations and modification of the protein lengths clearly has an effect
Structural Characterization of the Carotenoid 1,2-Hydratases (CrtC) from Rubrivivax gelatinosus and Thiocapsa roseopersicina
74
on the expression. While the removal of the N-terminus resulted in an increased expression
level, all point mutations negatively influenced the expression of the protein. In the case of
the wild type TrCrtC, the purification usually has to be performed as soon as it is expressed,
preferably before the cleavage of the N-terminal part (including the His-Tag). This was not
the case here and therefore only a very weak protein band is detected after the purification.
It should be noted here that the truncated version of TrCrtC shows a larger molecular weight
(Figure 3.7, lane 9) compared to the ‘cleaved’ versions (Figure 3.7, lanes 10-15), which is
due to the chosen primer position and the attached His-Tag.
Figure 3.7 SDS-PAGE (10%) analysis of expression (A) and IMAC purification from membrane (B) of
CrtC’s from R. gelatinosus (RgCrtC) (lane 1-7) and T. roseopersicina (TrCrtC) (lane 8-15) wildtype and
mutants. M, Precision plus protein standard. C, pET15b control. (A) First lane of each sample shows cells
before induction with 0.1 mM IPTG and the second lane shows cells after overnight expression at 25°C. 1,
RgCrtC wildtype; 2, RgCrtC truncated; 3, RgCrtC H239A; 4, RgCrtC W241A; 5, RgCrtC H264A; 6, RgCrtC
Y266A; 7, RgCrtC D268A; 8, TrCrtC wildtype; 9, TrCrtC truncated; 10, TrCrtC S58V; 11, TrCrtC S58Q;
12, TrCrtC H237A; 13, TrCrtC W239A; 14, TrCrtC H262A; 15, TrCrtC D266A.
With regard to the N-terminal point mutations, it seems that the cleavage rate increased in
the order of wildtype < S58V < S58Q. This conclusion is based on the fact that in the
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 C M
M 8 9 10 11 12 13 14 15 M
50
37
37
50
M 1 2 3 4 5 6 7 C M
(A)
(B)
3.3 Results and discussion
75
wildtype sample in Figure 3.7A mainly the 44 kDa band is visible (lane 8). In the S58V
mutant about the same amount of both, the 38- as well as the 44 kDa bands could be
detected (lane 10), while in the S58Q mutant mainly the 38kDa band could be identified
(lane 11). Nevertheless, additional experiments are needed to get more insight into this
phenomenon. For example, by expressing larger amounts of the corresponding proteins,
and by purifying them, one could follow the change of the protein size in time. With the
wildtype TrCrtC, we have already shown that even though the purified enzyme consisted
of both sizes proteins, after few days of storage, the 44 kDa could not be detected anymore
(data not shown).
Next to the analysis of the expression levels, the activities of all constructed mutants were
measured with lycopene as substrate (Figure 3.8).
Figure 3.8 Enzymatic activity of wildtype (wt) and mutant CrtC from R. gelatinosus (A) and T.
roseopersicina (B). Extracts from E.coli cells expressing the respective enzymes were assayed with 20 μM
lycopene in 50 mM Na2HPO4 sodium phosphate (pH 8.0) at 28ºC overnight. Trunc, variants with missing N-
terminal residues 1-45 (RgCrtC) and 1-57 (TrCrtC).
As the expression levels were very low for some of the mutants and the activity of CrtC in
general is very low, crude extracts were used for the activity assay. Consequently, the
results cannot be quantitatively compared. However, in combination with the expression
wt trunc H239A W241A H264A Y266A D268A0
1
2
3
4
wt trunc S58V S58Q H237A W239A H262A D266A0
1
2
3
4
Enz
yme
acti
vity
[nm
ol m
g-1]
(A)
(B)
Structural Characterization of the Carotenoid 1,2-Hydratases (CrtC) from Rubrivivax gelatinosus and Thiocapsa roseopersicina
76
levels as shown in Figure 3.7A, indicative conclusions can be drawn. As stated in our
previous study the N-terminus is not important for catalytic activity [7]. This again was
proven here, as the truncated Rg- as well as TrCrtC were active. Furthermore, the
introduction of N-terminal point mutations did not affect the activity of TrCrtC, although
it did affect the cleavage rate of the N-terminal part. This might be explained by the fact
that the substitution of an amino acid by a smaller or chemically different amino acid could
result in conformational changes which promote or prevent the processing activity, either
by host proteases or through self-cleavage.
On the other hand, it appears that four key residues were identified, which have a potentially
important role in the hydration mechanism. By replacing each of the amino acids H239,
W241, Y266 and D268 individually by an alanine in RgCrtC the activity is completely
destroyed. The same mutations of the corresponding amino acids in TrCrtC, i.e. H237,
W239 and D266, also resulted in CrtC inactivation. Unfortunately, the mutagenesis of
Y264 in TrCrtC was not successful, and therefore, could not be included in this study.
However, based on all the results, one could expect that the mutation of Y264 in TrCrtC
would lead to inactivation, as has been seen for RgCrtC. On the other hand, the less
conserved H264 in RgCrtC and the corresponding histidine residue in TrCrtC (H262), seem
not to have any functional role. The mutants fully retained activity, and even showed
slightly increased activity when the expression levels were considered. For instance, the
truncated TrCrtC and H262A mutant showed almost the same level of expression (Figure
3.7A, lanes 9 and 14) but the activity of H262A mutant was ~ 1.3-fold higher (Figure 3.8B).
The same was observed for RgCrtC, where the expression of the wildtype is much more
than that of the mutant H264A, but both showed approximately the same activity.
All created mutants were also tested for the activity towards geranylgeraniol. In Figure 3.9,
representative HPLC results are depicted. We could confirm activity for mutants that were
still catalytically active for lycopene. The formation of the product was followed for two
days and an increase was observed, which indicates the activity of CrtC (Table 3.4). In
addition, when twice the amount of CrtC was used, the relative amount of the product also
increased 2-fold (data not shown). As described in chapter 2, it was not possible to isolate
the obtained product in amounts which are necessary for further analysis. However, from
the HPLC results we can conclude that the formed product is more hydrophilic than the
substrate itself, as it eluted earlier from the reversed phase C-18 column. If our assumption,
that CrtC recognizes only a specific part, i.e. -end group, in the carotenoid substrate
3.3 Results and discussion
77
molecule is correct, then one can imagine that CrtC would be able to hydrate the terminal
double bond of geranylgeraniol.
Figure 3.9 HPLC separation of diterpene alcohols formed in vitro by E.coli extract expressing the RgCrtC
(solid line) compared with the blank reaction (dotted line) and the pET15b-plasmid (dashed line). Crude
extracts were assayed with 20 μM geranylgeraniol in 50 mM Na2HPO4 sodium phosphate (pH 8.0) at 30°C
and 800 rpm. Peak 1, reaction product; Peak 2, geranylgeraniol.
In order to investigate how the newly identified key residues could be involved in the
catalytic hydration reaction, the modeled structure of CrtC (Figure 3.4) was re-analyzed.
We have assumed earlier that regions IV and V might contain potentially important
residues, and indeed, it appears that our assumption is correct with regard to region IV. The
identified key residues H239, W241, Y266 and D268 in RgCrtC and the corresponding
residues in TrCrtC are all in close distance to each other (Figure 3.5). These four residues,
which are conserved throughout the CrtC family, are also found in the active site of
squalene-hopene cyclase (SHC) [14]. SHC catalyzes the cyclization reaction of squalene
to hopene as a major product (Figure 3.10). Hopanol is also formed to a minor extent. The
proposed mechanism for cyclases is proton-triggerd polycyclization, whereby the
intermediate carbocation is stabilized by aromatic amino acids.
0 1 2 3 4 5 6 7 8 9 10
100000
200000
300000
400000
500000
600000
Inte
nsity
[m
V]
Time [min]
blank pET15b RgCrtC
1
2
Structural Characterization of the Carotenoid 1,2-Hydratases (CrtC) from Rubrivivax gelatinosus and Thiocapsa roseopersicina
78
Table 3.4 Relative amount of the reaction product obtained from the substrate geranylgeraniol. Reactions
were performed with Escherichia coli crude extracts expressing R. gelatinosus and T. roseopersicina CrtC
wildtype and mutants, respectively. The areas under the substrate (1) and the product (2) peaks (Figure 3.9)
were set as 100% and were used as the measure of the relative activity. N.d. not detected.
Next to the stabilization role of the aromatic amino acids, they also create hydrophobic
environment in order to prevent quenching of the cation by water. The cyclization cascade
is terminated by a well-positioned enzymatic base. The formation of the side alcohol
product suggests significant water accessibility at the termination region of the active site.
Sample Reaction product (%)
after 1 day after 2 days
RgCrtC wt 0.37 1.00
RgCrtC trunc 0.47 0.82
RgCrtC H239A <0.05 <0.05
RgCrtC W241A <0.05 <0.05
RgCrtC H264A 0.08 0.11
RgCrtC Y266A <0.05 <0.05
RgCrtC D268A <0.05 <0.05
TrCrtC wt 0.06 0.09
TrCrtC trunc 0.14 0.44
TrCrtC S58V 0.14 0.29
TrCrtC S58Q 0.15 0.21
TrCrtC H237A <0.05 <0.05
TrCrtC W239A <0.05 <0.05
TrCrtC H262A 0.16 0.25
TrCrtC D266A <0.05 <0.05
3.3 Results and discussion
79
Figure 3.10 Enzyme catalyzed cyclisation of squalene to hopene and hopanol.
The acidic residue aspartate (D376), which is located in the center of the active site in SHC,
is the likely general acid responsible for protonating the C3 atom of the squalene substrate
[14]. The acidity of D376 is enhanced by a connection to the side chain of Y495 through a
water molecule. Because of the similarity of the initial protonation reactions of squalene
and lycopene, we assume that the residues involved in catalysis will be alike in SHC and
CrtC. This hypothesis is in agreement with our results obtained by mutagenesis study as
well as the structure-based analysis. Therefore, we propose the following mechanism for
CrtC. D268 is the catalytic acid that initiates the hydration of lycopene (Figure 3.11).
Figure 3.11 Proposed mechanism for the initial protonation during lycopene hydration.
Structural Characterization of the Carotenoid 1,2-Hydratases (CrtC) from Rubrivivax gelatinosus and Thiocapsa roseopersicina
80
Upon diffusion of lycopene into the active site, it is required that the C2 atom of the
substrate is positioned near the proton of D268 that putatively will be added to the substrate.
In order to enhance the acidity of the catalytic D268 for olefin protonation, the amino acid
is directly bonded to H239 and to Y266 through an ordered water molecule, similar to what
has been proposed for SHC [14]. Mutation of one of these three amino acids leads to
inactivation of enzymatic activity, thereby supporting our hypothesis that they are all
directly involved in the hydration reaction of lycopene. In contrast to SHC, where
premature quenching of the cationic intermediate by water or nucleophiles is prevented by
well positioned aromatic amino acids, a water molecule is added to lycopene to yield the
desired hydroxylated lycopene derivative. This suggests that the active site of CrtC has
more water molecules present, so that the interaction between the substrate and solvent
water molecules is more significant. The aromatic amino acid Trp266 may be involved in
the stabilization of the intermediate carbocation.
Interestingly, according to the model, the residues H264 (Rg) and H262 (Tr), respectively,
which seem not to have any functional property, are located away (region V) from the
potential active site residues. This observation further supports our hypothesis that the
region IV is the active site of CrtC. On the other hand, the three conserved hydrophobic
residues proline, phenylalanine and tyrosine in region VI might play the role of attracting
the hydrophobic substrate and placing it in the right position. The mainly hydrophobic
amino acids in region II, which are located close to potential active side residues in region
IV, might play a role in stabilization of the substrate during catalytic activity.
3.4 Conclusion
The main purpose of this study was to investigate whether it is possible to get more
understanding of the hydration mechanism of carotenoid 1,2-hydratases. The used
approach was modeling of the 3D structure with the closest homologous protein with
known 3D structure, and subsequently the generation of point mutants of potentially
important amino acid residues. Overall results indicate that the 3D structure consist of a
beta-barrel, which closes with itself to form a central cavity. The substrate binding site,
which consists mainly of hydrophobic amino acid residues, is located at the top of the
cavity, while at the bottom inside the cavity potentially catalytic residues H, D, Y and W
3.5 Acknowledgements
81
are located. The absence of activity upon individual substitution of these residues by an
alanine supports their roles in the initial protonation. Although, the model with only 17%
sequence identity to the template is not very reliable, it fits to the data obtained on the
activities of the mutants, reassuring that the model is probably correct.
From our findings it becomes clear that the complete structure of the enzymes, through
crystallization studies, will be pivotal to further unravel the mechanism for this intriguing
enzyme. Nevertheless, the results of this study shed for the first time light on structure-
activity relationships and opens the field for the engineering of carotenoid 1,2-hydratase to
generate industrially relevant mutants.
3.5 Acknowledgements
We thank Prof. Dr. Jaap Jongejan for advice on the potentially important residues in
carotenoid 1,2-hydratases and Jan van Leeuwen for making the CrtC model.
Structural Characterization of the Carotenoid 1,2-Hydratases (CrtC) from Rubrivivax gelatinosus and Thiocapsa roseopersicina
82
3.6 References
[1] G. A. Armstrong and J. E. Hearst, "Carotenoids .2. Genetics and molecular biology of carotenoid
pigment biosynthesis," Faseb Journal, vol. 10, pp. 228-237, Feb 1996.
[2] S. L. Jensen, et al., "Biosynthesis of carotenoids in purple bacteria : A re-evaluation based on
considerations of chemical structure," Nature, vol. 192, pp. 1168-1172, 1961.
[3] C. I. Cazzonelli, "Carotenoids in nature: insights from plants and beyond," Functional Plant Biology,
vol. 38, pp. 833-847, 2011.
[4] G. A. Armstrong, "Genetics of eubacterial carotenoid biosynthesis: A colorful tale," Annual Review
of Microbiology, vol. 51, pp. 629-659, 1997.
[5] D. Umeno, et al., "Diversifying carotenoid biosynthetic pathways by directed evolution,"
Microbiology and Molecular Biology Reviews, vol. 69, pp. 51-78, Mar 2005.
[6] Z. T. Sun, et al., "A novel carotenoid 1,2-hydratase (CruF) from two species of the non-
photosynthetic bacterium Deinococcus," Microbiology-Sgm, vol. 155, pp. 2775-2783, Aug 2009.
[7] A. Hiseni, et al., "Biochemical characterization of the carotenoid 1,2-hydratases (CrtC) from
Rubrivivax gelatinosus and Thiocapsa roseopersicina," Applied Microbiology and Biotechnology,
vol. 91, pp. 1029-1036, 2011.
[8] R. Kourist, et al., "Enzymatic synthesis of optically active tertiary alcohols: Expanding the
biocatalysis toolbox," Chembiochem, vol. 9, pp. 491-498, Mar 3 2008.
[9] J. F. Jin and U. Hanefeld, "The selective addition of water to C=C bonds; enzymes are the best
chemists," Chemical Communications, vol. 47, pp. 2502-2510, 2011.
[10] C. M. Evans and A. J. Kirby, "A model for olefin hydration: Intramolecular nucleophilic addition of
phenolate oxygen to the unactivated double bond," Journal of the Chemical Society, Perkin
Transactions 2, pp. 1259-1267, 1984.
[11] H. J. Chiu, et al., "Structure of the first representative of Pfam family PF09410 (DUF2006) reveals
a structural signature of the calycin superfamily that suggests a role in lipid metabolism," Acta
Crystallographica Section F: Structural Biology and Crystallization Communications, vol. 66, pp.
1153-1159, 2010.
[12] N. J. Patel, et al., "Use of deuterium labelling from deuterium oxide to demonstrate carotenoid
transformations in photosynthetic bacteria," BBA - General Subjects, vol. 760, pp. 92-96, 1983.
[13] A. A. Yeliseev and S. Kaplan, "Anaerobic carotenoid biosynthesis in Rhodobacter sphaeroides
2.4.1: H2O is a source of oxygen for the 1-methoxy group of spheroidene but not for the 2-oxo group
of spheroidenone," Febs Letters, vol. 403, pp. 10-14, 1997.
[14] K. U. Wendt, et al., "Enzyme Mechanisms for Polycyclic Triterpene Formation," Angewandte
Chemie International Edition, vol. 39, pp. 2812-2833, 2000.
[15] S. C. Hammer, et al., "Squalene hopene cyclases: highly promiscuous and evolvable catalysts for
stereoselective CC and CX bond formation," Current Opinion in Chemical Biology, vol. 17, pp. 293-
300, 2013.
3.6 References
83
[16] S. F. Altschul, et al., "Basic Local Alignment Search Tool," Journal of Molecular Biology, vol. 215,
pp. 403-410, Oct 5 1990.
[17] A. Marchler-Bauer, et al., "CDD: A Conserved Domain Database for the functional annotation of
proteins," Nucleic Acids Research, vol. 39, pp. D225-D229, 2011.
[18] R. D. Finn, et al., "The Pfam protein families database," Nucleic Acids Research, vol. 38, pp. D211-
D222, January 1, 2010 2010.
[19] A. Dereeper, et al., "Phylogeny.fr: robust phylogenetic analysis for the non-specialist," Nucleic
Acids Research, vol. 36, pp. W465-469, 2008.
[20] A. Dereeper, et al., "BLAST-EXPLORER helps you building datasets for phylogenetic analysis,"
BMC Evolutionary Biology, vol. 10, 2010.
[21] A. A. Porollo, et al., "POLYVIEW: A flexible visualization tool for structural and functional
annotations of proteins," Bioinformatics, vol. 20, pp. 2460-2462, 2004.
[22] K. Arnold, et al., "The SWISS-MODEL workspace: A web-based environment for protein structure
homology modelling," Bioinformatics, vol. 22, pp. 195-201, 2006.
[23] L. A. Waidner and D. L. Kirchman, "Aerobic anoxygenic photosynthesis genes and operons in
uncultured bacteria in the Delaware River," Environmental Microbiology, vol. 7, pp. 1896-1908,
Dec 2005.
[24] E. Giraud, et al., "Two distinct crt gene clusters for two different functional classes of carotenoid in
Bradyrhizobium," Journal of Biological Chemistry, vol. 279, pp. 15076-15083, Apr 9 2004.
[25] M. Kammann, et al., "Rapid insertional mutagenesis of DNA by polymerase chain reaction (PCR),"
Nucleic Acids Research, vol. 17, p. 5404, 1989.
[26] G. Sarkar and S. S. Sommer, "The 'megaprimer' method of site-directed mutagenesis,"
BioTechniques, vol. 8, pp. 404-407, 1990.
[27] O. Landt, et al., "A general method for rapid site-directed mutagenesis using the polymerase chain
reaction," Gene, vol. 96, pp. 125-128, 1990.
[28] N. Igarashi, et al., "Horizontal transfer of the photosynthesis gene cluster and operon rearrangement
in purple bacteria," Journal of Molecular Evolution, vol. 52, pp. 333-341, Apr 2001.
[29] M. J. Zvelebil, et al., "Prediction of protein secondary structure and active sites using the alignment
of homologous sequences," Journal of Molecular Biology, vol. 195, pp. 957-961, 1987.
[30] D. R. Flower, "The lipocalin protein family: Structure and function," Biochemical Journal, vol. 318,
pp. 1-14, 1996.
[31] J. M. LaLonde, et al., "The up-and-down beta-barrel proteins," The FASEB Journal, vol. 8, pp. 1240-
7, December 1, 1994 1994.
[32] G. J. Bartlett, et al., "Analysis of catalytic residues in enzyme active sites," Journal of Molecular
Biology, vol. 324, pp. 105-121, 2002.
Chapter 4
4 Oleate hydratase as model enzyme to design and evaluate high-throughput screening assay for alcohol detection
Aida Hiseni, Rosario Medici, Isabel W.C.E. Arends, Linda G. Otten
Biotechnol. J. Feb 2014; DOI: 10.1002/biot.201300412
Oleate hydratase as model enzyme to design and evaluate high-throughput screening assay for alcohol detection
86
Abstract
A novel high-throughput screening assay for the detection of alcohols is developed by using
oleate hydratase (OHase) from Elizabethkingia meningoseptica as the model enzyme. It
allows for screening of mutant libraries generated by directed evolution techniques or other
mutagenesis methods. The assay is based on the reaction between the alcohol and nitrous
acid to form the corresponding alkyl nitrite and is valid for a broad range of alcohols,
differing in size and solubility. Cyclic as well as acyclic unsaturated alkenes (substrates)
and the corresponding alcohols (products) were tested and they showed sufficient
discrimination for analysis. Lower detection limits were 1.5 to 3 mM with excellent Z-
factors ranging from 0.70 – 0.91. Precision, linearity and plate uniformity were estimated
with pure substrates, mixtures and enzymatic reactions.
4.1 Introduction
87
4.1 Introduction
Oleate hydratase (OHase) (EC 4.2.1.53) belongs to the group of hydro-lyase enzymes (EC
4.2.1), which cofactor independently catalyze the reversible addition of a water molecule
to a substrate possessing a carbon-carbon double bond [1]. The 73 kDa OHase from
Elizabethkingia meningoseptica has been characterized with respect to its biochemical
properties [2] and has recently been immobilized as CLEA (cross-linked enzyme
aggregate) [3]. The enzyme shows high amino acid sequence similarities with members of
the Streptococcal 67 kDa myosin-cross-reactive antigen like family [4, 5]. A few group
members of this family were shown to also exhibit fatty acid hydratase activity [5-7].
Knowledge of the hydratase could be of great importance for the industry, as the reaction
product 10-hydroxystearic acid (10-HSA) is a high-added-value compound and can be used
for the production of a large number of industrial products including resins, waxes, nylons,
plastics, cosmetics and coatings [3]. Compared to the traditional acid-catalyzed water
addition, the enzymatic reaction proceeds under very mild conditions and is stereo- and
regioselective. Recently, attempts have been made to increase microbial 10-HSA
production by using recombinantly expressed oleate hydratase from Stenotrophomonas
maltophilia [6, 8].
In industrial biocatalytic processes, hydro-lyases are underrepresented and only a few
group members are amenable to be used for industrial scale reactions, including nitrile
hydratase for the production of acrylamide [9] and fumarase to produce malate [10] . This
is mainly due to the low stability and/or catalytic activity of these enzymes. However,
utilization of this class of enzymes as biocatalysts needs intensive study and optimization
of enzyme properties, such as stability, specific activity and selectivity, beforehand.
A powerful tool to address these issues is directed evolution, which has been used in the
past decade to improve biocatalysts [11-14]. An advantage of this technique is that no need
for knowledge about the structure-function relationship is required. Moreover, a large
number of mutants with potentially improved and/or novel properties can be produced in a
short time. However, a crucial step in any directed evolution experiment is the development
of a high-throughput screening (HTS) assay, which allows rapid screening of a large
number of variants within a reasonable timeframe [15]. In general, the assay has to be
sensitive, easy to perform, robust and has to have high throughput.
Oleate hydratase as model enzyme to design and evaluate high-throughput screening assay for alcohol detection
88
So far, the quantification of enzymatic activity of OHase has usually been determined by
either GC [2, 5-8] or HPLC [3, 16]. The methods are based on derivatization of fatty acids
and are straightforward and accurate. Nevertheless, they are not suitable for high-
throughput screening.
Therefore, we have developed a spectrophotometric high-throughput screening method for
the detection of alcohols. The assay is based on the simple reaction between the alcohol
that is produced by the enzyme and nitrous acid to form the corresponding alkyl nitrite
(Figure 4.1) [17].
Figure 4.1 Simplified scheme for the conversion of an alcohol to the corresponding ester of nitrous acid (box).
Figure 4.2 Absorption spectra of 2-methylbutyl nitrite (primary), 3-methylbutan-2-yl nitrite (secondary) and
tert-pentyl nitrite (tertiary) obtained from 2-methyl-1-butanol, 3-methyl-2-butanol and 2-methyl-2-butanol,
respectively. 10 μl of the 150 mM stock in acetone was added to 90 μl of 20 mM Tris-HCl (pH 8.0) and the
nitrosation reaction performed under standard conditions (as described in Materials and Methods, section
“Assay conditions”).
330 340 350 360 370 380 390 400 410 420 430 440
0,00
0,02
0,04
0,06
0,08
0,10
Abs
orba
nce
Wavelength [nm]
primary secondary tertiary
4.2 Materials and methods
89
Next to enzyme activity detection, this assay provides also information about the position
of the alcohol group in the molecule. For example, alkyl nitrites obtained from tertiary
alcohols have a maximum at 400 nm, which is absent in those obtained from primary and
secondary alcohols (Figure 4.2) [18].
With this valuable information the regioselectivity of an enzyme can be easily determined,
especially of importance if the substrate contains several double bonds that could be
converted by the same hydratase.
The capability of the developed method for enabling an automated set up has been
examined and characterized with OHase as the model enzyme. Next to precision of the
system, the linearity and quality have also been addressed by using simulated and
enzymatic reaction systems.
4.2 Materials and methods
4.2.1 Standard curves and Z-factor determination In order to validate the assay for linearity, standard curves and reaction simulation curves
(substrate-product mixtures) were prepared using different alkenes and alcohols (Sigma-
Aldrich) in a concentration range of 1 – 15 mM in triplicate. A desired amount of the 150
mM stock in acetone was manually added to the plates pre-filled with 20 mM Tris-HCl (pH
8.0). Subsequent steps were performed using the automated liquid handling system as
described in “Assay conditions” section. In the case of fatty acids 12-hydroxystearic acid
(12-HAS) and oleic acid (OA) (Sigma-Aldrich) a stock in DMSO was used and dispensed
by Hamilton syringe for better accuracy.
For the determination of the Z′-factor, a parameter that indicates the suitability of the assay
to be used in high-throughput format, 15 mM alkene, alcohol and fatty acids, respectively,
were used. Therefore, 10 μl of the 150 mM stock was added to plates pre-filled with 20
mM Tris-HCl (pH 8.0) (n = 32), and the nitrosation assay was performed using the standard
conditions. The calculation of the Z′-factor was done using following equation:
(3 3 )1 alcohol alkene
alcohol alkene
SD SDZ
mean mean
(Eq. 4.1)
To test the real case situation, E. coli TOP10 cells with pBAD-HISA-OH (pBAD/HisA
vector containing ohyA gene) were used instead of the standards, whereby pBAD-HISA
Oleate hydratase as model enzyme to design and evaluate high-throughput screening assay for alcohol detection
90
(pBAD/HisA empty vector) served as the negative control (n = 48). Following equation
was used for the Z-factor calculation:
(3 3 )Z 1 pBAD HISA OH pBAD HISA
pBAD HISA OH pBAD HISA
SD SD
mean mean
(Eq. 4.2)
4.2.2 Large scale production of 10-HSA As the OHase reaction product, 10-hydroxystearic acid (10-HSA), is commercially not
available, we used 12-HSA instead, with the assumption that both have similar properties.
In order to test this hypothesis, large scale production of 10-HSA was performed using E.
coli TOP10 cells overexpressing OHase. The reaction mixture contained 1 ml of the cell-
free extract (24 mg ml-1), 0.6 % (v/v) oleic acid in a total volume of 25 ml in 20 mM Tris-
HCl (pH 8.0). After overnight incubation at 30°C and 200 rpm, a 500 μl sample was used
to confirm the product by HPLC. First, the pH of the sample was adjusted with 50 μl of 3N
HCl. Subsequently, 50 μl of saturated NaCl solution was added and fatty acids extracted
with one volume of dichloromethane. The mixture was shaken for 5 min at 1400 rpm,
centrifuged for 1 min at 13.200 rpm and 1 μl of the dichloromethane phase was transferred
into a new tube. After drying with a SpeedVac Concentrator (Thermo Scientific), fatty acids
were derivatized and analyzed as described earlier [3]. Once the reaction product was
confirmed as 10-HSA, it was isolated as described previously [16] with small modification.
Briefly, the rest of the mixture (24.5 ml) was filtered through Whatman filter-paper (Grade
1) and the filter with the residues dried overnight at 39°C. The dry solid was scraped off
and dissolved in 15 ml of EtOH. Unsoluble material was filtered off and the filtrate dried
using a SpeedVac Concentrator (Thermo). The isolated product was stored at 4°C until
further use.
4.2.3 Growth conditions in 96-well deep well plates Well separated E. coli TOP10 colonies containing the plasmid pBAD-HISA-OH [3] or
empty pBAD-HISA (control) were picked and transferred to individual wells in 96-well
microtiter plates containing 150 μl LB medium with 100 μg ml-1 ampicillin and 0.2 % L-
arabinose (w/v) followed by overnight incubation at 37°C and 150 rpm. Using a 96-pin
colony replicator, the cells were transferred into 96-well deep well plates (2 ml, V-bottom,
Greiner Bio-One), which were pre-filled with 1 ml of TB-medium and 100 μg ml-1
ampicillin. Prior to incubation for 24 h at 37°C and 150 rpm, the plates were covered with
gas-permeable seals (BreathSeal, Greiner Bio-One) and lids (Lid with condensation ring,
4.2 Materials and methods
91
Greiner Bio-One). After harvesting by centrifugation for 35 min at 4000 rpm and 4°C
(5810R, Eppendorf), the resulting cells were washed ones with 20 mM Tris-HCl (pH 8.0)
and stored at -20°C overnight.
4.2.4 Liquid handling All liquid handling steps were performed using the JANUS® automated workstation
(Perkin Elmer). The system is equipped with an 8-tip pipetting arm and an arm with a 96-
channel dispense head.
4.2.5 Assay conditions Cell lysates were prepared by resuspending the cell pellets in 130 μl of 20 mM Tris-HCl
(pH 8.0) containing 1 mg ml-1 lysozyme and 0.1 mg ml-1 DNAse and subsequent incubation
at 37°C for 1 h. Cell debris and unlysed cells were removed by centrifugation for 35 min at
4000 rpm and 4°C. For enzymatic reactions, 95 μl of the cell-free extract was transferred
into a 96-well deep well assay plate (1 ml, U-bottom, Greiner Bio-One) pre-filled with 5 μl
of the substrate oleic acid (1 M stock in DMSO). The plates were covered and incubated
overnight at 30°C and 300 rpm.
For whole cell reactions, cell pellets were resuspended in 130 μl of 20 mM Tris-HCl (pH
8.0) and 95 μl of the cell suspension was directly transferred into the assay plate containing
the substrate. The reaction mixtures were incubated overnight at 30°C and 300 rpm.
Following steps were performed with the automated workstation (Figure 4.3).
Figure 4.3 Conceptualized 96-well high-throughput screening assay procedure using JANUS® automated
workstation. Steps after the performance of the enzymatic reaction are shown. Refer to text for a stepwise
description of the operation.
Oleate hydratase as model enzyme to design and evaluate high-throughput screening assay for alcohol detection
92
First, 150 μl of octane was added to the assay plate (Figure 4.3, a), followed by 50 μl of
10% HCl (aq., v/v) (Figure 4.3, b) and 80 μl 10% NaNO2 (aq., w/v) (Figure 4.3, c) with the
96-channel dispense head. The plate was manually capped (CapMat, Greiner Bio-One),
shaken vigorously for 3 min at 1500 rpm using a small shaker with microtiter attachment
(IKA) and centrifuged for 3 min at 4000 rpm and RT. The plate was returned to the
workstation and by using the 8-tip pipetting arm, 50 μl of the organic layer was transferred
to a clean 96-well microtiter plate containing 50 μl of octane (Figure 4.3, d). The pipetting
height was carefully chosen so that only organic layer was transferred. After a short
agitation, absorption spectrum was taken between 330 nm and 440 nm using a
spectrophotometer (Synergy 2, Bio Tek Instruments, Inc.). To calculate activity the
absorbance of the highest peak was taken; this is approximately 356 nm, 372 nm and 382
nm for 1°, 2° and 3° alcohols respectively.
4.2.6 Preparation of ohyA mutant libraries For the generation of randomly mutated ohyA variants, epPCR (error-prone PCR) was
performed across the entire coding sequence (1941 bp) using the Genemorph II random
mutagenesis kit (Stratagene). Two libraries were constructed with low (0 – 4.5
mutations/kb) and high (9 – 16 mutations/kb) mutation frequencies. This could be achieved
by adjusting the template DNA concentration. Amplification reactions were done under
standard PCR conditions using plasmid pBAD-HISA-OH [3] as template and flanking
primers pBAD_For (CTCTTCTCGCTAACCAAACC) and pBAD_Rev
(GGCGTTTCACTTCGGCATGG). Prior to the cloning of the variant genes into an
appropriate vector, the first PCR products were subjected to a second PCR reaction, where
restriction sites for XhoI (forward) and HindIII (reverse) were introduced through a second
set of primers (OH_F AATCTCGAGATGAACCCAATAACTTC; OH_R
ATTAAGCTTTTATCCTCTTATTCCTTTTAC) (restriction sites are underlined) and the
amount of the DNA was increased. Taq PCR master kit (Qiagen) was used following the
manufacturer’s instruction. Using XhoI / HindIII restriction sites, the digested and purified
fragments were ligated into the same sites of the pBAD-HISA vector and transformed into
electrocompetent E. coli TOP10 cells. The insertion of the genes was verified by restriction
analysis with XhoI / HindIII enzymes. From each library, a representative number of
randomly selected clones was analyzed by sequencing (BaseClear).
4.2 Materials and methods
93
4.2.7 Expression of ohyA variants After the transformation of the recombinant plasmids into E. coli TOP10, the cells were
spread on a 200 ml LB agar plate containing 100 μg ml-1 ampicillin and the plates were
incubated at 37°C overnight. The volume of the cells used was adjusted so that between
1000 and 2000 clones would be present per plate. Individual colonies from mutant libraries
were inoculated into individual wells of 96-well microtiter plate containing 150 μl LB
medium supplemented with 100 μg ml-1 ampicillin with a VersArray Colony Picker
(Biorad). By removing six of the colony picking needles, the empty wells could be
manually inoculated with six wild type ohyA clones, which served as positive controls in
each plate. The plates were covered with gaspermeable seals (BreathSeal, Greiner Bio-
One) and incubated at 37°C overnight with shaking (150 rpm). Following this, the cells
were transferred into 96-well deep well plates (2 ml, V-bottom, Greiner Bio-One) pre-filled
with 1 ml of TB-medium and 100 μg ml-1 ampicillin using a colony copier. The rest of the
cells was mixed with 40 μl of 60% glycerol (reference plate), sealed with seals (SilverSeal,
Greiner Bio-One) and stored at -80°C. Prior to incubation for 24 h at 37°C and 150 rpm,
the plates were covered with gaspermeable seals and lids (Lid with condensation ring,
Greiner Bio-One). Next, protein expression was induced by adding 10 μl of a 20% L-
arabinose stock using the JANUS® automated workstation (Perkin Elmer) and the plates
incubated for another 24 h under the same conditions. After harvesting by centrifugation
for 35 min at 4000 rpm and 4°C, the resulting cells were washed ones with 20 mM Tris-
HCl (pH 8.0) and stored at -20°C overnight.
4.2.8 Library screening Cell pellets were resuspended in 130 μl of 20 mM Tris-HCl (pH 8.0). For enzymatic
reactions, 95 μl of the cell suspension was transferred into a 96-well deep well assay plate
(1 ml, U-bottom, Greiner Bio-One) pre-filled with 5 μl of the substrate oleic acid (1 M
stock in DMSO). The plates were covered and the reaction mixtures incubated overnight at
30°C and 300 rpm. Following steps were performed with the automated workstation as
described in the “Assay conditions” section
Oleate hydratase as model enzyme to design and evaluate high-throughput screening assay for alcohol detection
94
4.3 Results and discussion
A high-throughput screening assay for hydro-lyases was developed. At first, a product with
the alcohol group is obtained by the enzymatic reaction. Subsequently, the nitrosation
reaction is performed and the resulting alkyl nitrite extracted using an immiscible organic
solvent. Direct measurements of the UV spectra were used for product detection. After
validation of the assay it was assessed using oleate hydratase from E. meningoseptica as
the model enzyme.
4.3.1 Method performance and linearity with small substrates In order to demonstrate that the assay is applicable to molecules with different sizes,
structures and substituents, and to test the precision and detection limits of the developed
method, different concentrations of unsaturated cyclic and acyclic substrates and the
corresponding alcohols were assessed under high-throughput assay conditions (100 μl).
Nitrosation of alcohols is a standard procedure in laboratories for the synthesis of alkyl
nitrites and some nitrosation reactions have also been adapted to the industrial scale [19].
However, our objective is the miniaturization of this reaction in order to be applicable to
the 96-well plate format. To accommodate good mixing of the reaction mixture, 96-well
deep well plates (1 ml) were used instead of 96-well microtiter plates (~0.3 ml).
Standard curves ranging from 1 to 15 mM were constructed and the results (Figure 4.4)
demonstrate that the discrimination between the reaction with the alkene (substrate) or the
alcohol (product) is sufficient for analysis. However, a slight background reaction of the
substrate was observed for the cyclic compounds. Lower limits of detection for each
compound were 1.5 mM, except for compounds 2-methyl-1-butanol and 2-methyl-2-
butanol, where the response below 3 mM was not linear or reliable with relative standard
deviation (RSD) exceeding 20% (calculated based on three replicates). Thus, this assay is
not applicable to reactions where low or new enzyme activities are to be discovered. On
the other hand, the linearity of the standard curves from 3 to 15 mM indicates that the
method can also be used for quantification. This is a remarkable result, since the assay has
many steps and additional liquid-liquid extraction, which in general give high errors in 100
μl format. Moreover, these results demonstrate the high robustness of the assay despite the
complex set-up.
4.3 Results and discussion
95
0 2 4 6 8 10 12 14 16
0,00
0,02
0,04
0,06
0,08
0,10
Abs
orba
nce
356
nm
Conc. [mM]0 2 4 6 8 10 12 14 16
0,00
0,02
0,04
0,06
0,08
0,10
Abs
orba
nce
382
nm
Conc. [mM]0 2 4 6 8 10 12 14 16
0,00
0,02
0,04
0,06
0,08
0,10
Abs
orba
nce
372
nm
Conc. [mM]
0 2 4 6 8 10 12 14 16
0,00
0,02
0,04
0,06
0,08
0,10
Abs
orba
nce
356
nm
Conc. [mM]0 2 4 6 8 10 12 14 16
0,00
0,02
0,04
0,06
0,08
0,10
Abs
orba
nce
382
nm
Conc. [mM]0 2 4 6 8 10 12 14 16
0,00
0,02
0,04
0,06
0,08
0,10
Abs
orba
nce
370
nm
Conc. [mM]
0 2 4 6 8 10 12 14 16
0,00
0,02
0,04
0,06
0,08
0,10
Abs
orba
nce
372
nm
Conc. [mM]0 2 4 6 8 10 12 14 16
0,00
0,02
0,04
0,06
0,08
0,10
Abs
orba
nce
360
nm
Conc. [mM]
Figure 4.4 Analysis of small alkene/alcohol pairs using the proposed high throughput screening method.
Nitrosation reactions were performed with different concentrations of the standard (stock in acetone) in 20
mM Tris-HCl (pH 8.0). Absorbance of the highest peak in the alcohol spectrum was plotted.
One important parameter in the described method is the choice of the organic solvent,
which has to be screened depending on the expected reaction product. Several organic
solvents were tested including octane, decane, dodecane, tetradecane and hexadecane.
Octane showed the best results for compounds used in this study (data not shown).
4.3.2 Method performance for larger substrates and reaction simulation
Besides small cyclic and acyclic unsaturated substrates, the larger substrate oleic acid was
tested, differing significantly in size and solubility. As 10-HSA is not commercially
available, 12-HSA was used in this study to identify and evaluate the OHase reaction
product, which has the alcohol group at a different position (position 12 vs. 10). To
determine if both products would react similarly in the proposed assay, a larger scale
production of 10-HSA was performed with OHase. The product 10-HSA was isolated and
confirmed with HPLC as > 85% pure. Nitrosation experiments were performed with 5 mM
HO
HO
OH
HOHO
OH
OH
HO
Oleate hydratase as model enzyme to design and evaluate high-throughput screening assay for alcohol detection
96
10- and 12-HSA and the results are depicted in Figure 4.5. They clearly show that 12-HSA
can be used as a standard for 10-HSA, since the spectra are identical. Lower purity of 10-
HSA explains the slightly lower values in the absorption spectra with the same
concentration.
Figure 4.5 Absorption spectra of 10-(nitrosooxy)octadecanoic acid obtained from 10-HSA, 12-
(nitrosooxy)octadecanoic acid obtained from 12-HSA and control reaction with OA. 50 mM stock in DMSO
was diluted 10 x with 20 mM Tris-HCl (pH 8.0) and the nitrosation reaction performed using standard
conditions.
Nitrosation of substrate oleic acid and the (artificial) product 12-HSA were performed. As
shown in Figure 4.6, the obtained standard curve illustrates that even with very unsoluble
substrates / products this HTS method can be used. No background reaction has been
observed from the substrate oleic acid. Thus, the assay can be applied for the enzymatic
reaction with OHase.
Next, enzymatic reaction progress was simulated by using different mixtures of the
substrate oleic acid and the product 12-HSA. The performed experiment gives an indication
of the approach applicability to real situation, where different ratios of substrate and
product are present in the mixture at the same time. From the results presented in Figure
4.7, a clear overlap of the simulated and the standard curve was observed, showing that the
assay is not negatively influenced by the presence of the substrate during the assay.
330 340 350 360 370 380 390 400 410 420 430 440
0,000
0,005
0,010
0,015
0,020
0,025
0,030
Abs
orba
nce
Wavelength [nm]
10HSA 12HSA OA
4.3 Results and discussion
97
Figure 4.6 Analysis of 12-HSA/OA pair using the proposed high throughput screening method. Nitrosation
reactions were performed with different concentrations of the standard (stock in DMSO) in 20 mM Tris-HCl
(pH 8.0).
Figure 4.7 Simulated reaction progress and standard curve of 12-(nitrosooxy)octadecanoic acid obtained from
12-HSA. Different ratios of OA and 12-HSA were prepared (total concentration 16 mM) to simulate
enzymatic reaction. In comparison, the standard curve of nitrosation of 12-HSA only, was plotted (Figure
4.6).
0 2 4 6 8 10 12 140,00
0,02
0,04
0,06
0,08
Abs
orba
nce
372
nm
Concentration [mM]
0 2 4 6 8 10 12 140,00
0,02
0,04
0,06
0,08
Reaction simulation 12-HSA
Abs
orpt
ion
372
nm
Concentration [mM]
Oleate hydratase as model enzyme to design and evaluate high-throughput screening assay for alcohol detection
98
4.3.3 Precision and accuracy (Z-factor) To develop a HTS method that can be used for the identification of ‘hits’, robustness and
reproducibility are of a big importance. Therefore, a simple parameter (Z-factor) was
defined by Zhang et al. [20], which can be used to evaluate the quality of the HTS method
and recently has been applied for the detection of decarboxylase activities [21]. As this
factor is dimensionless, it can be used to compare different HTS methods. The factor takes
into account standard deviations and mean values of sample and control measurements
(Eq. 4.1). In this study, first the Z′-factor was determined for all tested compounds to
evaluate the quality of the assay itself and a summary of the results is shown in Table 4.1.
Table 4.1 Z′-factor values of various alkene / alcohol pairs, indicating the screening assay quality. The Z′-
factor was calculated using the formula (Eq. 4.1): Z′-factor = 1 – 3 × (SDalcohol + SDalkene) / |meanalcohol –
meanalkene|
Alkene / Alcohol Z′-factor
2-methyl-1-butene / 2-methyl-1-butanol 0.82
2-methyl-1-butene / 2-methyl-2-butanol 0.71
2-methyl-2-butene / 2-methyl-2-butanol 0.70
2-methyl-2-butene / 3-methyl-2-butanol 0.72
2-methyl-1-pentene / 2-methyl-1-pentanol 0.91
2-methyl-1-pentene / 2-methyl-2-pentanol 0.73
2-methyl-2-pentene / 2-methyl-2-pentanol 0.73
2-methyl-2-pentene / 2-methyl-3-pentanol 0.90
1-methylcyclohexene / 2-methylcyclohexanol 0.72
3-methylcyclohexene / 3-methylcyclohexanol 0.78
oleic acid / 12-hydroxystearic acid 0.75
The Z′-factors are all >0.5, while most of them are even >0.7. Z′-factor values ranging from
0.5 to 1 demonstrate a good quality of the assay and can be used for identification of ‘hits’
[20]. Thus, the obtained values indicate that the HTS assay is an ‘excellent assay’ for all
alkene/alcohol pairs tested, which makes this assay applicable to distinguish all kind of
hydroxylated compounds from their unsaturated counterparts in only one step.
Another important parameter when developing a 96-well format assay is the reproducibility
and spatial plate uniformity. The design of the plates and the process can introduce new
problems, for example, temperature gradients and aeration differences, especially when
plates are stacked during the incubation time. The results can reveal patterns of drifts or
edge effects, which have to be diminished by design optimization [22]. For this reason, a
4.3 Results and discussion
99
scatter plot was prepared by plotting the response of the standards OA and 12-HSA against
well number (n = 32), either by column or by row. The results (Figure 4.8A, B) show that
no significant drifts were observed for the fatty acid standards, neither when plotting by
column nor when plotting by row. This indicates that the process design of the assay is
appropriate for high throughput screening. From these results we also can conclude that the
automated liquid handling workstation works with high accuracy.
Figure 4.8 Scatter plot to assess the spatial uniformity. The response of nitrosated 15 mM 12-HAS and 15
mM OA is plotted against well number, ordered by row (A) and by column (B). The nitrosation reaction was
performed under standard conditions.
0 12 24 36 48 60 72 84 96
0,00
0,02
0,04
0,06
0,08 12-HSA OA
Abs
orba
nce
372
nm
Well number, by row
0 8 16 24 32 40 48 56 64 72 80 88 96
0,00
0,02
0,04
0,06
0,08 12-HSA OA
Abs
orba
nce
372
nm
Well number, cy column
(A)
(B)
Oleate hydratase as model enzyme to design and evaluate high-throughput screening assay for alcohol detection
100
4.3.4 Optimization of protein expression conditions In order to test the applicability of the assay with real samples, E. coli TOP10 cell-extracts
and whole cells with and without overexpressed OHase were used. This is especially
important, as cell-extracts or whole cells naturally contain a lot of alcohols, which can serve
as substrate for the nitrosation reaction and may result in increased background signal. In
an effort to reduce the background signal, initial optimization of the expression was
performed by using TB-medium (Terrific Broth) instead of the usual LB-medium for the
enzyme expression. As expected, 2-fold higher protein concentrations were obtained with
TB-medium compared to the LB-medium (data not shown). Furthermore, reaction with
whole cells showed higher response to that obtained from cell-free extracts under the same
reaction conditions and was chosen for further experiments to simplify the HTS process.
10-HSA production was performed in 96-well plates using E. coli TOP10 cells carrying
either empty an expression vector (negative control) or a vector with ohyA gene (positive
control). Under the chosen assay conditions (50 mM oleic acid, 30°C, overnight incubation)
around 30% of the oleic acid was converted to 10-HSA (data not shown). Only partial
conversion of the substrate is required in order to be able to detect potentially improved
activity as long as the amount produced is above the detection limit. The nitrosation of the
reaction products was conducted using the automated workstation. In this experiment, not
only the accuracy of the workstation was tested, but also the spatial uniformity of the cell
growth, substrate addition and temperature influence. The obtained results (data not shown)
revealed substantial deviations in the response. In order to identify factors, which are
affecting these results, further experiments were performed. At first, we have looked into
the growth behavior of bacteria in 96-well deep well plates as it can differ from that in
standard laboratory containers like Erlenmeyer flasks. The cell densities showed significant
deviations during the first 10 hours of the growth (Figure 4.9). Usually, the protein
expression is induced in the exponential phase of the growth, when cell densities reach a
value of ~0.4 (OD600). However, with the miniaturization of cell cultures like in the high-
throughput screening set-up, this would decrease the efficiency because of the added step
in the procedure. Hence, the inducer agent is added immediately at the beginning of the cell
growth. Since plates are inoculated with a colony replicator, cell densities are relatively
different at that point. Consequently, this results in different enzyme quantities in each well.
In order to have approximately the same amount of the enzyme in each well, the protocol
4.3 Results and discussion
101
was adapted and the protein expression was induced after 25 h growth, where the standard
deviation showed an acceptable value of 6.3% (Figure 4.9).
Figure 4.9 Growth curve of E. coli TOP10 in 96-well deep well plates. Mean values and standard deviations
of the cell densities from 96 E. coli cultures are shown, which were grown at 150 rpm and 37°C over a period
of 25 h.
The enzymatic reaction was repeated with cells grown under optimized conditions. Despite
inducing OHase production later, a high standard deviation was obtained in the response.
In an attempt to decrease the error in the OHase response, the protein induction time was
varied between 16 and 25 h. As shown in Table 4.2, the Z-factor increased significantly
from -46.50 to -0.77 by increasing the induction time.
Table 4.2 Z-factor values of E. coli cultures containing pBAD-HISA or pBAD-HISA-OH plasmid, indicating
the total screening assay quality. The Z-factor was calculated using the formula (Eq. 4.2): Z-factor = 1 – 3 ×
(SDpBAD-HISA-OH + SDpBAD-HISA) / |meanpBAD-HISA-OH – meanpBAD-HISA|.
Experiment Induction time (h) Z-factor
1 16 -46.50
2 21 -1.0
3 25 -0.77
0 5 10 15 20 25 300,0
0,1
0,2
0,3
0,4
0,5
0,6
0,7
0,8 Cell density E. coli TOP10
OD
600
Time [h]
Time (h) Mean SD SD (%)
4 0,01 0,003 29,5
8 0,2 0,026 13,4
10 0,42 0,062 14,6
25 0,67 0,042 6,3
Oleate hydratase as model enzyme to design and evaluate high-throughput screening assay for alcohol detection
102
In addition, responses obtained were assessed for patterns of drift or edge effects, by
plotting against well number and ordered either by row first, then by column
(Figure 4.10A), or by column first, then by row (Figure 4.10B).
Figure 4.10 Scatter plot to assess the spatial uniformity. The response of nitrosated E. coli pBAD-HISA-OH
and E. coli pBAD-HISA (n=48) reaction products is plotted against well number, ordered by row (A) and by
column (B). The enzymatic and nitrosation reactions were performed under standard conditions.
0 8 16 24 32 40 48 56 64 72 80 88 96-0,01
0,00
0,01
0,02
0,03
0,04
0,05
0,06
0,07
0,08
0,09
0,10 E. coli pBAD-HISA-OH E. coli pBAD-HISA
Abs
orba
nce
370
nm
Well number, by column
0 12 24 36 48 60 72 84 96-0,01
0,00
0,01
0,02
0,03
0,04
0,05
0,06
0,07
0,08
0,09
0,10 E. coli pBAD-HISA-OH E. coli pBAD-HISA
Abs
orba
nce
370
nm
Well number, by row
(B)
(A)
4.3 Results and discussion
103
There are no drift patterns or edge affects visible in these figures, indicating that bacterial
growth is not affected by the place it is situated. It is, however, obvious from the plots that
the negative and positive points overlap, which will result in more false positives or missing
of hits, depending on the threshold set. Although the deviation of the negative controls is
larger than in the assay alone (32% vs 26%) it is still reasonable, considering the extra steps
in this process. The RSD of 26% for the positive controls indicates a substantial variability
in the response, since the 12-HSA variation itself was only 3.3%. This is probably due to
variability in cell growth and protein production, despite the improvements already
implemented. Another point to investigate is the octane extraction step. Compared to the
used oleic acid and 12-HSA standards, whole cells consists of a complex mixture of
different compounds, which may influence the extraction and introduce deviations to the
assay. In order to be applicable for the detection of potential ‘hits’ from mutant library, the
cell growth and enzyme production as well as the extraction step need further
investigations. Adding extra steps will take more time and effort, but hopefully result in a
good assay. Improvements should be at the beginning of the process, for instance,
inoculation from pre-grown plates by the pipetting robot instead of the colony replicator
tool, or afterwards by improving the extraction step. Also changing host or expression
vector could improve enzyme variability. As changing the induction time already improved
the Z-factor 60-fold, it should be possible to reduce the standard deviation of the OHase
signal in the plate by another factor of 10, leading to a Z-factor >0.5, which would be an
ideal assay.
From the results described so far, it is clear that further improvements are needed in order
to implement the new developed assay in the directed/random evolution studies. However,
for the time being we applied the new high-throughput screening assay to identify an OHase
variant with improved activity towards oleic acid by using a threshold value of 2 standard
deviations of the wildtype OHase activity in each plate. The generation of the mutants
included random mutagenesis of the ohyA, subsequent cloning in pBAD-HISA vector and
expression in E.coli TOP10 cells. Two separate mutant libraries were prepared with either
low- or high mutation frequency. The analysis of 55 randomly picked clones revealed an
average mutation frequency of 5 mutations/kb, which is close to the expected range of 0 –
4.5 mutations/kb (data not shown). The average mutation frequency on amino acid
sequence level was 3 mutations/gene.
Approximately 1500 transformants were obtained in each library. In first instance, the low
mutation frequency library was tested and the absorbances at 372 nm analyzed. An example
Oleate hydratase as model enzyme to design and evaluate high-throughput screening assay for alcohol detection
104
of the screening results is shown in Figure 4.11. The wild type OHase (Figure 4.11, black
bars) was included in each plate to account for the variation of the activities.
Figure 4.11 Evaluation scheme of a screening process. To account for the variation of the activities of the
individual variants (gray bars), a threshold (dashed line) was defined, above which a variant was declared as
positive. The threshold was calculated for each plate using the data of the control (wildtype) activities (black
bars). The absorbance spectra of a positive mutant and a wildtype are displayed.
13 mutants exhibiting higher activity than the wild type were identified by means of the
colorimetric high-throughput screening method (Table 4.3).
Due to the restricted time, further analysis of the obtained mutants could not be executed.
However, in order to confirm the screening result, the obtained clones need to be re-
cultivated and re-tested for activity. Once the results are re-produced and confirmed, more
detailed analysis of the mutations in these particular mutants would be of high interest, as
they could give an indication of directions for further improvement of the activity.
340 360 380 400 420 4400,00
0,02
0,04
0,06
0,08
0,10
A1
A2
A3
A4
A5
A6
A7
A8
A9
A10
A11
A12 B1
B2
B3
B4
B5
B6
B7
B8
B9
B10
B11
B12 C1
C2
C3
C4
C5
C6
C7
C8
C9
C10
C11
C12 D1
D2
D3
D4
D5
D6
D7
D8
D9
D10
D11
D12 E1
E2
E3
E4
E5
E6
E7
E8
E9
E10
E11
E12 F1 F2 F3 F4 F5 F6 F7 F8 F9 F10
F11
F12 G1
G2
G3
G4
G5
G6
G7
G8
G9
G10
G11
G12 H1
H2
H3
H4
H5
H7
H8
H9
H10
H11
0,00
0,02
0,04
0,06
0,08
0,10
Abs
orba
nce
372
nmA
bsor
banc
e
Wavelength
G12 wildtype average
4.3 Results and discussion
105
Table 4.3 Screening analysis of 1500 epPCR OHase variants. The normalized values at λmax = 372nm of the
OHase variants were compared to the values obtained for the wildtype OHase in the same plate. All showed
mutants were declared as positive using the corresponding threshold values.
In conclusion, a robust, high quality high-throughput screening method has been developed
for the detection of alcohols. In general, this assay can be used with any hydro-lyase
member, whose product can undergo a reaction with a nitrosating agent to form alkyl
nitrites. The assay is applicable to a broad range of compounds varying in size and
solubility, with good to excellent Z′-factors. Future studies will be directed at optimization
of the assay procedure for improvement of the plate uniformity of the enzyme concentration
and of the octane extraction.
96-well plate
number
Threshold
(wt average + 2SD)
Absorbance 372 nm
Wildtype
(average) Mut1 Mut2 Mut3 Mut4
01 0.051 0.033 0.054 0.064 0.052
02 0.061 0.045 0.072 0.069 0.069 0.063
07 0.082 0.062 0.090
09 0.045 0.023 0.048 0.050
15 0.089 0.050 0.092 0.096 0.100
Oleate hydratase as model enzyme to design and evaluate high-throughput screening assay for alcohol detection
106
4.4 References
[1] J. F. Jin and U. Hanefeld, "The selective addition of water to C=C bonds; enzymes are the best
chemists," Chemical Communications, vol. 47, pp. 2502-2510, 2011.
[2] L. E. Bevers, et al., "Oleate hydratase catalyzes the hydration of a nonactivated carbon-carbon
bond," Journal of Bacteriology, vol. 191, pp. 5010-5012, Aug 2009.
[3] A. Hiseni, et al., "Preparation and properties of immobilized oleate hydratase as a cross-linked
enzyme aggregate (CLEA)," 2012.
[4] E. Rosberg-Cody, et al., "Myosin-cross-reactive antigen (MCRA) protein from Bifidobacterium
breve is a FAD-dependent fatty acid hydratase which has a function in stress protection," Bmc
Biochemistry, vol. 12, Feb 2011.
[5] A. Volkov, et al., "Myosin cross-reactive antigen of Streptococcus pyogenes M49 encodes a fatty
acid double bond hydratase that plays a role in oleic acid detoxification and bacterial virulence,"
Journal of Biological Chemistry, vol. 285, pp. 10353-10361, 2010.
[6] Y.-C. Joo, et al., "Production of 10-hydroxystearic acid from oleic acid by whole cells of
recombinant Escherichia coli containing oleate hydratase from Stenotrophomonas maltophilia,"
Journal of Biotechnology.
[7] Y. C. Joo, et al., "Biochemical characterization and FAD-binding analysis of oleate hydratase from
Macrococcus caseolyticus," Biochimie.
[8] E. Y. Jeon, et al., "Bioprocess engineering to produce 10-hydroxystearic acid from oleic acid by
recombinant Escherichia coli expressing the oleate hydratase gene of Stenotrophomonas
maltophilia," Process Biochemistry, vol. 47, pp. 941-947, 2012.
[9] S. van Pelt, et al., "Nitrile hydratase CLEAs: The immobilization and stabilization of an industrially
important enzyme," Green Chemistry, vol. 10, pp. 395-400, 2008.
[10] A. S. Bommarius and B. R. Riebel, "Introduction to Biocatalysis," in Biocatalysis, ed: Wiley-VCH
Verlag GmbH & Co. KGaA, 2005, pp. 1-18.
[11] F. H. Arnold, "Design by directed evolution," Accounts of Chemical Research, vol. 31, pp. 125-131,
Mar 1998.
[12] U. T. Bornscheuer and M. Pohl, "Improved biocatalysts by directed evolution and rational protein
design," Current Opinion in Chemical Biology, vol. 5, pp. 137-143, Apr 2001.
[13] L. G. Otten and W. J. Quax, "Directed evolution: selecting today's biocatalysts," Biomolecular
Engineering, vol. 22, pp. 1-9, Jun 2005.
[14] L. G. Otten, et al., "Enzyme engineering for enantioselectivity: from trial-and-error to rational
design?," Trends in Biotechnology, vol. 28, pp. 46-54, Jan 2009.
[15] J.-L. Reymond, Enzyme assays: High-throughput screening, genetic selection and fingerprinting:
Whiley-VCH, 2006.
[16] J. A. Hudson, et al., "Conversion of oleic acid to 10-hydroxystearic acid by two species of ruminal
bacteria," Applied Microbiology and Biotechnology, vol. 44, pp. 1-6, Dec 1995.
4.4 References
107
[17] D. L. H. Williams, "O-Nitrosation," in Nitrosation Reactions and the Chemistry of Nitric Oxide, ed
Amsterdam: Elsevier Science, 2004, pp. 105-115.
[18] I. A. Leenson, "Identification of primary, secondary, and tertiary alcohols - An experiment in
spectrophotometry, organic chemistry, and analytical chemistry," Journal of Chemical Education,
vol. 74, pp. 424-425, Apr 1997.
[19] W. Lyn, "Introduction," in Nitrosation Reactions and the Chemistry of Nitric Oxide, ed Amsterdam:
Elsevier Science, 2004, pp. xi-xii.
[20] J. H. Zhang, et al., "A simple statistical parameter for use in evaluation and validation of high
throughput screening assays," Journal of Biomolecular Screening, vol. 4, pp. 67-73, Apr 1999.
[21] R. Médici, et al., "A high-throughput screening assay for amino acid decarboxylase activity,"
Advanced Synthesis and Catalysis, vol. 353, pp. 2369-2376, 2011.
[22] B. Eastwood, et al. (2009). Assay Guidance Manual, Version 6 [from internet]. Available:
http://assay.nih.gov/assay/index.php/Table_og_Contents
Chapter 5
5 Preparation and properties of immobilized oleate hydratase as a cross-
linked enzyme aggregate (CLEA)
Aida Hiseni, Maria del Rosario Franco Berriel, Isabel W.C.E. Arends and
Linda G. Otten
Manuscript in preparation
Preparation and properties of immobilized oleate hydratase as a cross-linked enzyme aggregate (CLEA)
110
Abstract
The immobilization of oleate hydratase (OHase) from Elizabethkingia meningoseptica as
cross-linked enzyme aggregates (CLEA) is described. CLEA’s were prepared by
precipitation of OHase in cell-free extracts and subsequent cross-linking with
glutaraldehyde. The effects of different precipitating agents and different concentrations of
the cross-linking agent glutaraldehyde were investigated. In an optimized procedure ninety
percent ammonium sulfate saturation and 0.3wt% glutaraldehyde were used. Activity
recovery of 26% was achieved after 21 h cross-linking at 4°C. OHase CLEA’s had
increased activity over a range of different temperatures compared to that of the OHase
both in cell-free extracts as well as in whole cells.
5.1 Introduction
111
5.1 Introduction
The possibility of using renewable, plant-based resources for the production of fine
chemicals has generated wide interest in the field of industrial biotechnology. Reasons such
as fluctuating supply and price of the finite resource petroleum, and considerable
environmental issues have led to the development of new processes in the industry, where
petroleum-based products are being replaced by products derived from alternative and
sustainable sources [1-4]. One of the cheapest and most abundant biological raw materials
is vegetable oil [5].
Hydroxy fatty acids (HFA) have specific physical and chemical properties i.e. high
viscosity and reactivity, which make them suitable for the production of a number of
products, including resins, nylons, plastics, waxes, cosmetics and coatings [6]. They can be
obtained by chemical modification of unsaturated fatty acids using strong acids such as
sulfuric acid, followed by subsequent hydrolysis [6]. However, the resulting mixture of
several HFA’s requires costly downstream processing. Furthermore, regio- and
enantioselectivity is difficult to achieve. Therefore, the use of isolated enzymes and/or
microbial systems will offer significant advantages: Both the problem of selectivity as well
as the requirement of strong acids can be overcome.
The enzymatic hydration of oleic acid (OA) into 10-hydroxystearic acid (10-HSA) was first
described in a Pseudomonas strain [7]. Since then reports followed for a series of different
bacterial and eukaryotic microorganisms, such as Sphingobacterium thalpophilum [8]
Corynebacterium [9], Saccharomyces cerevisiae [6] and Stenotrophomonas nitritireducens
[10] with space-time yields ranging from 0.001 to 16 g l-1 h-1 for 10-HSA (Supplementary
table 5.1). Although over the years much research has been devoted to the optimization of
the fermentation conditions so that high productivities of the enantiomerically pure 10-
HSA can be obtained, rather little attention has been paid to the enzyme responsible for this
hydration reaction. Only recently, Bevers et al. [11] were able to recombinantly express
and characterize oleate hydratase (OHase) from Elizabethkingia meningoseptica (formerly
known as Pseudomonas sp. 3266), the same strain that Davis et al. [12] described 43 years
ago. This hydratase represents a new type of hydro-lyase, which is able to hydrate an
isolated carbon-carbon double bond (Figure 5.1) and is a possible biocatalyst for the
production of several alcohols and alkenes [13, 14]. The growing interest in this type of
hydro-lyases has been shown by many recent studies that have focused on finding and
Preparation and properties of immobilized oleate hydratase as a cross-linked enzyme aggregate (CLEA)
112
characterizing oleate hydratases from other microorganisms for the production of 10-HSA
[15-18].
Figure 5.1 Reaction catalyzed by oleate hydratase (OHase): conversion of oleic acid into 10-hydroxystearic
acid.
The use of isolated enzymes in biocatalytic transformations allows for higher product
concentrations, less side reactions and simplified down-stream processing compared to
processes catalyzed by whole cells. Furthermore, diffusion limitations do not occur. On the
other hand, isolated enzymes may show high sensitivity to industrial conditions, which
often involve organic solvents, extreme pH’s or elevated temperatures. One strategy to
improve operational performances of enzymes in industrial processes is immobilization as
a means of stabilization. Furthermore, immobilization may improve other enzyme
properties, including selectivity or specificity or reduce enzyme inhibition by, for instance,
substrate or product [19]. A considerable number of immobilization techniques, such as
binding to a carrier, encapsulation in a polymeric matrix or cross-linking of enzyme
aggregates, are known to date [20-22]. However, there is no universal protocol. For every
enzyme the best immobilization method needs to be investigated. Hanefeld et al. [23] and
Garcia-Galan et al. [24] have reviewed enzyme immobilization and they highlighted some
important parameters that have to be taken into account when choosing a suitable
immobilization technique.
To our knowledge, the immobilization of oleate hydratase has not been reported to date.
As a first and straightforward methodology to immobilize OHase cross-linked enzyme
aggregates (CLEA) were prepared. This method offers the advantage that it does not lead
to ‘dilution of activity’ by usage of an carrier, has lower production costs through exclusion
of an expensive carrier, and produces a catalyst with highly concentrated activity [25]. In
this study, the results obtained for the immobilization of the overexpressed non-purified
O
OHoleic acid
O
OH
OH
10-hydroxystearic acid
H2OOHase
5.2 Materials and Methods
113
OHase are described. For this purpose, recombinant OHase from E. coli cell-free extracts
was aggregated and cross-linked using a bifunctional cross-linker glutaraldehyde.
Biochemical and biophysical properties as well as the efficiency of the CLEA biocatalyst
were investigated.
5.2 Materials and Methods
5.2.1 Bacterial strain, growth conditions and cell disruption E. coli TOP10 cells containing the plasmid pBAD-HISA-OH [11] were grown at 37°C in
TB medium with 100 μg ml-1 ampicillin until an OD600 value of 0.6 – 0.8 was reached.
Protein expression was induced with 0.2% arabinose (final concentration), followed by
cultivation at 28°C overnight. Cells were harvested by centrifugation (10.000 rpm, 10 min,
4°C; Sorvall), washed once with 20 mM Tris-HCl pH 8.0 and lysed in the same buffer with
a cell disruptor at the pressure of 1.5 kBar (Constant systems, IUL instruments). Cell-free
extract (CFE) was separated from cell debris by centrifugation at 10.000 rpm for 20 min at
4°C and stored on ice until further use. For long term storage, aliquots of CFE were frozen
in liquid nitrogen and stored at -80°C.
5.2.2 Precipitation procedure An amount of 0.1 ml of CFE (protein concentration: 4 mg ml-1) was added drop-wise to 0.9
ml precipitant (acetone, acetonitrile (ACN), ethanol, 2-propanol, 1,2-dimethoxyethane
(DME) or saturated ammonium sulfate), at room temperature (RT) and 4°C, respectively.
The resulting mixture was shaken at 400 rpm (Eppendorf Thermomixer) for 1 h, after which
the precipitated protein was separated at 13.200 rpm for 20 min (Eppendorf centrifuge).
Subsequently, the pellets were resuspended in 0.5 ml 20 mM Tris-HCl pH 8.0, and assayed
for activity using oleic acid as substrate.
5.2.3 Cross-linking procedure After protein precipitation 12.5 – 200 μl of 25wt% glutaraldehyde was added drop-wise
into the same tube and the mixture shaken at 400 rpm for 1 – 21 h. When the protein
concentration was varied from 1 to 24 mg ml-1 0.3wt% of glutaraldehyde was used. The
suspended CLEA’s were centrifuged (13.200 rpm, 30 min) and the supernatant was
removed. In order to remove non-cross-linked protein and the remaining glutaraldehyde,
Preparation and properties of immobilized oleate hydratase as a cross-linked enzyme aggregate (CLEA)
114
CLEA’s were washed three times with 0.5 ml 20 mM Tris-HCl pH 8.0 and stored in the
same buffer on ice until further use. Washing supernatants were assayed for activity to
determine enzyme leakage.
For the scale-up procedure, the above described protocol was used, with 50-fold increased
amount of OHase. Briefly, 5 ml of CFE (protein concentration: 4 mg ml-1) was added drop-
wise to 45 ml saturated ammonium sulfate solution and the mixture shaken at 40 rpm
(Incubator shaker, Innova 44) and 4°C for 1 h. Subsequently, 625 μl of 25wt%
glutaraldehyde (endconc. 0.3wt%) was added and the mixture shaken further for 21 h. The
CLEA’s were centrifuged for 30 min at 4000 rpm and the supernatant removed. After
washing three times with 1 ml 20 mM Tris-HCl pH 8.0, the CLEA’s were stored in the
same buffer on ice until further use.
5.2.4 Activity assay OHase activity was determined using oleic acid as substrate. Unless otherwise stated, a
standard assay was performed with 0.5 ml final volume in 20 mM Tris-HCl pH 8.0,
containing 6 mM oleic acid and 2 μl of cell-suspension (55 mg ml-1), 2 μl of CFE (24 mg
ml-1) or a certain amount of CLEA, respectively. The mixtures were incubated at 30°C and
1400 rpm. After a desired time interval the reaction was stopped by the addition of 50 μl
3N hydrochloric acid (HCl), and substrate and product were extracted from the aqueous
layer. Prior to the extraction stearic acid (dissolved in acetone) was added, which served as
external standard, followed by addition of 50 μl saturated NaCl solution and the extraction
with one volume of dichloromethane (DCM). The mixtures were shaken for 5 min at 1400
rpm, centrifuged for 1 min at 13.200 rpm and 50 μl of the DCM phase was transferred into
a new tube. After drying with a SpeedVac Concentrator (Thermo), fatty acids were
derivatized [26, 27]. To the dried extracted fatty acids 25 μl of 2-bromoacetophenone (10
mg ml-1 in acetone) and 25 μl of triethylamine (10 mg ml-1 in acetone) were added and the
mixtures heated at 96°C for 15 min. 3.5 μl of acetic acid was added and the mixtures heated
for a further 5 min. After evaporation to dryness the samples were reconstituted in 0.1 ml
of ACN for HPLC analysis. Separation was performed with a 4.6 x 50 Merck Chromolith
SpeedROD RP-18e, using H2O-ACN mobile phase gradient (A: H2O with 0.1%, v/v
trifluoroacetic acid; B: ACN). The gradient consisted of 50% B over 3 min, 50 – 80% B
over 2 min and isocratic elution (80% B) over 7 min, at 1 ml min-1 and at a column
temperature of 50°C. Derivatized substrate and product were detected at 242 nm (SPD20A,
Shimadzu).
5.3 Results and discussion
115
For quantitative analysis a linear relationship was established for the peak area ratios of
product versus external standard stearic acid.
5.2.5 Storage stability Storage stabilities of cell-suspension (55 mg ml-1), CFE (24 mg ml-1) and CLEA (0.2 mg
ml-1) were tested by storing the enzyme in 20 mM Tris-HCl pH 8.0 at 4°C and RT (21°C),
respectively, for several days. At various time points activities were determined using oleic
acid as substrate under standard assay conditions. Stabilities were given as residual
activities, calculated by taking the initial activity of the enzyme as 100%.
5.2.6 pH activity and temperature stability In order to investigate the pH effect on the enzyme activity, standard assay conditions were
used in buffers with varying pH values (100 mM sodium acetate, pH 3.0 – 6.0; 100 mM
potassium phosphate, pH 6.0 – 8.0; 50 mM Tris-HCl pH 8.0 – 9.0). Enzyme activity,
determined in 20 mM Tris-HCl pH 8.0 under standard conditions was designated as 100%.
Thermal stability was investigated by pre-incubating the enzyme at temperatures ranging
from 20 to 50°C in the absence of substrate for 20 min, cooling the enzyme solution on ice,
and then measuring the residual activity using the standard assay. Residual activities were
calculated by taking the initial activity of the enzyme as 100%.
5.2.7 Biocatalyst recovery Biocatalyst operational stability was studied using standard assay containing 10 mg ml-1 of
CLEA. After 1 h of reaction, product extraction and derivatization were performed as
described in section “Activity assay”. CLEA was removed from the interphase after
extraction, washed three times with 0.5 ml 20 mM Tris-HCl pH 8.0, and resuspended in
fresh buffer to perform a new reaction.
5.3 Results and discussion
Recombinantly overexpressed OHase from E. meningoseptica was immobilized by self-
aggregation into cross-linked enzyme aggregates (CLEA’s). The crude enzyme is first
aggregated by a precipitating agent and subsequently covalently cross-linked using a bi-
functional agent glutaraldehyde [20]. One advantage of this method is that this
immobilization procedure is carrier-free. Protein sequence analysis of OHase revealed 50
Preparation and properties of immobilized oleate hydratase as a cross-linked enzyme aggregate (CLEA)
116
lysine residues, which are potential sites for cross-linking. Since the crystal structure of
OHase has not yet been solved, it is not known if these residues are exposed to the solvent
or/and are close to the active site. However, given the fact that cross-linking is observed
(vide infra) it is reasonable to assume that a certain percentage is located on the enzyme
surface.
5.3.1 Selection of the best precipitating agent for CLEA preparation
As a first step, several precipitating agents were screened, including organic solvents and
an ammonium salt in an enzyme/precipitating agent ratio of 1:9 (v/v), both at 4°C and RT.
To evaluate the different precipitating agents, the possibility to reactivate the aggregated
enzyme after treatment (by dissolving in 20 mM Tris-HCl pH 8.0) is determined. As shown
in Figure 5.2, the highest activity recovery was obtained when 2-propanol and ammonium
sulfate were used. Using ammonium sulfate at RT results in more active enzyme, while no
good activity recovery was observed for 2-propanol.
Figure 5.2 Activity recovery of redissolved OHase aggregates after precipitation of 4 mg ml-1 CFE with 90%
(v/v) of precipitation agent. Assays were performed using standard conditions in 20 mM Tris-HCl pH 8.0
with oleic acid as substrate. Enzyme activity of the free and soluble enzyme was designated as 100% activity.
This can be explained by the fact that hydrophilic solvents such as acetonitrile, ethanol or
Acetone Acetonitrile EtOH 2-Propanol DME (NH4)2SO40
10
20
30
40
50
60
70
80
90
100
Act
ivit
y re
cove
ry [
%]
4°C RT
5.3 Results and discussion
117
acetone are able to take up infinite amounts of water, which in this case is stripped off from
the enzyme surface [28]. As seen in Figure 5.2, this effect is for all solvents more
pronounced at RT and is observed even for the less polar solvents such as 2-propanol and
DME. For further studies both 2-propanol and ammonium sulfate procedures were used.
5.3.2 Cross-linking and the effect of glutaraldehyde concentration
OHase CLEA’s were prepared from the precipitate with different concentrations of
glutaraldehyde and three different incubation times, namely 1, 3 and 21 h at 4°C. In this
step of CLEA preparation it is important to define proper reaction conditions in order to
avoid excessive cross-linking, which can increase the rigidity of the enzyme and therefore
negatively influence the performance of the enzyme. In contrast, using too low
concentrations of the cross-linker may cause the formation of a highly flexible and small
CLEA, which cannot be centrifuged and therefore is not suitable for reuse. From the results
that are presented in Figure 5.3, a significant difference in activity recoveries was observed
when ammonium sulfate (Figure 5.3A) and 2-propanol (Figure 5.3B) were used as
precipitating agent.
The overall activity recovery was 100-fold higher for ammonium sulfate than that for 2-
propanol. The precipitation agent causes the enzyme to "freeze" in a certain conformation,
which is subsequently covalently stabilized by glutaraldehyde. Despite the relatively high
activity recovery obtained after precipitation of OHase with 2-propanol (Figure 5.2), hardly
any activity recovery was observed once the precipitated OHase has been covalently cross-
linked. This can be due to the fact that the precipitated OHase consisted of a rather
unfavorable and inactive conformation, which could be reactivated after redissolving in
buffer. On the contrary, this unfavorable conformation was stabilized after cross-linking
with glutaraldehyde, thus resulting in inactive CLEA particles. Similar results were
reported previously for a laccase from Trametes villosa, where good activity recoveries
were obtained after precipitation with 2-propanol. However, once the enzyme was cross-
linked, the catalytic activity decreased drastically [29].
Preparation and properties of immobilized oleate hydratase as a cross-linked enzyme aggregate (CLEA)
118
Figure 5.3 Preparation of OHase CLEA’s (4 mg ml-1) using ammonium sulfate (A) and 2-propanol (B) as
precipitating agent in combination with different concentrations of the cross-linker glutaraldehyde. Cross-
linking time used was 1, 3 and 21 h. CLEA activity recovery is determined by comparison with the total
amount of units in 100 μl cell-free extract that was used for CLEA preparation.
Precipitation of OHase with ammonium sulfate resulted in significantly higher activity
recoveries. The remaining activity in the CLEA was inversely proportional to the
concentration of glutaraldehyde. With increasing glutaraldehyde concentration the
quaternary protein structure probably deforms in such way that the enzyme loses its
activity. Moreover, due to the high amount of lysine residues, the enzyme might become
rigid and is not able to undergo conformational changes upon binding to the substrate.
Therefore we chose a low glutaraldehyde concentration. Under these conditions a long
cross-linking time gives better results. For further tests CLEA’s were prepared using
0.3wt% of glutaraldehyde and an incubation time of 21 h. No enzyme leakage was detected
after 3 washing cycles with buffer when CLEA’s were prepared under these conditions.
This indicates that despite the low glutaraldehyde concentration all enzyme molecules were
properly cross-linked.
0 1 2 3 4 502468
10121416
0 1 2 3 4 50,00
0,05
0,10
0,15
Act
ivit
y re
cove
ry [
%]
1h 3h 21h
Glutaraldehyde [wt%]
(A)
(B)
5.3 Results and discussion
119
Preparation of immobilized catalysts can introduce a new problem, i.e. diffusional
limitations of the substrate and product due to the large catalyst particle size. Oleic acid is
a C18 molecule that needs to be accommodated in the right position in the active site of
OHase. However, if the catalyst forms large aggregates, the accessibility of the active site
is impeded. This problem can be overcome by either reducing the aggregate particle size
by mechanical stirring [30], or by reducing the amount of enzyme used in the CLEA
preparation. We have prepared CLEA’s using 1 to 24 mg ml-1 of the CFE and the results
are shown in Figure 5.4. The activity recovery was the highest for the smallest CFE
concentration used. Although visually it was observed that more CLEA was obtained using
24 mg ml-1 of the CFE, it did not result in higher activity recovery. In general, the activity
recovery decreases with increasing protein concentration. From all these experiments we
deduced that the best way to make OHase CLEA’s is to prepare them with 90% ammonium
sulfate, 0.3wt% glutaraldehyde and 1 mg protein ml-1 at 4°C using a cross-linking time of
21 h.
Figure 5.4 Effect of enzyme concentration of the cell-free extract used for CLEA preparation on relative
activity recovery of OHase CLEA. Cell-free extracts of 1 mg ml-1 (A), 4 mg ml-1 (B), 10 mg ml-1 (C) and 24
mg ml-1 (D) were used.
A B C D0
5
10
15
20
25
30
Act
ivit
y re
cove
ry [
%]
Preparation and properties of immobilized oleate hydratase as a cross-linked enzyme aggregate (CLEA)
120
5.3.3 Thermal stability and pH profile of OHase CLEA’s The thermal stability of OHase as cell-suspension, in CFE and as CLEA was investigated
by incubating the samples for 20 min at temperatures between 20 and 50°C in the absence
of the substrate oleic acid and measuring their residual activity with the standard assay. The
highest residual activity was obtained with CLEA (Figure 5.5). At 30°C the residual activity
for the CLEA was significantly higher (81%) than that of the CFE (34%). When pre-
incubated at 50°C, the CLEA still showed relative high activity (around 20%) compared to
cell-suspension and CFE (5 and 3%, respectively). This phenomenon of increased
temperature stability of CLEA has been observed earlier [30, 31]. This is probably due to
enhancement of the structure stability through inter- and intramolecular covalent cross-
links, which results in a molecule more resistant to conformational changes.
Figure 5.5 Comparison of temperature stabilities of OHase as CLEA (□), in cell-free extract (○) and as cell-
suspension (∆). Residual activities were assayed under standard conditions after the enzyme samples had
been incubated at the indicated temperature (20 – 50°C) in 20 mM Tris-HCl pH 8.0 for 20 min. Initial activity
determined under standard assay conditions was taken as 100%. Values are means of at least two independent
measurements.
The pH dependency of OHase activity was investigated using oleic acid as substrate. From
the results shown in Figure 5.6, it is obvious that OHase in CFE shows a different activity
profile compared to CLEA or cell-suspension. The optimal pH for OHase as free soluble
20 25 30 35 40 45 50 550
20
40
60
80
100
120 CLEA
Res
idua
l act
ivit
y [%
]
Temperature [°C]
cell-free extracts cell suspension
5.3 Results and discussion
121
enzyme is at pH 7.0, on a broad plateau from pH 6.0 - 8.0, which is in agreement with
previously reported results [11]. It is shifted to a smaller peak in more alkaline conditions
(pH 8.0) for CLEA and cell-suspension. Acidic conditions (pH values 4.0 – 6.0) result in
inactive CLEA and cell-suspension, while CFE shows about 57% of the relative activity at
pH 5.0.
Figure 5.6 Comparison of pH profiles of OHase as CLEA (□), in cell-free extract (○) and as cell-suspension
(∆). Relative activities were determined using oleic acid as substrate in buffers with varying pH (4.0 – 8.6)
and compared to the activity measured using standard assay conditions (20 mM Tris-HCl pH 8.0).
There are many reasons, which could explain this different behavior. One important
parameter in this study is the physical state of oleic acid in biological aqueous systems.
Cistola and co-workers [32] discussed this in detail and concluded that oleic acid exists in
three different states, which is dependent on the pH of the solution and on the ionic strength.
At pH <7 oleic acid is in form of a stable oil phase and the carboxylic groups are protonated.
From pH 7 - 9 the degree of ionization increases, which results in the formation of more
structured lamellar system or large vesicles. Furthermore, this increase of ionization leads
also to increased fluidity. If the concentration at pH >9 is above its critical micelle
concentration (CMC ~6 μM), oleic acid starts to form micelles. Therefore, the pH
dependency of enzymatic activities is not only the result of kinetic parameters but also
4 5 6 7 8 90
20
40
60
80
100
120
CLEA
Res
idua
l act
ivit
y [%
]
pH
cell-free extracts
cell suspension
Preparation and properties of immobilized oleate hydratase as a cross-linked enzyme aggregate (CLEA)
122
depends on the nature of the substrates and the products. Firstly, the above mentioned
fluidity of oleic acid at lower pH’s results in limited diffusivity, which again has big effect
on OHase activity as cell-suspension or CLEA. Secondly, the apparent pKa of monomeric
oleic acid is reported to be ~4.8, whereas it is 7.5 when incorporated into phospholipids
bilayer of the cell membranes [32]. As CLEA is a densely packed hydrophobic
environment, it may resemble a bilayer and have similar effects on the pKa of oleic acid.
The charge variation of the substrate and the enzyme itself, and the resulting structural
alterations may influence the binding of the substrate and therefore the catalytic activity of
the enzyme.
5.3.4 Storage stability of OHase CLEA’s The storage stability of the OHase in CFE, as cell-suspension and as CLEA was determined
at 4°C (Figure 5.7A) and RT (Figure 5.7B). In general, the residual activities for OHase in
CFE and as CLEA were greater for samples stored at 4°C. Complete loss of activity was
observed after 7 days of storage at RT. In contrast to that, the decrease of OHase activity
over time as cell-suspension is significantly lower at RT than that at 4°C. While about 50%
of the initial activity was lost after 7 days of storage at 4°C, the enzyme still retained 95%
of its initial activity when stored at RT for the same period of time. The cross-linking of
OHase leads to a slightly better storage stability at 4°C compared to the CFE. Nevertheless,
after 3 days of storage the activity decreases at the same degree as OHase in CFE or as cell-
suspension.
5.3 Results and discussion
123
Figure 5.7 Comparison of storage stabilities at 4°C (A) and RT (B) of OHase as CLEA (□), in cell-free extract
(○) and as cell-suspension (∆) in 20 mM Tris-HCl pH 8.0. Stabilities were given as residual activities, calculated
by taking the initial activity of the enzyme as 100% under standard assay conditions.
0 2 4 6 8 10 12 14 160
20
40
60
80
100
120
cell-free extract
Res
idua
l act
ivit
y [%
]
Time [days]
cell suspension CLEA
0 2 4 6 8 10 12 14 160
20
40
60
80
100
120 CLEA
Res
idua
l act
ivit
y [%
]
Time [days]
cell-free extract cell suspension
(A)
(B)
Preparation and properties of immobilized oleate hydratase as a cross-linked enzyme aggregate (CLEA)
124
5.3.5 Recycling of OHase CLEA’s For the recyclability studies, the CLEA’s were recovered and washed three times with
buffer after each cycle of operation and the activity assay repeated with the same CLEA’s.
The obtained results, which are depicted in Figure 5.8, show that the activity decreases with
every cycle of operation. In order to eliminate the possible negative influence of HCl, which
is needed for the extraction of fatty acids, we performed the extraction step without the
addition of HCl and compared the results with those obtained for the standard procedure.
Indeed, slightly higher residual activities were obtained when HCl was not used for the
extraction, and were 2.7-fold higher after the second cycle and 6.5-fold higher after the
third cycle. However, the loss of 70 and 87% of the initial activities after two and three
cycles, respectively, clearly indicates low stabilities of the CLEA’s. This effect can be
explained by the fact, that the product 10-HSA, which is a solid and starts to precipitate
after a certain point of time, accumulates inside and outside the aggregated biocatalyst and
blocks the structure for the diffusion of the substrate and the product. The inside portion
will not be washed out under current washing conditions, resulting in new substrate not
able to enter the CLEA’s and reach the active site of the OHase.
Figure 5.8 Recycling stability of OHase CLEA. Standard activity assay was performed and after 3 x washing
of the CLEA with buffer, the assay was repeated for a second and third time. The extraction step was
performed with and without the addition of 3N HCl.
1 2 30
20
40
60
80
100
120
Res
idua
l act
ivit
y [%
]
Cycle number
+ HCl - HCl
5.4 Conclusion
125
The same problem was observed by Cao et al., where penicillin G acylase CLEA starts to
accumulate the product ampicilline inside the CLEA matrix [33]. Another immobilization
technique may be considered at this point, such as soluble-insoluble supports [34]. With
this technique it would be possible to retain the enzyme in solution while centrifuging off
the solid product. With the subsequent lowering of the pH, the enzyme could be recovered
in its insoluble form for the next cycle [34]. An additional option would be the preparation
of OHase combined with another enzyme, such as lipase, which can convert 10-HSA to the
soluble product lactone [35]. Preliminary results indicate that this procedure warrants
further study.
5.3.6 Space-time yields Space-time yields for the production of 10-HSA by cell-suspension, CFE and CLEA’s were
calculated and compared with previously reported values (Supplementary table 5.1). Cell-
suspension and CFE produced roughly the same amount of the product 10-HSA with
volumetric productivities of 0.26 and 0.33 g l-1 h-1, respectively. The space-time yields
achieved with OHase CLEA’s were 4.7- and 6-fold lower than those obtained with the cell-
suspension and CFE, respectively. Nonetheless, they were up to 55-fold higher than
microbial productions with, for instance, Flavobacterium sp.DS5
(Supplementary table 5.1), performed under similar assay conditions (30°C) and with
similar yield (~6%). Interestingly, in the listed studies (Supplementary table 5.1) all
reported productivities above 5 g l-1 h-1 were achieved under optimized conditions, where
surfactants or organic solvents were used to increase the solubility of the substrate and the
product in the aqueous phase. It should be noted, however, that all obtained productivities
in this study were performed under non-optimized conditions. Although, investigations of
OHase immobilization as CLEA might not necessarily contribute directly to better 10-HSA
productivities and certainly leave room for optimization, they might guide further
investigations to make a stable and efficient biocatalyst for the industry.
5.4 Conclusion
This research describes the first steps towards a preparation of a biocatalyst for the
production of 10-HSA. For the first time OHase from E. meningoseptica has been
immobilized as cross-linked enzyme aggregates (CLEA’s). This immobilization technique
Preparation and properties of immobilized oleate hydratase as a cross-linked enzyme aggregate (CLEA)
126
can be used to improve the biocatalytic properties of OHase. In the synthesis of 10-HSA,
CLEA’s preparation of OHase led to a 2.4-fold increase of biocatalyst stability at elevated
temperatures and better storage stabilities at cold temperatures in comparison with the
soluble enzyme in cell-free extracts or as whole-cells. The perspectives that we give here
could contribute to the preparation of a more successful biocatalyst for the application in
this industrial process. [36-39]
5.5 Supplemental Information
127
5.5 Supplemental Information S
trai
n C
ulti
vati
on
med
ium
Gro
wth
tem
p.
[°C
]
Ass
ay
bu
ffer
Ass
ay
tem
p.
[°C
]
Ass
ay
pH
Ass
ay
shak
ing
[rp
m]
Su
bst
rate
[g/l
]
Pro
du
ct
[g/l
]
Yie
ld
[%]
ST
Y
[g/l/
h]
Au
thor
Y
ear
Ref
.
Ent
eroc
occu
s fa
ecal
is
Enr
ichm
ent m
ediu
m
37
Enr
ichm
ent m
ediu
m-a
naer
obic
37
N
R
star
t aft
er
24h
0.9
0.8
89
0.01
1 H
udso
n 19
95
[26]
Ent
eroc
occu
s ga
llin
arum
H
B b
roth
45
/ 15
H
B m
edii
um
39
~6.5
90
2
1.9
97
0.02
7 M
orva
n 19
99
[36]
Fla
voba
cter
ium
sp.
DS
5 m
ediu
im
30
0.05
M K
-pho
spha
te
30
7.5
200
5.4
0.34
6
0.00
1 H
eo a
nd
Kim
2009
[3
9]
Lac
toba
cill
us s
p.
HB
bro
th
45
HB
med
iium
39
~6
90
2
1.52
76
0.
021
Mor
van
1999
[3
6]
Noc
ardi
a ch
oles
tero
licu
m
YM
A
NR
0.
05 M
K-p
hosp
hate
-ana
erob
ic
40
6.5
150
17.8
16
90
2.
7 K
orit
ala
1989
[3
7]
N. P
araf
fina
e N
BY
30
0.
05 M
K-p
hosp
hate
-ana
erob
ic
25
6.8
180
18
8 44
1.
6 L
atra
sse
1997
[3
8]
P. a
cidi
lact
ici
HB
bro
th
45 /
15
HB
med
iium
39
~6
.5
90
2 1.
86
93
0.02
7 M
orva
n 19
99
[36]
Sel
enom
onas
rum
inan
tium
E
nric
hmen
t med
ium
37
E
nric
hmen
t med
ium
-ana
erob
ic
37
NR
st
art a
fter
24h
0.9
0.63
70
0.
009
Hud
son
1995
[2
6]
Sph
ingo
bact
eriu
m th
alpo
phil
um
WF
6Mn
28
WF6
Mn
28
~7
350
18
7 40
0.
07
Kuo
20
06
[8]
Ste
notr
ophm
onas
nitr
itir
educ
ens
Gro
wth
med
ium
+ O
A 2
8 0.
05 M
Tri
s-H
Cl +
0.0
5 %
Tw
een
80-a
naer
obic
35
7.5
200
30
31.5
10
5 7.
9 K
im
2010
[1
0]
Ste
notr
ophm
onas
mal
toph
ilia
N
R
NR
C
itrat
e-ph
osph
ate
buff
er +
0.0
5 %
Tw
een
40
35
6.5
NR
50
40
80
5
Joo
2012
[1
7]
E. c
oli
cont
aini
ng O
Has
e
from
Lys
inib
acil
lus
fusi
form
is
LB
-med
ium
16
0.
05 M
PIP
ES
buf
fer
+ 4
% E
tOH
35
6.
5 N
R
40
40
100
16
Kim
20
11
[18]
E. c
oli c
onta
inin
g O
hase
from
S. m
alto
phil
ia
LB
-med
ium
16
C
itra
te-p
hosp
hate
buf
fer
+ 0
.05
%
Tw
een
40
35
6.5
NR
50
49
98
12
.6
Joo
2012
[1
7]
E. c
oli c
onta
inin
g O
hase
from
S. m
alto
phil
ia
Rie
senb
erg
med
ium
25
0.
05 M
Tri
s-H
Cl +
0.0
5 %
Tw
een
80 3
0 7.
5 2 0
0 50
45
.5
91
8.2
Jeon
20
12
[15]
E. c
oli c
onta
inin
g O
hase
from
E. m
enin
gose
ptic
a
TB
-med
ium
28
0.
02 M
Tri
s-H
Cl
30
8 14
00
1.7
0.26
15
0.
26
His
eni
2012
th
is w
ork
E. c
oli C
FE
con
tain
ing
Oha
se
from
E. m
enin
gose
ptic
a
TB
-med
ium
28
0.
02 M
Tri
s-H
Cl
30
8 14
00
1.7
0.56
33
0.
33
His
eni
2012
th
is w
ork
CL
EA
(fro
m r
ecom
bina
nt E
. men
ingo
sept
ica
Oha
se)
TB
-med
ium
28
0.
02 M
Tri
s-H
Cl
30
8 14
00
1.7
0.09
5,
3 0.
055
His
eni
2012
th
is w
ork
NR
: not
rep
orte
d
Supplementary table 5.1 Comparison of space-time yield for the production of 10-HAS by OHase.
Preparation and properties of immobilized oleate hydratase as a cross-linked enzyme aggregate (CLEA)
128
5.6 References
[1] R. A. Sheldon, "Green solvents for sustainable organic synthesis: state of the art," Green Chemistry,
vol. 7, pp. 267-278, 2005.
[2] N. Ran, et al., "Recent applications of biocatalysis in developing green chemistry for chemical
synthesis at the industrial scale," Green Chemistry, vol. 10, pp. 361-372, 2008.
[3] D. M. Alonso, et al., "Catalytic conversion of biomass to biofuels," Green Chemistry, vol. 12, pp.
1493-1513, 2011.
[4] R. A. Sheldon, "Utilisation of biomass for sustainable fuels and chemicals: Molecules, methods and
metrics," Catalysis Today, vol. 167, pp. 3-13, 2011.
[5] A. S. Carlsson, "Plant oils as feedstock alternatives to petroleum - A short survey of potential oil
crop platforms," Biochimie, vol. 91, pp. 665-670, Jun 2009.
[6] S. H. Elsharkawy, et al., "Microbial oxidation of oleic-acid," Applied and Environmental
Microbiology, vol. 58, pp. 2116-2122, Jul 1992.
[7] L. L. Wallen, et al., "The microbiological production of 10-hydroxystearic acid from oleic acid,"
Archives of Biochemistry and Biophysics, vol. 99, pp. 249-253, 1962.
[8] T. M. Kuo and W. E. Levinson, "Biocatalytic production of 10-hydroxystearic acid, 10-ketostearic
acid, and their primary fatty amides," Journal of the American Oil Chemists Society, vol. 83, pp.
671-675, Aug 2006.
[9] C. W. Seo, et al., "Hydration of squalene and oleic-acid by Corynebacterium sp. S-401,"
Agricultural and Biological Chemistry, vol. 45, pp. 2025-2030, 1981.
[10] B. N. Kim, et al., "Conversion of oleic acid to 10-hydroxystearic acid by whole cells of
Stenotrophomonas nitritireducens," Biotechnology Letters, vol. 33, pp. 993-997, May 2010.
[11] L. E. Bevers, et al., "Oleate hydratase catalyzes the hydration of a nonactivated carbon-carbon
bond," Journal of Bacteriology, vol. 191, pp. 5010-5012, Aug 2009.
[12] E. N. Davis, et al., "Microbial hydration of cis-9-alkenoic acids " Lipids, vol. 4, pp. 356-362, 1969.
[13] P. Marliere, "Method for producing an alkene comprising the step of converting an alcohol by an
enzymatic dehydration step," 2011.
[14] J. F. Jin and U. Hanefeld, "The selective addition of water to C=C bonds; enzymes are the best
chemists," Chemical Communications, vol. 47, pp. 2502-2510, 2011.
[15] E. Y. Jeon, et al., "Bioprocess engineering to produce 10-hydroxystearic acid from oleic acid by
recombinant Escherichia coli expressing the oleate hydratase gene of Stenotrophomonas
maltophilia," Process Biochemistry, vol. 47, pp. 941-947, 2012.
[16] Y. C. Joo, et al., "Biochemical characterization and FAD-binding analysis of oleate hydratase from
Macrococcus caseolyticus," Biochimie, vol. 94, pp. 907-915, 2012.
[17] Y. C. Joo, et al., "Production of 10-hydroxystearic acid from oleic acid by whole cells of
recombinant Escherichia coli containing oleate hydratase from Stenotrophomonas maltophilia,"
Journal of Biotechnology, vol. 158, pp. 17-23, 2012.
5.6 References
129
[18] B. N. Kim, et al., "Production of 10-hydroxystearic acid from oleic acid and olive oil hydrolyzate
by an oleate hydratase from Lysinibacillus fusiformis," Applied Microbiology and Biotechnology,
pp. 1-9, 2011.
[19] C. Mateo, et al., "Improvement of enzyme activity, stability and selectivity via immobilization
techniques," Enzyme and Microbial Technology, vol. 40, pp. 1451-1463, May 2007.
[20] R. A. Sheldon, "Cross-linked enzyme aggregates (CLEAs): stable and recyclable biocatalysts,"
Biochemical Society Transactions, vol. 35, pp. 1583-1587, Dec 2007.
[21] K. Hernandez and R. Fernandez-Lafuente, "Control of protein immobilization: Coupling
immobilization and site-directed mutagenesis to improve biocatalyst or biosensor performance,"
Enzyme and Microbial Technology, vol. 48, pp. 107-122, Feb 2011.
[22] R. A. Sheldon, "Cross-Linked Enzyme Aggregates as Industrial Biocatalysts," Organic Process
Research & Development, vol. 15, pp. 213-223, 2011.
[23] U. Hanefeld, et al., "Understanding enzyme immobilisation," Chemical Society Reviews, vol. 38,
pp. 453-468, 2009.
[24] C. Garcia-Galan, et al., "Potential of different enzyme immobilization strategies to improve enzyme
performance," Advanced Synthesis and Catalysis, vol. 353, pp. 2885-2904, 2011.
[25] R. A. Sheldon, "Enzyme immobilization: The quest for optimum performance," Advanced Synthesis
& Catalysis, vol. 349, pp. 1289-1307, Jun 2007.
[26] J. A. Hudson, et al., "Conversion of oleic acid to 10-hydroxystearic acid by two species of ruminal
bacteria," Applied Microbiology and Biotechnology, vol. 44, pp. 1-6, Dec 1995.
[27] A. Mehta, et al., "Rapid quantitation of free fatty acids in human plasma by high-performance liquid
chromatography," Journal of Chromatography B, vol. 719, pp. 9-23, Nov 1998.
[28] A. S. Bommarius and B. R. Riebel, "Biocatalysis in Non-conventional Media," in Biocatalysis, ed:
Wiley-VCH Verlag GmbH & Co. KGaA, 2005, pp. 339-372.
[29] I. Matijosyte, et al., "Preparation and use of cross-linked enzyme aggregates (CLEAs) of laccases,"
Journal of Molecular Catalysis B-Enzymatic, vol. 62, pp. 142-148, Feb 2010.
[30] B. S. Aytar and U. Bakir, "Preparation of cross-linked tyrosinase aggregates," Process Biochemistry,
vol. 43, pp. 125-131, Feb 2008.
[31] M. E. Ortiz-Soto, et al., "Evaluation of cross-linked aggregates from purified Bacillus subtilis
levansucrase mutants for transfructosylation reactions," Bmc Biotechnology, vol. 9, p. 68, 2009.
[32] D. P. Cistola, et al., "Ionization and phase behavior of fatty acids in water: application of the Gibbs
phase rule," Biochemistry, vol. 27, pp. 1881-1888, Mar 1988.
[33] L. Q. Cao, et al., "Cross-linked enzyme aggregates: A simple and effective method for the
immobilization of penicillin acylase," Organic Letters, vol. 2, pp. 1361-1364, May 2000.
[34] J. Zhou, "Immobilization of cellulase on a reversibly soluble-insoluble support: Properties and
application," Journal of Agricultural and Food Chemistry, vol. 58, pp. 6741-6746, 2010.
[35] A. Hiseni, et al., "Biochemical characterization of the carotenoid 1,2-hydratases (CrtC) from
Rubrivivax gelatinosus and Thiocapsa roseopersicina," Applied Microbiology and Biotechnology,
vol. 91, pp. 1029-1036, 2011.
Preparation and properties of immobilized oleate hydratase as a cross-linked enzyme aggregate (CLEA)
130
[36] B. Morvan and K. N. Joblin, "Hydration of oleic acid by Enterococcus gallinarum, Pediococcus
acidilactici and Lactobacillus sp. isolated from the rumen," Anaerobe, vol. 5, pp. 605-611, 1999.
[37] S. Koritala, et al., "Microbial conversion of oleic acid to 10-hydroxystearic acid," Applied
Microbiology and Biotechnology, vol. 32, pp. 299-304, 1989.
[38] A. Latrasse, et al., "Conversion of oleic acid to 10-hydroxystearic acid by Nocardia paraffinae,"
Biotechnology Letters, vol. 19, pp. 715-718, 1997.
[39] S. H. Heo, et al., "Production of oxygenated fatty acids from vegetable oils by Flavobacterium sp.
strain DS5," New Biotechnology, vol. 26, pp. 105-108, 2009.
Chapter 6
6 Conclusions and future prospects
Conclusions and future prospects
132
The study described in this thesis was set out to explore the potential of newly discovered
hydratases, carotenoid 1,2-hydratases (CrtC) from photosynthetic bacteria Rubrivivax
gelatinousus and Thiocapsa roseopersicina and oleate hydratase (OHase) from
Elizabethkingia meningoseptica, for their use as biocatalysts in industrial processes. In
order to do so, it was important to gain more insight in the activity, stability substrate scope
and structure-function relationship of these enzymes. When the research described in this
thesis started, limited or no literature was available on structural and mechanistic properties
of these two groups of hydratases. The work presented in this thesis sought to broaden the
structural, mechanistic and sequence-based knowledge required to define future research.
The main findings of this thesis are presented in the ‘Summary’ section of this thesis. This
chapter will evaluate the original question, which was posed at the start of the research
project, namely to evaluate if carotenoid 1,2-hydratases and oleate hydratases have
potential as industrial biocatalysts.
6.1 Carotenoid 1,2-hydratase
A comparative study of homologous carotenoid 1,2-hydratases sequences was successfully
applied to identify conserved residues within selected regions across the gene. Next to
mutagenesis of selected key residues and biochemical methods, which have proven to be
effective for determining the potential catalytic mechanism, the elucidation of a three-
dimensional structure is also pivotal to unravel the structure-function relationship of this
group of enzymes. Although, we made a homology model, which appeared to be accurate
since it can explain the mutants we made, the availability of a three-dimensional structure
would allow the application of site-saturated mutagenesis in residues governing the
property of interest and the generation of synergistic effects of neighboring mutations. In
addition, docking models can be used to predict the preferred orientation of substrates and
residues involved.
The work presented in this thesis has helped to shed light on structural and mechanistic
properties of carotenoid 1,2-hydratases. But also, it has clearly shown that their low
activities at present might prevent their successful utilization in industrial processes. The
fact that they are membrane-bound may have some advantages as it can be regarded as
natural immobilization. On the other hand, most enzymes used in industrial settings are
extracellular enzymes, as they require less downstream processing prior to catalysis and
Carotenoid 1,2-hydratase
133
they are more stable to external environmental perturbations. The overproduction of
carotenoid 1,2-hydratases is primarily limited to the membrane capacity of the host
organism. Therefore, the development of an effective expression system is of a high
importance. For instance, the usage of a host that is less sensitive to the toxic effects of
overexpressed membrane or membrane-bound proteins, which have possibly formed
aggregates due to space constrains, will form more biomass that can produce more protein
[1-6].
Another limitation of carotenoid 1,2-hydratases is the very low specific activity. This might
be due to either non-optimal assay conditions or the intrinsic property of membrane-bound
enzymes. High specific activity ensures sufficient space-time yield and makes the process
and reactor costs low. Therefore, the catalytic activity of these hydratases needs to be
improved, either by random mutagenesis, followed by site-saturated mutagenesis as a
means to further improve beneficial mutations obtained through random mutagenesis, or
by immobilization. As demonstrated by Umeno et al. [7] the evolvability of carotenoid
biosynthetic enzymes is remarkable. Carotenoid biosynthesis pathway appears to consist
of two groups of enzymes: ‘gatekeeper’ enzymes, which are located at the earliest steps of
the pathway and/or at important branch points and enzymes that are ‘locally specific’, i.e.
they recognize a particular structural motif of a possible substrate. The former dictate the
product diversity by allowing only certain molecules to enter the pathway and are therefore
expected to be very specific. Several researches have demonstrated the ability of these
enzymes to acquire new specificities after a limited genetic change. In contrast to the high
specificity of the ‘gatekeeper’ enzymes, ‘locally specific’ enzyme do not require this
property as they are placed at several locations in the pathway and are supposed to convert
more than one substrate. In case of a change upstream, which would allow a new compound
to enter the pathway, downstream enzymes are expected to be able to also metabolize this
new compound. Carotenoid 1,2-hydratase is such an enzyme that is less specific and
appears to recognize only a particular motif of the structure (-end group according to
carotenoid nomenclature). Thus, this fact predicts a good prospect for this enzyme to
metabolize unnatural substrates as long as it retains the required motif.
Overall, if it would be possible to address these two main issues, i.e. overexpression and
catalytic activity, this would significantly enlarge the potential of carotenoid 1,2-
hydratases. Future research could be the focus on optimizing additional enzyme properties,
such as substrate promiscuity, thermostability, solvent tolerance and activity at high
Conclusions and future prospects
134
substrate concentration. Nevertheless, the time that needs to be invested in order to make
this enzyme suitable for industrial process has to be balanced against the chances for
success in reasonable timeframe.
6.2 Oleate hydratase
Another hydratase with high potential for industrial biocatalysis is oleate hydratase. Since
the first paper was published on characterization of recombinantly overexpressed oleate
hydratase by Hagen et. al [8], the literature on oleate hydratase significantly expanded with
several papers, mostly with the work from the group of Oh [9-15] and Feussner [16, 17].
While the production of 10-hydroxystearic acid in high yields and biochemical
characterization of several recombinantly overexpressed oleate hydratases have been
extensively studied by Oh et al., the latter author succeeded very recently in elucidating the
first three-dimensional structure of the oleate hydratase from Lactobacillus acidophilus
(LAH). Despite the significant contribution of this work to the better understanding of
structural properties of LAH, the precise location of the active site and the involved
catalytic mechanism still remain unclear. The researchers were able to elucidate the crystal
structure of an apo-LAH and LAH co-crystallized with linoleic acid (LA-LHA), but both
without the co-factor FAD (lost during enzyme purification). In addition, the binding of the
substrate LA in the active site, was hindered by two MPD (2-methyl-2,4-pentanediol; used
as precipitating agent) molecules so that it stayed bound at the entrance of the substrate
channel. Nevertheless, given the fact that the LAH shares more than 50% amino acid
sequence similarity with the oleate hydratase from E. meningoseptica, which was studied
in this thesis work, it is likely to assume that these novel structural insights will partly help
to increase our understanding of the structural properties of oleate hydratases. Future
research of the study presented in this thesis, however, could attempt to crystallize oleate
hydratase from E. meningoseptica in the presence of a substrate analog in order to locate
the active site and amino acids necessary for binding of the substrate and catalysis. Once
the catalytic mechanism is unraveled and together with other newly gained structural data,
the analysis of the created mutants (Chapter 4) can be performed in more detail, which
again could give an indication of directions for further improvement of the catalytic activity
or substrate specificity.
High-throughput screening assay
135
With regard to formulating the enzyme by means of immobilization through cross-linking
(Chapter 5) in order to make it suitable for an economically feasible industrial process,
other methods than cross-linking need to be explored. As the product 10-hydroxystearic
acid is a solid, a method needs to be chosen which prevents the accumulation of the solid
product within the immobilized enzyme complex. This might be accomplished by
immediate removal of the product either by a physical isolation through a second phase or
by reacting the product further to produce a water soluble intermediate or a final product.
Overall, the good activity of OHase together with its straightforward expression system
makes this enzyme a promising candidate for future directed evolution studies.
6.3 High-throughput screening assay
A crucial part of any directed evolution study is a robust and selective high-throughput
screening assay, which can be used to isolate mutants with improved properties. The assay
allows testing of large number of mutants in a quick and efficient way. The developed
colorimetric high-throughput screening assay (Figure 6.1) with oleate hydratase as model
enzyme (Chapter 4) that can be used for the detection of primary, secondary and tertiary
alcohols, provides an adequate basis for screening a large amount of generated mutants.
Although the assay has been proven to be robust and applicable for many different
substrate/product pairs, the signal window needs further improvement.
The current status is that by using purified oleate hydratase instead of crude E. coli extracts,
the signal window could significantly be increased, allowing sufficient discrimination
between the noise and enzymatic activity. This result increases the chance of finding
mutants with improved properties, without having the risk of detecting false positive
mutants. Although enzyme purification can be performed in a high-throughput manner, it
would be of more interest to follow optimization approaches that prevent too high signal of
the noise or that increase the overexpression yield of the enzyme in a microtiter plate.
Besides the colorimetric assay developed by us, also calorimetric assays could contribute
to HTS of activity of these enzymes [18]. Calorimetry measures the absorbed or exerted
heat during bond breaking or making. This means that this assay is the universal assay for
enzymatic activity using real substrates instead of artificial ones. It is already shown in our
lab that the enthalpy of hydration is large enough to measure enzyme kinetics. Overall, this
Conclusions and future prospects
136
will allow the rate evaluation of activity, stability and substrate scope of large libraries of
mutants.
Figure 6.1 Schematic overview of the high high-throughput screening assay. The assay was developed for
the detection of enzymatic hydration activity assessed by selective spectrophotometric detection of alcohols.
Next to OHase and CrtC, other hydratases that also operate on (non-activated) double bonds
are continuously discovered by microbiologists [19]. Glycerol dehydratases (EC 4.2.1.30)
might be of interest for the dehydration of glycerol (a huge by-product of biodiesel
production) to get the building block 3-hydroxypropanol [20]. Also the very fast enzyme
enoyl-CoA hydratase (EC 4.2.1.17) could be investigated for promiscuous activities [21].
Although the promiscuous activity of an enzyme is usually orders of magnitudes lower than
the activity with the natural substrate, this could still be acceptable because of the almost
diffusion limited rate of this enzyme. The linalool dehydratase-isomerase (EC 4.2.1.127)
might be an interesting enzyme when looking at fatty acids, since it has its function in the
production of myrcene from linalool, a C10-terpene [22]. Hydroxycinnamoyl-CoA
hydratase-lyase (EC 4.2.1.101) could be used in the biosynthesis of the flavour compound
vanillin [23]. A key step is the addition of water to the thioester of ferulic acid, catalysed
by hydroxycinnamoyl-CoA hydratase lyase (HCHL, formerly feruloyl-CoA hydratase).
The hydration is immediately followed by a retro-aldol reaction, releasing the vanillin and
acetyl-CoA [24].
ACTIVITY SOURCE
ACTIVITY/SCREENING
ASSAY
ABSORPTION
MEASUREMENT
PLATE PROCESSING
DATA PROCESSING
High-throughput screening assay
137
In conclusion, I believe there is a bright future for hydratase enzymes and that there are
enough leads for follow-up research on the enzymatic hydration of double bonds. Our assay
can serve to explore these novel enzymes for their potential.
Conclusions and future prospects
138
6.4 References
[1] S. Wagner, et al., "Tuning Escherichia coli for membrane protein overexpression," Proceedings of
the National Academy of Sciences, vol. 105, pp. 14371-14376, September 23, 2008 2008.
[2] G. J. Gopal and A. Kumar, "Strategies for the production of recombinant protein in escherichia coli,"
Protein Journal, vol. 32, pp. 419-425, 2013.
[3] N. Gul, et al., "Evolved escherichia coli strains for amplified, functional expression of membrane
proteins," Journal of Molecular Biology, vol. 426, pp. 136-149, 2014.
[4] T. M. Lo, et al., "Microbial engineering strategies to improve cell viability for biochemical
production," Biotechnology Advances, vol. 31, pp. 903-914, 2013.
[5] D. M. Molina, et al., "Engineering membrane protein overproduction in Escherichia coli," Protein
Science, vol. 17, pp. 673-680, 2008.
[6] E. Gordon, et al., "Effective high-throughput overproduction of membrane proteins in Escherichia
coli," Protein Expression and Purification, vol. 62, pp. 1-8, 2008.
[7] D. Umeno, et al., "Diversifying carotenoid biosynthetic pathways by directed evolution,"
Microbiology and Molecular Biology Reviews, vol. 69, pp. 51-78, Mar 2005.
[8] L. E. Bevers, et al., "Oleate hydratase catalyzes the hydration of a nonactivated carbon-carbon
bond," Journal of Bacteriology, vol. 191, pp. 5010-5012, Aug 2009.
[9] B. N. Kim, et al., "Production of 10-hydroxystearic acid from oleic acid and olive oil hydrolyzate
by an oleate hydratase from Lysinibacillus fusiformis," Applied Microbiology and Biotechnology,
pp. 1-9, 2011.
[10] B. N. Kim, et al., "Production of 10-hydroxystearic acid from oleic acid and olive oil hydrolyzate
by an oleate hydratase from Lysinibacillus fusiformis," Applied Microbiology and Biotechnology,
vol. 95, pp. 929-937, 2012.
[11] B. N. Kim, et al., "Conversion of oleic acid to 10-hydroxystearic acid by whole cells of
Stenotrophomonas nitritireducens," Biotechnology Letters, vol. 33, pp. 993-997, May 2010.
[12] J. S. Kim, et al., "Identification and characterization of a novel nitrilase from Pseudomonas
fluorescens Pf-5," Applied Microbiology and Biotechnology, vol. 83, pp. 273-283, May 2009.
[13] K. R. Kim and D. K. Oh, "Production of hydroxy fatty acids by microbial fatty acid-hydroxylation
enzymes," Biotechnology Advances, 2013.
[14] Y. C. Joo, et al., "Biochemical characterization and FAD-binding analysis of oleate hydratase from
Macrococcus caseolyticus," Biochimie, vol. 94, pp. 907-915, 2012.
[15] Y. C. Joo, et al., "Production of 10-hydroxystearic acid from oleic acid by whole cells of
recombinant Escherichia coli containing oleate hydratase from Stenotrophomonas maltophilia,"
Journal of Biotechnology, vol. 158, pp. 17-23, 2012.
[16] A. Volkov, et al., "Crystal structure analysis of a fatty acid double-bond hydratase from
Lactobacillus acidophilus," Acta Crystallographica Section D: Biological Crystallography, vol. 69,
pp. 648-657, 2013.
References
139
[17] A. Volkov, et al., "Myosin cross-reactive antigen of Streptococcus pyogenes M49 encodes a fatty
acid double bond hydratase that plays a role in oleic acid detoxification and bacterial virulence,"
Journal of Biological Chemistry, vol. 285, pp. 10353-10361, 2010.
[18] M. J. Todd and J. Gomez, "Enzyme kinetics determined using calorimetry: A general assay for
enzyme activity?," Analytical Biochemistry, vol. 296, pp. 179-187, 2001.
[19] J. F. Jin and U. Hanefeld, "The selective addition of water to C=C bonds; enzymes are the best
chemists," Chemical Communications, vol. 47, pp. 2502-2510, 2011.
[20] S. Kwak, et al., "Biosynthesis of 3-hydroxypropionic acid from glycerol in recombinant Escherichia
coli expressing Lactobacillus brevis dhaB and dhaR gene clusters and E. coli K-12 aldH,"
Bioresource Technology, vol. 135, pp. 432-439, 2013.
[21] G. Agnihotri and H. W. Liu, "Enoyl-CoA hydratase: Reaction, mechanism, and inhibition,"
Bioorganic and Medicinal Chemistry, vol. 11, pp. 9-20, 2003.
[22] D. Brodkorb, et al., "Linalool dehydratase-isomerase, a bifunctional enzyme in the anaerobic
degradation of monoterpenes," Journal of Biological Chemistry, vol. 285, pp. 30436-30442, 2010.
[23] P. M. Leonard, et al., "The 1.8 Å resolution structure of hydroxycinnamoyl-coenzyme a hydratase-
lyase (HCHL) from Pseudomonas fluorescens, an enzyme that catalyses the transformation of
feruloyl-coenzyme A to vanillin," Acta Crystallographica Section D: Biological Crystallography,
vol. 62, pp. 1494-1501, 2006.
[24] J. P. Bennett, et al., "A ternary complex of hydroxycinnamoyl-CoA hydratase-lyase (HCHL) with
acetyl-CoA and vanillin gives insights into substrate specificity and mechanism," Biochemical
Journal, vol. 414, pp. 281-289, 2008.
Summary/Samenvatting
Summary/Samenvatting
142
Summary
The rapid development in the field of biotechnology over the last four decades, in addition
to an increasing recognition that we have limited resources and thus need to move to
renewable raw materials, have been drivers for the chemical industry to look at enzymes as
novel catalysts. In addition, enzymes are highly specific, thereby leading to high regio- and
chiral selectivities and less/no unwanted side reactions and byproducts. They generally
operate under mild conditions, resulting in energy savings. Overall, it is safe to state that
enzymes contribute to the environmentally sustainable processing.
Hydratases catalyze the non-hydrolytic and non-oxidative addition and/or removal of a
water molecule to a carbon-carbon double bond. From a chemical point of view, this
reaction is difficult to achieve and requires harsh conditions, such as high temperature and
low pH. In contrast, the enzymatic route proceeds under very mild conditions in a neutral
aqueous environment, yielding products in high yields and without undesired side
reactions. Therefore, there is significant interest in the application of hydratases as efficient,
selective and environmentally friendly biocatalyst. The research of this thesis focused on
two hydratases: carotenoid 1,2-hydratase (CrtC) and oleate hydratase (OHase).
CrtC is an enzyme found in the biosynthetic pathway of carotenoids. CrtC introduces a
tertiary hydroxyl group into a carotenoid molecule by addition of water to the carbon-
carbon double bond at the C-1 position. Another hydratase that has raised the attention of
researchers is OHase. OHase catalyzes the conversion of oleic acid (OA) into (R)-10-
hydroxystearic acid (10-HSA), a high-added value product used for the production of a
number of products, including resins, nylons, plastics, waxes, cosmetics and coatings. This
hydratase, as well as the carotenoid 1,2-hydratase, represents a new type of hydro-lyase as
it is able to hydrate an isolated carbon-carbon double bond.
In literature, a limited amount of data was available on the biochemical, structural and
mechanistic properties of these two hydratases. Therefore, it was decided to study these
enzymes with a focus on their structure-function relationship, thus allowing the evaluation
of the potential of these hydratases as industrial biocatalysts.
In Chapter 1, a general overview is given on enzymes and their application as biocatalysts
in various industries. Also, protein engineering tools used to overcome the limitations of
natural enzymes as biocatalysts at typical operating industrial conditions, such as high
substrate and salt concentrations, use of organic solvents, etc., are introduced. Our present
Summary/Samenvatting
143
knowledge on hydro-lyases and their utilization in industrial processes is highlighted.
Special attention is given to aspects of the structure-function relationship of the two studied
hydratases CrtC and OHase.
Chapter 2 describes the detailed biochemical characterization of two newly discovered
CrtC’s from photosynthetic bacteria Rubrivivax gelatinosus and Thiocapsa roseopersicina.
In order to investigate the biochemical properties, the enzymes were recombinantly
overexpressed and purified by affinity chromatography. It was demonstrated that both
CrtC’s were able to cofactor independently catalyze the conversion of the natural substrate
lycopene to 1-HO- and 1,1′-(HO)2-lycopene. In addition, low activity was detected with an
unnatural substrate geranylgeraniol (C20 substrate), which functionally resembles the
natural C40 substrate lycopene. Both CrtC’s are stable at a broad and suitable temperature
and pH range, which makes them attractive for green hydration reactions in industrial
applications. Although, the amino acid sequences of RgCrtC and TrCrtC differ by only one
amino acid (406 vs. 405), a structural difference has been observed by means of SDS-
PAGE and MS analysis. Whereas RgCrtC is expressed as a 44 kDa protein, TrCrtC exist
as a 38 kDa protein, most likely caused by autocatalytic processing.
In order to increase our understanding of the structure and mechanism of CrtC’s from
photosynthetic bacteria, protein engineering techniques site-directed evolution and semi-
rational mutagenesis were applied (Chapter 3). By generating alanine point-mutants of
selected amino acid positions, it was possible to elucidate the role of the amino acids
His239, Trp241, Tyr266 and Asp268 in RgCrtC (and the corresponding amino acids in
TrCrtC) and identify them as key residues, which are directly involved in the catalytic
reaction. By analyzing a partial 3D structure obtained by homology modeling with the
distantly related putative AttH protein from Nitrosomonas europaea it could be shown that
all identified amino acids were in close proximity to each other. All these results indicate
that the aforementioned amino acid residues are involved in the catalytic cycle.
When considering the generation of tailor-made biocatalysts for a successful utilization in
industrial processes, the availability of a suitable high-throughput screening or selection
method is a pre-requisite. The existence of such an assay will also determine the method of
choice for protein engineering. Due to limited existing structural and mechanistic
knowledge on hydratases studied in this thesis, a high-throughput screening assay for the
detection of alcohols, products of hydrating enzymes such as CrtC and OHase, was
developed (Chapter 4), which allows rapid screening of a large number of variants within
a reasonable timeframe. OHase from Elizabethkingia meningoseptica was used as the
Summary/Samenvatting
144
model enzyme to examine and characterize the capability of the developed method for
enabling an automated set up. The assay was able to detect primary, secondary and tertiary
alcohols in the presence of fatty acids as well as small cyclic and acyclic unsaturated
alkenes as substrates. Besides protein engineering techniques to improve the operational
performance of enzymes (e.g. thermo-stability, activity and solvent tolerance)
immobilization is a convenient approach towards stabilization. In Chapter 5 we report on
the immobilization of OHase as cross-linked enzyme aggregates (CLEA). For this purpose,
recombinant OHase from E. coli cell-free extracts was aggregated and cross-linked using a
bifunctional cross-linker glutaraldehyde. With an activity recovery of 26% after 21h cross-
linking at 4°C, CLEA’s preparation of OHase led to a 2.4-fold increase of biocatalyst
stability at elevated temperatures and better storage stabilities at cold temperatures.
Furthermore, up to 55-fold higher space-time yields were achieved with OHase CLEA’s
compared to microbial productions.
Overall, the work presented in this thesis has contributed to an understanding of the
structure-function relationship of two newly discovered hydratases: carotenoid 1,2-
hydratase and oleate hydratase. Furthermore, it may contribute to the development of a
biocatalyst that can be used for the production of high-added value compounds in industrial
processes.
Summary/Samenvatting
145
Samenvatting
De snelle ontwikkelingen op het gebied van de biotechnologie in de afgelopen vier
decennia, samen met de toegenomen bewustwording dat we over beperkte hoeveelheden
aan fossielen grondstoffen beschikken, en er een noodzaak bestaat om over te gaan naar
hernieuwbare grondstoffen, zijn aanleiding geweest voor de chemische industrie om
enzymen te ontwikkelen als nieuwe en hernieuwbare katalysatoren. De selectiviteit van
enzymen zorgt ervoor dat minder of geen ongewenste nevenreacties en bijproducten
worden geproduceerd. Daarnaast werken enzymen onder milde condities, wat bijdraagt aan
energiezuinige procescondities. Over het algemeen kan men dus stellen dat het gebruik van
enzymen als katalysatoren kan bijdragen aan duurzame processen.
Hydratases katalyseren de niet-hydrolytische en niet-oxidatieve additie en/of eliminatie van
een watermolecuul aan een koolstof-koolstof dubbele binding. Vanuit chemisch oogpunt is
deze reactie moeilijk uit te voeren en vereist extreme condities, zoals hoge temperaturen en
lage pH. Daarentegen verloopt de enzymatische route onder zeer milde omstandigheden in
een neutrale waterige omgeving, waardoor producten in hoge opbrengsten en zonder
ongewenste nevenreacties gemaakt kunnen worden. Daarom is het zeer relevant om
hydratases te bestuderen als efficiënte, selectieve en milieuvriendelijke biokatalysatoren.
Het onderzoek van dit proefschrift richt zich op twee enzymen: carotenoïd 1,2- hydratase
(CrtC) en oleaat hydratase (OHase).
CrtC is een enzym dat aanwezig is in de biosynthese route van carotenoïden. CrtC
introduceert een tertiaire hydroxyl groep in een carotenoïde molecuul door toevoeging van
water aan de koolstof-koolstof dubbele binding op de C-1 positie. Een ander hydratase dat
de aandacht van onderzoekers heeft getrokken is OHase. OHase katalyseert de omzetting
van oliezuur (OA) in (R)-10-hydroxystearinezuur (10-HSA), een product met hoge
toegevoegde waarde voor de productie van materialen zoals harsen, nylon, kunststoffen,
wassen, cosmetica en coating. Dit hydratase, evenals de carotenoïd 1,2-hydratase,
vertegenwoordigt een nieuw type hydro-lyase dat in staat is om een geïsoleerde koolstof-
koolstof dubbele binding te hydrateren.
In de literatuur is een beperkte hoeveelheid gegevens beschikbaar met betrekking tot de
biochemische, structurele en mechanistische eigenschappen van deze twee hydratases.
Daarom werd besloten om deze enzymen te bestuderen om meer inzicht te krijgen in de
Summary/Samenvatting
146
structuur-functie relatie en zodoende het potentieel van hydratases als biokatalysatoren in
industriële processen in kaart te brengen.
In Hoofdstuk 1 wordt een algemeen overzicht gegeven van enzymen en hun toepassing als
biokatalysatoren in diverse industrieën. Ook ‘protein engineering’ technieken die worden
gebruikt om de beperkingen van de natuurlijke enzymen als biokatalysatoren bij typische
operationele industriële omstandigheden te overwinnen, zoals hoge substraat- en
zoutconcentraties, gebruik van organische oplosmiddelen, etc., worden geïntroduceerd.
Onze huidige kennis over hydro-lyasen en hun gebruik in industriële processen wordt
daarbij benadrukt. Speciale aandacht wordt besteed aan aspecten van de structuur-functie
relatie van de twee bestudeerde hydratases CrtC en OHase.
Hoofdstuk 2 beschrijft de gedetailleerde biochemische karakterisering van twee nieuw
ontdekte CrtC’s van de fotosynthetische bacteriën Rubrivivax gelatinosus en Thiocapsa
roseopersicina. Om de biochemische eigenschappen te onderzoeken, werden de enzymen
recombinant tot overexpressie gebracht en gezuiverd middels affiniteitschromatografie. Er
werd aangetoond dat beide CrtC’s zonder de hulp van een cofactor de omzetting van het
natuurlijke substraat lycopeen naar 1-HO- en 1,1'-(HO)2-lycopeen konden katalyseren.
Bovendien werd lage activiteit gedetecteerd met het niet-natuurlijke substraat
geranylgeraniol (C20 substraat), dat structureel lijkt op het natuurlijke substraat lycopeen.
Beide CrtC’s zijn stabiel in een breed en gemiddeld temperatuur- en pH-bereik, waardoor
ze aantrekkelijk worden voor groene hydratatie reacties in industriële toepassingen. Hoewel
de theoretische eiwitgrootte van RgCrtC en TrCrtC slechts in één aminozuur verschilt (406
versus 405) is een structureel verschil waargenomen door middel van SDS-PAGE en MS-
analyse. Terwijl RgCrtC als een 44 kDa eiwit tot expressie wordt gebracht, bestaat TrCrtC
als een 38 kDa eiwit, waarschijnlijk veroorzaakt door autokatalytische verwerking.
Om onze kennis van de structuur en het mechanisme van CrtC’s uit fotosynthetische
bacteriën te verhogen, werden protein engineering technieken semi-gerichte evolutie (in
het engels semi-directed evolution) en semi-rationale mutagenese toegepast (Hoofdstuk
3). Door het genereren van specifieke alanine punt-mutanten van geselecteerde
aminozuurposities, was het mogelijk om de rol van de aminozuren His239, Trp241, Tyr266
en Asp268 in RgCrtC (en de overeenkomstige aminozuren in TrCrtC) te verduidelijken en
te identificeren als belangrijke residuen die direct betrokken zijn bij de katalytische reactie.
Door het analyseren van een gedeelte van de 3D-structuur, die verkregen is door homologie
modellering met het verwante AttH eiwit van Nitrosomonas europaea, kon worden
aangetoond dat alle geïdentificeerde aminozuren zich in directe omgeving van elkaar
Summary/Samenvatting
147
bevinden. Al deze resultaten zijn een eerste aanwijzing dat deze aminozuren betrokken zijn
bij de katalytische cyclus.
Voor onderzoek naar ‘op maat gemaakte biokatalysatoren’ is de beschikbaarheid van een
‘high-throughput screening’ of selectie methode een eerste vereiste. Het bestaan van een
dergelijke methode zal ook de keuze van de ‘protein engineering’ methode bepalen. Een
high-throughput screening test is ontwikkeld voor de detectie van alcoholen, de producten
van hydraterende enzymen zoals CrtC en OHase (Hoofdstuk 4). OHase van
Elizabethkingia meningoseptica werd als model enzym gebruikt om het vermogen van de
ontwikkelde methode voor het mogelijk maken van een geautomatiseerde opstelling te
onderzoeken en te karakteriseren. De test bleek in staat om primaire, secundaire en tertiaire
alcoholen te detecteren in de aanwezigheid van de start-verbinding: onverzadigde vetzuren
en kleine cyclische en niet-cyclische onverzadigde alkenen als substraten.
Naast ‘protein engineering’ technieken, die worden gebruikt om operationele prestaties van
enzymen (bijvoorbeeld thermostabiliteit, activiteit en oplosmiddel tolerantie) te verbeteren,
wordt ook immobilisatie toegepast voor stabilisatie van enzymen. In Hoofdstuk 5
beschrijven we de immobilisatie van OHase als verknoopte enzym-aggregaten (in het
Engels cross-linked enzyme aggregates (CLEA)). Hiervoor wordt het recombinante OHase
uit E. coli celvrije extracten geaggregeerd en verknoopt met een bi-functionele crosslinker
glutaaraldehyde. Met een activiteitsbehoud van 26% na 21 uur verknoping bij 4°C, leidde
de CLEA bereiding van OHase tot een 2,4-voudige toename van biokatalysator stabiliteit
bij verhoogde temperaturen en een betere opslagstabiliteit bij lage temperaturen. Bovendien
werden tot 55-voudig hogere ruimte-tijd rendement (in het Engels space-time yield) bereikt
met OHase CLEA’s ten opzichte van microbiële productie.
Samenvattend heeft het werk dat in dit proefschrift is uitgevoerd, bijgedragen aan een
begrip van de structuur-functie relatie van twee pas ontdekte hydratases: carotenoïd 1,2-
hydratase en oleaat hydratase. Bovendien kan het werk bijdragen tot de ontwikkeling van
een biokatalysator die kan worden gebruikt voor de productie van stoffen met hoge
toegevoegde waarde in industriële processen.
Acknowledgements
149
Acknowledgements The completion of this thesis has been a long journey, but I did it! At this point I would like
to thank all the important people who have contributed to this thesis in one way or another.
First, I am grateful to my promotor Prof. Isabel Arends for her guidance and encouragement
throughout these years. You are truly an inspiration for me.
Then, my deepest gratitude goes to my daily supervisor Dr. Linda Otten. Linda, your
absolutely supportive, positive attitude towards all aspects of my research was a great help.
Certainly, we had to find our way in the beginning as I was your first PhD student, but we
succeeded in finding a good way that worked for us (for sure, the fact that we were sitting
in the same office helped a lot). It was your support and encouragement, which helped me
to also manage all the difficult phases of my PhD time. You have been through a very
difficult phase yourself, but even then, you managed to always find time when I needed
advice, inspiration or critical comments. I am very glad that I have met you and I will
always be grateful for everything that you have done for me. You are a great person.
I would also like to thank Martin Gorseling for all the technical support. Martin, I am glad
that you have found the way to our group. You have made a very big, positive change in
our group and I am for sure not the only one who appreciates everything that you have
done. No matter what technical problem I had, you managed always to solve it very quickly.
Your knowledge about all apparatus is amazing and I learned a lot from you.
Now, I would like to take this opportunity to thank Mieke van der Kooij. Thank you for all
your help in administrative matters and beyond. It is amazing how you keep track on
everything and never forget to send a reminder if something is about to expire. Although,
we did not have many opportunities to talk, I always enjoyed our few short conversations
in your office.
Special thanks go to my paranymph Rosario Franco Berriel. You are an amazing person
and working with you was a lot of fun. I always enjoyed our lunches together and our
conversations about ‘Gott und die Welt’. Thank you for you friendship and I wish you and
your cute family the best for your future.
I extend my gratitude to the ‘other’ Rosario, Rosario Medici. I am amazed about your
knowledge and professionalism. Working hard and focused, helping each other and
performing experiments carefully and precisely, these all comes to my mind when I think
about you. I appreciate all the work that you have done in order to make the HTS-assay
Acknowledgements
150
publishable. I truly enjoyed working together with you and being friend with you. All the
best for your professional carrier and your lovely family.
Then, my colleagues and officemates from ENZ and BOC, whose longer or shorter
presence enriched the life at work. Thank you all for the nice time during my stay at the
TU-Delft and all the support. I was privileged to work in two groups and to learn from all
of you.
All the supports from my family and my family in-low are highly appreciated. I am indebted
to them.
Finally, my greatest thanks goes to my friend, my soul mate, my beloved husband Senad.
Thank you for all your love, support and understanding.
Curriculum vitae
151
Curriculum vitae Aida Hiseni was born on May 20, 1980, in Doboj (Bosnia and Hercegovina). She pursued
studies in Biology at the Heinrich-Heine-Universität, Düsseldorf, Germany, where she
received the Diplom degree in Biology in 2007. In the same year she moved to the
Netherlands and commenced her Ph.D. work in Biotechnology at the Delft University of
Technology. Since November 2011, Aida works as associate scientist at DSM in Delft.
Top Related