R

EM

CWNa

Bb

c

d

e

ARRA

KMIPTNIA

0h

Veterinary Immunology and Immunopathology 158 (2014) 53–61

Contents lists available at ScienceDirect

Veterinary Immunology and Immunopathology

j ourna l h omepa ge: www.elsev ier .com/ locate /vet imm

esearch paper

arly inflammatory response to the saponin adjuvantatrix-M in the pig

aroline Fossuma,∗, Bernt Hjertnera, Viktor Ahlberga,asin Charerntantanakula,b, Kathy McIntoshc, Lisbeth Fuxlera,

avisraj Balagunaseelana, Per Wallgrend, Karin Lövgren Bengtssone

Department of Biomedicine and Veterinary Public Health, Section for Immunology, Swedish University of Agricultural Sciences, P.O.ox 588, SE-751 23 Uppsala, SwedenResearch Laboratory for Immunity Enhancement in Humans and Domestic Animals Maejo University, Chiang Mai 50290, ThailandDepartment of Veterinary Microbiology, University of Saskatchewan, Western College of Veterinary Medicine, Saskatoon, CanadaNational Veterinary Institute, SVA, SE-751 89 Uppsala, SwedenIsconova AB, Kungsgatan 109, SE-753 18 Uppsala, Sweden

a r t i c l e i n f o

rticle history:eceived 3 December 2012eceived in revised form 20 July 2013ccepted 23 July 2013

eywords:atrix-M

SCOMigranscriptionalETs

RGsdjuvant

a b s t r a c t

The early inflammatory response to Matrix-M was evaluated in pigs. Adverse reactionsmeasured as body temperature, appetite, activity level and reaction at the site of injectionwere not observed after s.c. injection with three doses of the adjuvant (75, 100 or 150 �g)into one week old piglets. Analyses of the immediate cytokine response of PBMC afterin vitro exposure to Matrix-M (AbISCO-100®) revealed only a low expression of mRNA fortumour necrosis factor-� (p < 0.05) after 6 h incubation. Histological examination revealedan infiltration of leukocytes, haemorrhage and necrosis in muscle 24 h after i.m. injection of150 �g Matrix-M in pigs aged eleven weeks. At this time, different grades of reactive lym-phoid hyperplasia were recorded in the draining lymph node that was enlarged in threeof these six pigs injected with Matrix-M. The global transcriptional response at the site ofinjection and in the draining lymph node was analyzed using Affymetrix GeneChip PorcineGenome Array. A significant enrichment of gene signatures for the cell types described as“myeloid cells” and “plasmacytoid dendritic cells” was observed at the site of injection inMatrix-M injected pigs compared with pigs injected with saline. A number of genes encod-ing cytokines/chemokines or their receptors were upregulated at the injection site as wellas in the draining lymph node. In the draining lymph node, a majority of the upregulatedgenes were interferon-regulated genes (IRGs). The expression of IFN-�, but not IFN-�, wasincreased in the draining lymph nodes of a majority of the pigs exposed to Matrix-M. These

IFN-� expressing pigs also expressed increased levels of osteopontin (OPN) or stimulatorof interferon genes (STING), two factors known to facilitate the expression of type I IFNs inresponse to viral infection. Thus, Matrix-M does not appear to induce any harmful inflam-matory response in piglets whilst contributing to the innate immunity by activating the

possibl

type I IFN system,

∗ Corresponding author. Tel.: +46 018 4714056; fax: +46 018 4714382.E-mail address: Caroline.Fossum@slu.se (C. Fossum).

165-2427/$ – see front matter © 2013 Elsevier B.V. All rights reserved.ttp://dx.doi.org/10.1016/j.vetimm.2013.07.007

y through several alternative signalling pathways.© 2013 Elsevier B.V. All rights reserved.

1. Introduction

The immune-stimulating complex (ISCOM) is anantigen-presenting system in which antigens are incor-porated into a matrix of the saponin adjuvant QuilA, formulated into particles together with cholesterol

ogy and

54 C. Fossum et al. / Veterinary Immunol

and phospholipid (Morein et al., 1984). The formulationsoon proved useful for a number of membrane-derivedantigens for induction of the protective immunity tovarious microorganisms (Morein, 1987, 1988). Electronmicroscopy demonstrated the formation of a sphericalcage-like structure, 40 nm in size, regardless of the sourceof antigen. A standardized methodology and mixture ofQuil A, cholesterol and phophatidylcholine was establishedfor incorporation of amphipathic antigens (reviewed inLövgren Bengtsson and Morein, 2000). Later, it was realizedthat incorporation of antigens into the ISCOM structurewas not necessary for potent immune stimulation (Lövgrenand Morein, 1988; Lövgren Bengtsson and Sjölander, 1996).Pre-formed ISCOMs without incorporated antigen, calledISCOM-Matrix and later referred to as Matrix, became usedas stand-alone adjuvant, simply mixed with antigens.

The glycosidic saponins, extracted from the bark of thetree Quillaja saponaria Molina (Quil A), in free form, havebeen used as adjuvant for almost a century (reviewed inDalsgaard et al., 1990). Quil A is a potent adjuvant; how-ever, free saponins have haemolytic activity that may causeside effects. By formulation of saponins with cholesteroland phospholipids in ISCOMs or in Matrix particles, thehaemolytic activity is abolished and a more potent and lessreactogenic adjuvant is created. The Matrix made from QuilA or similar preparations are currently called Matrix-Q.

Biochemical separation techniques revealed that thelytic and structure forming capacities of Quil A weremainly restricted to different fractions (Kensil et al., 1991;Rönnberg et al., 1995) and that various combinationsof these components affected the adjuvant propertiesconsiderably (Johansson and Lövgren-Bengtsson, 1999).Detailed biochemical and functional characterisations ofthe saponin fractions have resulted in a very well-tolerated Matrix formulation called Matrix-M. Matrix-Mis a mixture of Matrix particles made from two dif-ferent purified fractions of Quillaja derived saponins.Matrix-MTM (Isconova AB, Uppsala, Sweden) is a potentadjuvant that is licensed for several animal vaccinesand now also has entered human clinical trials (LövgrenBengtsson et al., 2011). Another similar, albeit differ-ent product based on the ISCOM technology is theISCOMATRIX® adjuvant (CSL; Commonwealth Serum Lab-oratories, Melbourne, Australia). MatrixTM formulationsare available in various forms and recommended for dif-ferent species according to their saponin sensitivity andthere are two preparations available for research pur-poses, AbISCO-100® (Matrix-M type) and AbISCO-300®

(Matrix-Q type).Attempts to explore the power of Matrix formula-

tions on immune parameters have mainly been carriedout in mice. These studies have revealed a prominentrecruitment and activation of cells in the draininglymph node/spleen, antigen delivery to dendritic cellsaccompanied by cytokine and chemokine production.This allows for cross-presentation with the subsequentinduction of cytotoxic T cells and a long-lasting antibody

response (Duewell et al., 2011; Morelli et al., 2012;Reimer et al., 2012). However, which molecular path-way(s) are activated by the Matrix of ISCOM is still notclarified.

Immunopathology 158 (2014) 53–61

In the pig, early experimental ISCOM/Matrix-Q vac-cines focused on Aujeszky’s Disease Virus (Tsuda et al.,1991; Puentes et al., 1993; Tulman and Garmendia, 1994),rotavirus (Iosef et al., 2002; Nguyen et al., 2003; Gonzálezet al., 2004; Nguyen et al., 2006a; Azevedo et al., 2010), andthe use of virus-like particles in combination with ISCOM-Matrix (Tulman and Garmendia, 1994). The latter concepthas been used successfully in young pigs, inducing an activeimmune response even in the presence of maternal immu-nity (Nguyen et al., 2006b; McIntosh et al., manuscript) asalso shown for other ISCOM formulations applied in calves(Hägglund et al., 2004) or mice (Morein et al., 2007).

Taken together, Matrix-M appears as a promising adju-vant also in the pig where improved vaccines to severaldiseases are desirable. The pig is also a valuable model forstudies of adjuvant effects in man because of many simi-larities between the species in the organization of innateimmune cells and their cytokine production (Auray et al.,2010; Bertho et al., 2011; Faibairn et al., 2011; Marquetet al., 2011; Kapetanovic et al., 2012). To reflect the earlyinflammatory response to Matrix-M in the pig, resultsfrom in vitro studies using porcine blood mononuclear orpolymorphonuclear cells are reported here together withresults from an in vivo toxicity test carried out in piglets. Thefindings are related to the global transcriptional responseto Matrix-M recorded in pigs at the site of injection and inthe draining lymph node (Ahlberg et al., 2012).

2. Materials and methods

2.1. Animals and experimental designs

Five experimental set ups were used to study the earlyinflammatory response to the Matrix of ISCOMs in the pig.An animal toxicity study was carried out in one-week oldPIC-crossbred piglets, housed in a 600 sow commercialswine farrow-to-finish facility in Saskatchewan, Canada(Set I). In vitro cellular toxicity studies were performed withPBMC (Set II) and polymorphonuclear neutrophil leuko-cytes (PMNL; Set III) purified from the blood of finishingpigs housed in a specific pathogen free herd (Wallgren et al.,1999; Swedish Livestock Research Centre, Lövsta-Uppsala,Sweden). In vitro induced expression of cytokine mRNA (SetIV) was determined using PBMC obtained from convention-ally reared pigs at the University Research Station (FunboLövsta, Uppsala, Sweden) whereas in vivo induced expres-sion of mRNA for interferon-related genes (Set V) wasstudied in lymph nodes obtained from 11 weeks old SPF-pigs (Ahlberg et al., 2012). All procedures were conductedin accordance with the University of Saskatchewan’s Com-mittee for Animal Care and Supply (permit #20060004)and with the Ethical Committee for Animal Experiments,Uppsala, Sweden.

2.2. In vivo evaluation of Matrix-Q toxicity (Set I)

The potential for adverse reactions was tested by the

s. c. injection of variable doses of Matrix-Q (Isconova AB,Uppsala, Sweden) into one-week-old piglets. Piglets wereinjected with either 75 �g (n = 3), 100 �g (n = 3), or 150 �g(n = 3) of the Matrix-Q diluted in sterilized 0.01 M PBS to

ogy and

astoaa

2

b(PgscStPtwiTdB

2

3arlc(cw(8ne

RoseapaatcfGb(ctbBc

C. Fossum et al. / Veterinary Immunol

final volume of 200 �L using a 1 mL-25 gauge needle. Aingle injection was administered subcutaneously 1 cm offhe dorsal midline between the shoulders and piglets werebserved 7 times over a period of 30 h for rectal temper-ture, injection site reactivity (swelling, redness, or pain),nd activity level (active or lethargic).

.3. In vitro evaluation of Matrix-M toxicity (Set II)

The viability of PBMC was evaluated after 18 h incu-ation in the presence of 0.3, 1 or 3 �g Matrix-MAbISCO-100®; Isconova AB) per ml culture medium.BMCs were isolated from heparinized blood by densityradient centrifugation on Ficoll-Paque (Pharmacia, Upp-ala, Sweden). The cell viability was determined by flowytometry (FACSCanto flow cytometer; BD Biosciences,an Jose, CA) using the Annexin V-FITC Apoptosis Detec-ion Kit I with Propidium Iodide (PI) staining solution (BDharmingenTM, San Jose, CA) as recommended. Parallel cul-ures with PBMC incubated in growth medium or treatedith UV-light (480 mJ for 90 s) before incubation were

ncluded as negative and positive controls, respectively.en thousand events per sample were collected and theata were analyzed using the FACSDiva software (v. 5.0.2,D Biosciences).

.4. In vitro effects of Matrix-M on PMNL activity (Set III)

Heparinized blood was diluted with an equal volume of% Dextran (T-2000, Pharmacia Biotech, Uppsala, Sweden)nd allowed to sediment for 30 min at RT. The leucocyteich fraction was washed once in PBS, resuspended andayered on a discontinuous gradient of 70% and 80% Per-oll (GE Healthcare, Uppsala, Sweden). After centrifugation300 × g) for 25 min, cells in the two bands generated wereollected, the cell numbers were counted and the purityas determined on cytospin glasses stained with Diff Quick

Vector Lab Inc., Burligame, CA). The cells recovered on the0% Percoll cushion were enriched for PMNL (91.8 ± 6.1%,

= 20) and used for studies of the formation of neutrophilxtracellular traps (NETs).

The PMNL were washed twice in PBS and resuspended inPMI 1640 supplemented with HEPES, l-glutamine antibi-tics and 2% BSA (Sigma–Aldrich®). Two millilitre celluspension (107 neutrophils per ml) was seeded on cov-rslips in six well plates (Costar®) and incubated for 1 ht 37 ◦C. Thereafter, 400 �l medium (negative control) orhorbol 12-myristate 13-acetate (PMA; Sigma–Aldrich®)t a final concentration of 100 nM (positive control) weredded to the wells. The effect of Matrix-M was tested athe final concentrations of 0.3, 1 and 3 �g/ml in parallelultures. After 4 h of incubation the medium was care-ully removed from the wells and 1 ml of 50 nM Sytoxreen (Invitrogen) was added to each well and incu-ated in the dark for 10 min. Thereafter formaldehydeProlaboTM, Taipan, Malaysia) was added to a final con-entration of 4% per well and incubated for 30 min before

he coverslip was carefully removed and allowed to dryefore mounted in Vectashield with DAPI (Vector Lab Inc.,urligame, CA). The morphology of cell nucleus and extra-ellular DNA fragments were determined in a fluorescence

Immunopathology 158 (2014) 53–61 55

microscope (Nikon, Microphot-FX, Nikon Instruments Inc.,Tokyo, Japan) equipped with a digital camera (Coolpix 990,Nikon) for documentation.

2.5. In vitro Matrix-M induced expression of cytokinegenes (Set IV)

The effect of Matrix-M on the expression of cytokinemRNA by porcine PBMC was tested in vitro and com-pared to that induced by the CpG-ODN 2216 (CybergeneAB, Huddinge, Sweden) or LPS (Sigma Aldrich, Stein-heim, Germany), using methods detailed elsewhere (BolindBågenholm, 2009; Wikström et al., 2011). All inducers werediluted in RPMI 1640 medium (BioWhittaker, CambrexBioscience, Verviers, Belgium) supplemented with 20 mMHEPES buffer, 2 mM l-glutamine, 200 IU penicillin/ml,100 �g/ml streptomycin, 0.5 �M 2-mercaptoethanol and5% foetal calf serum (Invitrogen, Life Technologies, Carls-bad, CA, USA). Three ml cell cultures (final concentration5 × 106 cells per ml) were established in 25 cm2 tissue cul-ture flasks (Nunc, Roskilde, Denmark) containing Matrix-M(1 �g/ml), LPS (10 �g/ml), ODN 2216 (5 �g/ml) or onlygrowth medium. After 6 hours incubation at 37 ◦C, totalRNA was extracted, quality tested and DNA:se treatedbefore 2 �g of RNA was used for cDNA synthesize asdescribed (Wikström et al., 2011).

Real-time TaqMan PCR was performed for IFN-�, IFN-�, IL-6, IL-10, IL-12p40, IL-1�, TNF-�, TGF-�, CXCR4,RGS16 and two reference genes, Cyclophilin A (CyA)and Hypoxanthine-guanine phosphoribosyl transferase(HPRT), using previously published primers and protocols(Wikström et al., 2011). The relative expression of targetgenes induced by Matrix-M, LPS or ODN 2216 was com-pared to their expression in PBMC cultured in plain growthmedium according to Livak and Schmittengen (2001), usingCy A and HPRT as reference genes.

2.6. In vivo transcriptional response to Matrix-M (Set V)

Pigs were injected i.m. with either 150 �g Matrix-Msuspended in 1 ml sterile endotoxin-free 0.9% NaCl solu-tion (n = 6) or just saline (n = 6). Twenty four h afterinjection, pigs were necropsied and tissues from the siteof injection and their draining lymph nodes were col-lected and analyzed for early transcriptional response usingAffymetrix GeneChip® Porcine Genome Array as detailedin Ahlberg et al. (2012). This was followed up by a morecomprehensive expression analysis focusing on IFN-�, IFN-�, osteopontin (OPN) and stimulator of interferon genes(STING) in the draining lymph node. Sample preparation,RNA extraction and analysis, and cDNA construction aredetailed in Ahlberg et al. (2012).

Primer pairs for IFN-�, IFN-�, OPN, riboso-mal protein L32 (RPL32), STING and tyrosine3-monooxygenase/tryptophan 5-monooxygenase activa-tion protein (YWHAZ) were chosen from published worksfavouring those spanning an intron, and reoptimized in

house (Table 1). SYBR Green PCR was run as describedpreviously (Hjertner et al., 2013). Using PCR base linenormalized Cq values the expression of IFN-�, IFN-�,OPN and STING was normalized to the geometric average

56 C. Fossum et al. / Veterinary Immunology and Immunopathology 158 (2014) 53–61

Table 1Primer details and gene specific optimized conditions.

Gene Primer sequence Primer location Target sequence Annealtemp (◦C)

Primerconc (nM)

E (%)g r2 Melt point(◦C)

IFN-�a F:AGCCTCCTGCACCAGTTCTG 346–365 NM 214393.1 60 500 100 0.997 84.5R: TCACAGCCAGGATGGAGTCC 469–450

IFN-�b F: TAGCACTGGCTGGAATGAAACC 288–309 NM 001003923.1 58 400 104 0.993 79.5R: TCAGGTGAAGAATGGTCATGTCT 427–405

OPNc F: TTGGACAGCCAAGAGAAGGACAGT 731–754 NM 214023.1 56 300 93 0.997 82.5R: GCTCATTGCTCCCATCATAGGTCTTG 851–826

RPL32d F: CGGAAGTTTCTGGTACACAATGTAA 249–273 NM 001001636.1 55 300 97 0.997 77R: TGGAAGAGACGTTGTGAGCAA 342–322

STINGe F: TTACATCGGGTACCTGCGGC 489–508 NM 001142838.1 56 500 101 0.992 82R: CCGAGTACGTTCTTGTGGCG 572–553

YWHAZf F: ATTGGGTCTGGCCCTTAACT 961–980 XM 001927228.4 58 400 101 0.997 78.5R: GCGTGCTGTCTTTGTATGACTC 1106–1085

a Wikström et al. (2011).b Lin et al. (2013).c White et al. (2005).d Dawson et al. (2004).

Medium

0.3 M

atrix

1 Matr

ix

3 Matr

ix UV0

5

10

15

20Pe

rcen

tage

a

Medium

0.3 M

atrix

1 Matr

ix

3 Matr

ix UV0

20

40

60

80

100

Perc

enta

ge

b

e Xie et al. (2010).f Uddin et al. (2011).g Efficiency from serial dilutions of reference cDNA.

of RPL32 and YWHAZ (Vandesompele et al., 2002), andcalibrated to the average expression in all six control pigs.

2.7. Statistical analyses

Statistical differences in mRNA expression for IFN-�,IFN-�, STING and OPN between pigs injected with Matrix-M or saline were analyzed using the non-parametricMann–Whitney test whereas statistical differences for var-ious in vitro treatments were determined using the pairedStudent’s t-test (GraphPad Prism version 5.0 for Mac OS X,GraphPad Software, San Diego, CA). p-Values ≤ 0.05 wereregarded as significant. For all statistical analyses detailedin Ahlberg et al. (2012), q-values, i.e., p-values corrected formultiple testing were used.

3. Results and discussion

3.1. In vivo evaluation of Matrix-Q toxicity (Set I)

The safety of saponin-based Matrix adjuvants in pigswas studied with Matrix-Q in one-week-old piglets. Noadverse reactions were observed at the injection sitenor was the activity level of any piglet during the 30 hperiod after injection with the Matrix-Q affected. Theexpected normal rectal temperature of a suckling piglet>24 h of age is 39.2 ± 0.3 ◦C (Straw et al., 1999). Takinginto consideration the baseline rectal temperature of eachpiglet (temperature prior to injection), one piglet at 30 hpost-injection recorded a low grade fever of 39.6 ◦C (a tem-perature greater than 0.3 ◦C above its baseline temperatureand greater than 39.5 ◦C). However, this piglet received thelowest dose of Matrix-Q of 75 �g.

3.2. In vitro evaluation of Matrix-M toxicity (Set II)

The effect of Matrix-M on cell survival was testedin vitro using PBMC obtained from five pigs (Fig. 1). After18 h of culture the proportion of Annexin labelled cells

Fig. 1. Percentage of apoptotic (a) or dead (b) porcine PBMC after 18 h ofincubation in the presence of 0.3, 1 or 3 �g per ml of Matrix-M. The cor-responding figures for PBMC incubated in medium or UV-treated beforeincubation are included as negative and positive controls, respectively.

ogy and Immunopathology 158 (2014) 53–61 57

tcogtgwigwmpc

3

tSltcvmwrb

eMtgepntocwgictotIp

3M

aiTdmIi�o

Table 2Significant differences in relative mRNA expression determined by qPCR.RNA was isolated after 6 h culture of porcine PBMC in the presenceof Matrix-M (1 �g/ml), LPS (10 �g/ml), ODN 2216 (5 �g/ml) or in plaingrowth medium.

Target gene Matrix-M vs.medium (pvalue)

LPS vs. medium(p value)

ODN 2216 vs.medium (pvalue)

IFN-� ns * **

IFN-� ns ns *

IL-6 ns *** *

IL-10 ns *** *

IL-1� ns *** nsTNF-� * ** *

TGF-� ns * nsIL-12p40 ns ** *

CXCR4 ns ns **

RGS16 ns ns ns

ns: not significant.

haemorrhage and necrosis in muscle after 24 h. At thistime, different grades of reactive lymphoid hyperplasiawere recorded in the draining lymph node that showed a

C. Fossum et al. / Veterinary Immunol

hat were negative for PI was in mean 12.6 ± 4.6% forells incubated in the presence of Matrix-M, regardlessf concentration. This was similar to cells incubated inrowth medium (11.7 ± 2.7%) but higher than for thosehat were UV-treated (6.7 ± 3.5%) prior to incubation. Areat proportion (74.5 ± 16.4%) of the UV-treated PBMCas however stained with both PI and Annexin indicat-

ng a low cell survival. The corresponding figure for PBMCrown in various concentrations of Matrix M (12.2 ± 3.7%)as again very similar to that for PBMC grown in cultureedium (12.6 ± 2.3%). Thus, Matrix M did not induce apo-

tosis or increase cell death during the present cultureonditions.

.3. In vitro effects of Matrix-M on PMNL activity (Set III)

The ability of Matrix-M to induce formation of NETs wasested in vitro using porcine PMNL obtained from pigs in aPF herd. The number of PMNL recovered per ml blood wasow due to the high health status, and prior activation ofhem in vivo was less likely than for PMNL obtained fromonventionally reared pigs. In accordance, no signs of acti-ation were evident after 4 h incubation in plain growthedium (Fig. 3a) whereas a high proportion of neutrophilsith a condensed nucleus, showing signs of NETosis and

elease of NETs was observed among the neutrophils incu-ated with PMA (Fig. 3b and c).

The effect of Matrix-M on the neutrophils was lessvident. In the cultures supplemented with 0.3 or 1.0 �gatrix-M per ml (Fig. 3d and e) the nucleus of the neu-

rophils showed the same shape as those incubated in plainrowth medium. Among neutrophils cultured in the pres-nce of 3 �g Matrix-M per ml (Fig. 3f) a slightly higherroportion of the neutrophils had a condensed nuclei buto NET formation was detected. Prolonged incubation, upo 16 h, affected the survival of the neutrophils regardlessf culture set up. Still, no NET formation was observed inultures supplemented with Matrix-M or in the culturesith plain growth medium. Instead, the nuclei of PMNL

rown over night in the presence of Matrix-M were dis-ntegrated into small Sytox-stained fragments dispersed inonsiderably swelled cells or around disrupted cells, givinghe impression of a pyroptotic cell death. The activationf cathepsin genes (CTSB, CTSD, CTSH, CTSS and CTSZ) athe injection site and the up regulation of the genes forL-1� and IL-18 (Table 5, Ahlberg et al., 2012) agree withyroptosis (Labbé and Saleh, 2011).

.4. Early cytokine response of PBMC exposed toatrix-M in vitro (Set IV)

Analyses of the immediate cytokine response of PBMCfter in vitro exposure to Matrix-M revealed a low levelnduction of TNF-� mRNA (p < 0.05) after 6 h incubation.he mRNA expression for the other cytokines analyzedid not differ from that of PBMC cultured in plain growthedium. In comparison, mRNA specific for IL-1�, IL-6 and

L-10 (p < 0.001), and IL-12p40 and TNF-� (p < 0.01) wasnduced after 6 h exposure of the PBMC to LPS, and IFN-

mRNA (p < 0.01) was induced after 6 h in the presencef the ODN 2216. Thus, Matrix-M did not evoke any strong

* p ≤ 0.05.** p ≤ 0.01.

*** p ≤ 0.001.

immediate pro-inflammatory cytokine response in porcinePBMC when tested in vitro. These results are in agreementwith the absence of fever and local reactions in the tox-icity tests but caution should be taken regarding the factthat these studies were performed in cultures of purifiedlymphoid cells, devoid of PMNL and possibly also lackingimportant soluble factors produced by other cells.

3.5. Global transcriptional response to Matrix-M at thesite of administration and in draining lymph node (Set V)

In order to better reflect the immune stimulatory prop-erties of Matrix-M the global transcriptional response wasanalyzed following i.m. administration of 150 �g Matrix-Min pigs aged eleven weeks (Ahlberg et al., 2012). Histo-logical examination revealed an infiltration of leukocytes,

Fig. 2. Interferon-regulated genes (IRGs) upregulated at the injection site(n = 36) and/or draining lymph node (n = 38) 24 h after Matrix-M admin-istration. The ten most up-regulated IRGs in each group are listed. IRGswere defined by the database Interferome (http://www.interferome.org).

ogy and

58 C. Fossum et al. / Veterinary Immunol

moderate enlargement in three of the six pigs injected withMatrix-M. These observations (Table 2 and Fig. 1; Ahlberget al., 2012) were well in line with the absence of visi-ble signs of inflammation when pigs were injected witha similar dose of Matrix-Q and the marginal indication ofa pro-inflammatory cytokine response in porcine PBMCexposed to Matrix-M in vitro.

As reported in Ahlberg et al. (2012), an inflammatoryresponse to Matrix-M at the injection site was evidentfrom the enrichment of genes in gene ontology (GO)terms such as ‘immune response’ (q = 1.4E−10), ‘responseto wounding’ (q = 1.4E−9), ‘defence response’ (q = 5.1E−9),‘inflammatory response’ (q = 7.4E−9), ‘positive regula-tion of immune system process’ (q = 2.1E−4) and ‘innateimmune response’ (q = 7.2E−4). The corresponding analy-sis of gene regulation in the draining lymph node (Ahlberget al., 2012) revealed an enrichment of up regulated genesin the GO-terms ‘immune response’ (q = 9.9E−6), ‘responseto virus’ (q = 4.6E−4), ‘defence response’ (q = 2.3E−3), ‘reg-ulation of cell proliferation’ (q = 1.1E−2) and ‘behaviour’(q = 4.8E−2).

Cell migration patterns induced by Matrix-M werecharacterized by enrichment for “myeloid cells” and inparticular by plasmacytoid dendritic cells (pDC). Thisprofile, together with the prominent up regulation of a

Fig. 3. Porcine neutrophilic granulocytes incubated for 4 h in plain growth medium(c) or 0.3 �g (d), 1 �g (e), 3 �g (f) Matrix-M per ml.

Immunopathology 158 (2014) 53–61

considerable number of interferon regulated genes (IRGs),both at the site of injection and in the draining lymph node(Fig. 2) initiated studies on possible mechanisms for induc-tion of IFN production by Matrix-M. Because the genesfor two cytosolic RNA-sensing receptors (RIG-1 and MDA5)both were upregulated as well as MyD88 that mediatessignalling via TLR7 and TLR9, it was tempting to specu-late that nucleic acid played a part in the induction ofIRGs.

In patients with the autoimmune disorder systemiclupus erythematosus (SLE), self-DNA released from PMNLin the form of NETs can trigger pDC to produce IFN-�(Lande et al., 2011). In that case autoantibodies to DNAare thought to mediate the uptake and delivery of DNA toendosomal TLR9. One of the advantages with the ISCOMsis their ability to deliver antigen to the cytosol allowingpresentation of antigen on MHC class I molecules and theinduction of a cytotoxic T cell response (Takahashi et al.,1990). Therefore, Matrix-M could in theory mediate trans-port of any associated nucleic acid over cell membrane(s)and thereby initiate an IFN-response. The studies of PMNL

exposed to Matrix-M in vitro (Set III) did however not sup-port the hypothesis that Matrix-M induced NET formation,although a prominent influx of neutrophils were recordedafter in vivo administration.

(a), 100 nM PMA, 20× magnification (b), 100 nM PMA, 40× magnification

C. Fossum et al. / Veterinary Immunology and Immunopathology 158 (2014) 53–61 59

IFN-αα

1 2 3 4 5 6 7 8 9 10 11 120.0

0.5

1.0

1.5

2.0

Rel

ativ

e ex

pres

sion

IFN-ββ

1 2 3 4 5 6 7 8 9 10 11 120

10

20

30

40

OPN

1 2 3 4 5 6 7 8 9 10 11 120

5

10

15

Matrix Sali ne

Rel

ativ

e ex

pres

sion

STING

1 2 3 4 5 6 7 8 9 10 11 120

1

2

3

4

Matrix Sali ne

F lymph ne Z and ci atistica

3(

weSMrdi(iiiMclonbw(

bcI

ig. 4. Relative expression of IFN-�, IFN-�, OPN and STING in the iliac

xpression was normalized to the geometric average of RPL32 and YWHAn expression between Matrix-M treated and saline treated groups was st

.6. In vivo effects of Matrix-M on IFN-related responsesSet V)

The indicated IFN response in pigs early after injectionith Matrix-M was followed up with an analysis of the

xpression of IFN-� and -�, as well as OPN (SPP1) andTING in the draining lymph nodes of pigs that receivedatrix-M (n = 6) or just saline (n = 6). OPN and STING have

ecently been identified as two modulators acting on twoifferent pathways that signal the expression of IFN-�/�

n response to viral infections as reviewed by Levy et al.2011). OPN, which had more than a hundred-fold increasen expression at the site of injection (Ahlberg et al., 2012)s an essential factor for endosomal TLR7/9 dependentnduction of IFN-�/� expression via the adaptor molecule

yD88 (Shinohara et al., 2006). STING is essential forytoplasmic foreign DNA sensor signalling, as well as RIG-ike receptor (RLR) signalling, acting through recruitmentf TBK1 (Ishikawa et al., 2009). Furthermore, recently aew innate detection mechanism involving STING/TBK1ut independent of TLR and RLR pathways was described,hich was triggered by virus-cell membrane fusion only

Holm et al., 2012).

Transcripts from IFN-�, IFN-�, OPN and STING could

e detected in the lymph node of all pigs except for twoontrol pigs, which had no detectable IFN-� expression.n this case a Cq value of 40 was assigned. The relative

ode of pigs exposed to Matrix-M (nos. 1–6) or saline (nos. 7–12). Thealibrated to the average expression of all six control pigs. The differencelly significant (p < 0.05) for IFN-� and OPN.

expression of IFN-� was always less than two with nodifference in expression between Matrix M-treated andcontrol pigs (Fig. 4). However, four pigs (nos. 1, 2, 3 and 6)out of the six Matrix-M-treated pigs showed elevated IFN-� levels (p < 0.05) compared to the control group (Fig. 4).In three of these pigs (nos. 1, 3 and 6) the relative expres-sion of OPN was increased. The expression of OPN in theMatrix-M treated group of pigs was significantly (p < 0.05)higher than in the control group (Fig. 4). The fourth pig withelevated IFN-� expression (no. 2) had an OPN expressionlevel comparable to the control pigs but in this pig the rela-tive expression of STING was increased threefold. However,overall STING expression showed only a small increase intwo of the Matrix-M treated pigs and as a group, this wasnot significantly different to the control group. Thus, fourpigs treated with Matrix-M showed an increase in IFN-�expression and these pigs also expressed an elevated levelof OPN and/or STING. For three of these pigs (nos. 1, 2, and 3)the sampled draining lymph node was enlarged at autopsy,further indicating a potent immune activation.

4. Conclusion

The adjuvant Matrix-M induces an inflammatoryresponse characterized by a rapid influx of neutrophilicgranulocytes and activation of genes regulating earlyinflammation and other immune response genes in

ogy and

60 C. Fossum et al. / Veterinary Immunol

the pig. Functional annotation analysis and gene setenrichment analysis specified a significant enrichment of“myeloid cell” and pDC. The latter suggestion is well inline with the distinct interferon-regulated gene profilerecorded both at the site of injection and in the draininglymph node. In accordance the relative expression ofIFN-� was increased in the draining lymph node 24 h afterinjection with Matrix-M. As the IFN-� expression was mir-rored by an increased expression of OPN and STING boththe endosomal TLR7/TLR9 pathway including MyD88/OPNand the cytosolic STING/TBK1 pathways could be involvedin Matrix-M mediated IFN activation, although the formerpathway seems like the preferred one. The Matrix com-ponent inducing the interferon response still has to beidentified but the present Matrix-M formulation was welltolerated in young piglets, signifying that the magnitude ofthe inflammation was appropriate to initiate an immuneresponse without causing any adverse side reactions.

Acknowledgements

We are thankful for the excellent technical assistance ofthe staff of the Prairie Diagnostic Services and the PrairieSwine Centre of Saskatoon, Canada and by Ulla Schmidtat the University Research Station, Funbo Lövsta, Upp-sala, Sweden. Funding for this project was provided bythe EU 6th framework programme Food-CT-2004-513928,Control of Porcine Circovirus Diseases (PCVDs): TowardsImproved Food Quality and Safety and by the SwedishResearch Council for Environment, Agricultural and SpatialPlanning (FORMAS).

References

Ahlberg, V., Lövgren Bengtsson, K., Wallgren, P., Fossum, C., 2012. Globaltranscriptional response to ISCOM-Matrix adjuvant at the site ofadministration and in the draining lymph node early after intramus-cular injection in pigs. Dev. Comp. Immunol. 38, 17–26.

Auray, G., Facci, M.R., van Kessel, J., Buchanan, R., Babiuk, L.A., Gerdts,V., 2010. Differential activation and maturation of two porcine DCpopulations following TLR ligand stimulation. Mol. Immunol. 47,2103–2111.

Azevedo, M.S., Gonzalez, A.M., Yuan, L., Jeong, K.I., Iosef, C., Van Nguyen,T., Lövgren-Bengtsson, K., Morein, B., Saif, L.J., 2010. An oral versusintranasal prime/boost regimen using attenuated human rotavirusor VP2 and VP6 virus-like particles with immunostimulating com-plexes influences protection and antibody-secreting cell responses torotavirus in a neonatal gnotobiotic pig model. Clin. Vaccine Immunol.17, 420–428.

Bertho, N., Marquet, F., Pascale, F., Kang, C., Bonneau, M., Schwartz-Cornil, I., 2011. Steady state pig dendritic cells migrating in skindraining pseudo-afferent lymph are semi-mature. Vet. Immunol.Immunopathol. 144, 430–436.

Bolind Bågenholm, A., 2009. Early immune response to and adjuvant(AbISCO-100®) tested in porcine peripheral blood mononuclear cells.http://stud.epsilon.slu.se

Dalsgaard, K., Hilgers, L., Trouve, G., 1990. Classical and new approachesto adjuvant use in domestic food animals. Adv. Vet. Sci. Comp. Med.35, 121–159.

Dawson, H.D., Royaee, A.R., Nishi, S., Kuhar, D., Schnitzlein, W.M., Zucker-mann Jr., F., Urban, J., Lunney, J.K., 2004. Identification of key immunemediators regulating T helper 1 responses in swine. Vet. Immunol.Immunopathol. 100, 105–111.

Duewell, P., Kisser, U., Heckelsmiller, K., Hoves, S., Stoitzner, P., Koernig, S.,

Morelli, A.B., Clausen, B.E., Dauer, M., Eigler, A., Anz, D., Bourquin, C.,Maraskovsky, E., Endres, S., Schnurr, M., 2011. ISCOMATRIX adjuvantcombines immune activation with antigen delivery to dendritic cellsin vivo leading to effective cross-priming of CD8+ T cells. J. Immunol.187, 55–63.

Immunopathology 158 (2014) 53–61

Fairbairn, L., Kapetanovic, R., Sester, D.P., Hume, D.A., 2011. The mononu-clear phagocyte system of the pig as a model for understanding humaninnate immunity and disease. J. Leukoc. Biol. 89, 855–871.

González, A.M., Nguyen, T.V., Azevedo, M.S., Jeong, K., Agarib, F., Iosef, C.,Chang, K., Lövgren-Bengtsson, K., Morein, B., Saif, L.J., 2004. Antibodyresponses to human rotavirus (HRV) in gnotobiotic pigs following anew prime/boost vaccine strategy using oral attenuated HRV prim-ing and intranasal VP2/6 rotavirus-like particle (VLP) boosting withISCOM. Clin. Exp. Immunol. 135, 361–372.

Hjertner, B., Olofsson, K.M., Lindberg, R., Fuxler, L., Fossum, C.,2013. Expression of reference genes and T helper 17 asso-ciated cytokine genes in the equine intestinal tract. Vet. J.,http://dx.doi.org/10.1016/j.tvjl.2013.05.020 [Epub ahead of print].

Holm, C.K., Jensen, S.B., Jakobsen, M.R., Cheshenko, N., Horan, K.A., Moeller,H.B., Gonzalez-Dosal, R., Rasmusse, S.B., Christensen, M.H., Yarovin-sky, T.O., Rixon, F.J., Herold, B.C., Fitzgerald, K.A., Paludan, S.R., 2012.Virus-cell fusion as a trigger of innate immunity dependent on theadaptor STING. Nat. Immunol. 13, 343–737.

Hägglund, S., Hu, K.F., Larsen, L.E., Hakhverdyan, M., Valarcher, J.F., Taylor,G., Morein, B., Belák, S., Alenius, S., 2004. Bovine respiratory syncy-tial virus ISCOMs—protection in the presence of maternal antibodies.Vaccine 23, 646–655.

Iosef, C., Van Nguyen, T., Jeong, K., Bengtsson, K., Morein, B., Kim, Y., Chang,K.O., Azevedo, M.S., Yuan, L., Nielsen, P., Saif, L.J., 2002. Systemic andintestinal antibody secreting cell responses and protection in gnotobi-otic pigs immunized orally with attenuated Wa human rotavirus andWa 2/6-rotavirus-like-particles associated with immunostimulatingcomplexes. Vaccine 20, 1741–1753.

Ishikawa, H., Ma, Z., Barber, G.N., 2009. STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity. Nature 461,788–792.

Johansson, M., Lövgren-Bengtsson, K., 1999. Icoms with different quil-laja saponin components differ in their immunomodulating activities.Vaccine 17, 2894–2900.

Kapetanovic, R., Fairbairn, L., Beraldi, D., Sester, D.P., Archibald, A.L., Tug-gle, C.K., Hume, D.A., 2012. Pig bone marrow-derived macrophagesresemble human macrophages in their response to bacteriallipopolysaccharide. J. Immunol. 188, 3382–3394.

Kensil, C.R., Patel, U., Lennick, M., Marciani, D., 1991. Separation and char-acterization of saponins with adjuvant activity from Quillaja saponariaMolina cortex. J. Immunol. 146, 431–437.

Labbé, K., Saleh, M., 2011. Pyroptosis A Caspase-1-dependent pro-grammed cells death and a barrier to infection. In: Couillin, I., Pétrilli,V., Martinon, F. (Eds.), The Inflammasome, Progress in InflammationResearch. Springer, Basel AG, pp. 17–36.

Lande, R., Ganguly, D., Facchinetti, V., Frasca, L., Conrad, C., Gregorio,J., Meller, S., Chamilos, G., Sebasigari, R., Riccieri, V., Bassett, R.,Amuro, H., Fukuhara, S., Ito, T., Liu, Y.J., Gilliet, M., 2011. Neutrophilsactivate plasmacytoid dendritic cells by releasing self-DNA-peptidecomplexes in systemic lupus erythematosus. Sci. Transl. Med. 3,73ra19.

Levy, D.E., Marié, I.J., Durbin, J.E., 2011. Induction and function of type Iand III interferon in response to viral infection. Curr. Opin. Virol. 1,476–486.

Lin, W., Qiu, Z., Liu, Q., Cui, S., 2013. Interferon induction and suppres-sion in swine testicle cells by porcine parvovirus and its proteins. Vet.Microbiol. 163, 157–161.

Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression datausing real-time quantitative PCR and the 2(−Delta Delta C(T)) method.Methods 25, 402–408.

Lövgren Bengtsson, K., Morein, B., 2000. The ISCOMTM technology. In:O’Hagan, D.T. (Ed.), Methods in Molecular Medicine, Vaccine Adju-vant: Preparation Methods and Research Protocols. Humana Press,Inc., Totowa, NJ, pp. 239–258.

Lövgren, K., Morein, B., 1988. The requirement of lipids for the formation ofimmunostimulating complexes (iscoms). Biotechnol. Appl. Biochem.10, 161–172.

Lövgren Bengtsson, K., Morein, B., Osterhaus, A.D., 2011. ISCOMtechnology-based Matrix MTM adjuvant: success in future vaccinesrelies on formulation. Expert Rev. Vaccines 10, 401–403.

Lövgren Bengtsson, K., Sjölander, A., 1996. Adjuvant activity of iscoms;effect of ratio and co-incorporation of antigen and adjuvant. Vaccine14, 753–760.

Marquet, F., Bonneau, M., Pascale, F., Urien, C., Kang, C., Schwartz-Cornil,I., Bertho, N., 2011. Characterization of dendritic cells subpopula-tions in skin and afferent lymph in the swine model. PLoS ONE 6,

e16320.

Morein, B., Sundquist, B., Höglund, S., Dalsgaard, K., Osterhaus, A., 1984.Iscom a novel structure for antigenic presentation of membrane pro-teins from enveloped viruses. Nature 308, 457–460.

ogy and

M

M

M

M

N

N

N

P

R

R

S

C. Fossum et al. / Veterinary Immunol

orein, B., 1987. Potentiation of the immune response by immunizationwith antigens in defined multimeric physical forms. Vet. Immunol.Immunopathol. 17, 153–159.

orein, B., 1988. The iscom antigen-presenting system. Nature 332,287–288.

orein, B., Blomqvist, G., Hu, K., 2007. Immune responsiveness in theneonatal period. J. Comp. Pathol. 137, S27–S31.

orelli, A.B., Becher, D., Koernig, S., Silva, A., Drane, D., Maraskovsky,E., 2012. ISCOMATRIX: a novel adjuvant for use in prophylactic andtherapeutic vaccines against infectious diseases. J. Med. Microbiol. 61,935–943.

guyen, T.V., Iosef, C., Jeong, K., Kim, Y., Chang, K.O., Lövgren-Bengtsson, K.,Morein, B., Azevedo, M.S., Lewis, P., Nielsen, P., Yuan, L., 2003. Vaccine21, 4059–4070.

guyen, T.V., Yuan, L., Azevedo, M.S., Jeong, K.I., Gonzalez, A.M., Iosef,C., Lövgren-Bengtsson, K., Morein, B., Lewis, P., Saif, L.J., 2006a. Hightiters of circulating maternal antibodies suppress effector and mem-ory B-cell responses induced by an attenuated rotavirus priming androtavirus-like particle-immunostimulating complex boosting vaccineregimen. Clin. Vaccine Immunol. 13, 475–485.

guyen, T.V., Yuan, L., Azevedo, M.S., Jeong, K.I., Gonzalez, A.M., Iosef, C.,Lövgren-Bengtsson, K., Morein, B., Lewis, P., Saif, L.J., 2006b. Low titermaternal antibodies can both enhance and suppress B cell responses toa combined live attenuated human rotavirus and VLP-ISCOM vaccine.Vaccine 24, 2302–2316.

uentes, E., Cancio, E., Eiras, A., Nores, M.V., Aguilera, A., Regueiro, B.J.,Seoane, R., 1993. Efficacy of various non-oily adjuvants in immuniza-tion against the Aujeszky’s disease (pseudorabies) virus. Zentralbl.Veterinarmed. B 40, 353–365.

eimer, J.M., Karlsson, K.H., Lövgren-Bengtsson, K., Magnusson, S.E.,Fuentes, A., Stertman, L., 2012. Matrix-MTM adjuvant induces localrecruitment, activation and maturation of central immune cells inabsence of antigen. PLoS ONE 7, e41451.

önnberg, B., Fekadu, M., Morein, B., 1995. Adjuvant activity of non-toxicQuillaja saponaria Molina components for use in ISCOM matrix. Vac-cine 13, 1375–1382.

traw, B.E., DAllaire, S., Mengeling, W.L., Taylor, D.J., 1999. Diseases ofSwine, 8th ed. Iowa State University Press, Ames, IA.

Immunopathology 158 (2014) 53–61 61

Shinohara, M.L., Lu, L., Bu, J., Werneck, M.B., Kobayashi, K.S., Glimcher, L.H.,Cantor, H., 2006. Osteopontin expression is essential for interferon-alpha production by plasmacytoid dendritic cells. Nat. Immunol. 7,498–506.

Takahashi, H., Takeshita, T., Morein, B., Putney, S., Germain, R.N., Berzofsky,J.A., 1990. Induction of CD8+ cytotoxic T cells by immunization withpurified HIV-1 envelope protein in ISCOMs. Nature 344, 873–875.

Tsuda, T., Sugimura, T., Murakami, Y., 1991. Evaluation of glycoproteingII ISCOMs subunit vaccine for pseudorabies in pig. Vaccine 9, 648–652.

Tulman, E.R., Garmendia, A.E., 1994. Delivery of pseudorabies virusenvelope antigens enclosed in immunostimulating complexes(ISCOMs): elicitation of neutralizing antibody and lymphoprolif-erative responses in swine and protection in mice. Vaccine 12,1349–1354.

Uddin, M.J., Cinar, M.U., Tesfaye, D., Looft, C., Tholen, E., Schellander, K.,2011. Age-related changes in relative expression stability of com-monly used housekeeping genes in selected porcine tissues. BMC Res.Notes 4, 1–13.

Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe,A., Speleman, F., 2002. Accurate normalization of real-time quantita-tive RT-PCR data by geometric averaging of multiple internal controlgenes. Genome Biol., 3, research0034.1–0034.11.

Wallgren, P., Segall, T., Pedersen Mörner, A., Gunnarsson, A., 1999. Exper-imental infections with Actinobacillus pleuropneumoniae in pigs—I.Comparison of five different parenteral antibiotic treatments. Zen-tralbl. Veterinarmed. B 46, 249–260.

White, F.J., Ross, J.W., Joyce, M.M., Geisert, R.D., Burghardt, R.C., Johnson,G.A., 2005. Steroid regulation of cell specific secreted phosphopro-tein 1 (Osteopontin) expression in the pregnant porcine uterus. Biol.Reprod. 73, 1294–1301.

Wikström, F.H., Fossum, C., Fuxler, L., Kruse, R., Lövgren, T., 2011. Cytokineinduction by immunostimulatory DNA in porcine PBMC is impaired

by a hairpin forming sequence motif from the genome of Porcine Cir-covirus type 2 (PCV2). Vet. Immunol. Immunopathol. 139, 156–166.

Xie, L., Liu, M., Fang, L., Su, X., Cai, K., Wang, D., Xiao, S., 2010. Molecu-lar cloning and functional characterization of porcine stimulator ofinterferon genes (STING). Dev. Comp. Immunol. 34, 847–854.