IIlllllllIlJlIJIIJlllllIIllllIIlllIlllJllllIlllllIJllIllIllgpbou.weebly.com/uploads/2/6/6/4/26648965/mbio_2815.pdf ·...

-- IMJIIIIll111111111111JIllllrllllilllllllflll/NEWFOLDER

Z_

ICIrn_

_m

m

mmm

mm

IIlllllllIlJlIJIIJlllllIIllllIIlllIlllJllllIlllllIJllIllIllNEWFOLDER

Introduction to MicrobiologyMBIO 2815Spring 2009Section 010Quiz #1

Directions:

I Multiple Choice: One correct answer per question. Correct answer could be "all ofthe above", "none of the above", or a choice of several answer (for example; ChoiceE: A and B but not C and D). Mark your answers on your seantron for theappropriate question number.

True and False. If the answer is True, mark the A column. If the answer is False,

mark the B column for the appropriate question number.

Point Value-l.0

REMEMBER, DO NOT CHANGE ANSWERS UNLESS YOU ARE ABSOLUTELYPOSITIVELY SURE THAT YOU MARKED THE WRONG ANSWERS.INVARIABLY, THE FIRST ANSWER TO COME TO YOUR MIND IS THECORRECT ONE.

T F 1. The reason thatLa_aro Spallanzani's experiments thatdisproved spontaneous generationwere not accepted by supportersof the theory, was because the "vital force" was destroyed orkept from entering the sealed flasks.

2. Which of the following define tyndallization and what it is used for ?

A. A method of sterilizing heat-sensitive materials.B. Heating a solution to boiling, cooling it for 24 hrs, repeating the process of boiling and

cooling after 24 Ms, and repeating the process one more time.C. The process of disinfecting.D. Maintalmng the temperature at 1210C for 15 mins at 15psi.E. AandB

T F 3. The process by which a pathogen is weakened until it no longer can cause a disease is calledattenuation. This procx_ was discovered by Louis Pasteur.

4. Fannie Hesse is credited with giving the idea for using agar as a solidifying agent.

A. Louis PasteurB. Alexander FlemingC. Robert KochD. President David BorenE. Sergei Winogradsky

Page l, v4

T F 5. Is the following the correct order of Koch' s postulates?I. The organism must be cultivated in a pure culture away from the animal body2. The organism must always be present in animals suffering from the disease and shouldnot be present in healthy individuals.3. Such a pure culture, when inoculated into healthy, susceptible animals, must initiate thecharacteristic disease symptoms.4. The microorganism must be reisolated from the experimental animals, cultured again inthe laboratory and shown to be the same as the orginal microorganism.

• _- . . . _ ,_. _ _.. _._._ ,: ,

Ferdinand CohnE. Louis Pasteur

7. Cellulae:

A. Term coined by Robert Hcoke.B. Modem term is cells.C. Means little boxes.D. All of the above.E. None of the above.

8. Microorganisms that live in acidic environments?

A. XerophilieB. AlkalophilicC. OsmophilicD. HydrophilicE. Aeidophilic

9. A microorganism that is responsbile for making another organism siclc

A. Causative agent of diseaseB. Cell theoryC. Fermenting agent of diseaseD. Non-pathogenicE. Spontaneous generation

10. The study of fungi:

A. PhycologyB. MycologyC. VirologyD. ProtozoologyE. Bacteriology

Page 2, v4

Introduction to MicrobiologyMBIO 2815 Section 010Spring Semester 2009Exam #1

February 9_._109Team

Directions:

Multiple Choice. One correct answer per question. Correct answer could be "allof theabove", "None of the above", or "a choice of one answer that includes two or more of thechoices given".

Mark your answers on your scantron for the appropriate question number.

Point Value-l.0

REMEMBER, DO NOT CHANGE YOUR ANSWERS UNLESS YOU AREABSOLUTELY, POSITIVELY SURE THAT YOU MARKED THE WRONGANSWER.

1. Double helical structure, nucleotides-A, T, G, C, nucleotide A pairs with T while G pairs withC, are associated mostly with ?

A. James Watson and Francis CrickB. Louis Pasteur and Ferdinand CohnC. Robert Kock and Richard PetriD. Fleming, Chain, and FloreyE. Barry Marshall and Robin Warren

2_.Vibrio cholerae causes a severe form of dysentery (diarrhea/) disease With a high mortalityrote. Which of the following terms would be used to describe it?

A. Fastidious microorganismB. Opportunistic pathogenC. Non-pathogenic microorganismD. Pathogenic microorganismE. None of the above

3. Robert Hooke named cells, "cellulae" because?

A. That was the most appropriate name for them.B. They looked like little boxes.C. They were circular in shape.D. Somebody else called them by a different name.E. Cellulae means triangular in shape.

Page 1, v4

4. The process by which transposons cut themselves out of DNA at one location and re-insertthemselves into DNA at another location is called:

A. TransformationB. VaccinationC. IngraftingD. ConjugationE. Transposition

5. Lynn Margulis, an A meri_ scientist i¢,,ILg0_,la=fQr,her work . ._.... :,,_

PrionsB. easuative agents of diseaseC. AnthiaxD. Microbial evolutionE. The discovery of sulfa drugs

6. Francisco Redi:

A. Discovered endospores.B. Conducted the first experiments that shown the spontaneous generation did not occur.C. Developed the procedure of gram staining microorganisms.D. Was the British Ambassador to Turkey when ingrafting was discovered.E. Constructed the first "autoclaves".

7. Which of the following is incorrect in regards to Ignaz Semmelweis and his contributions tomicrobiology.

.Doctor's ward had a low incidence and mortality from purpureal fever.Studied childbed fever.C. Hungarian physician.D. Midwife' ward had a low incidence and mortality from purpureal fever.E. Mothers and infants were exposed to pathogen as a result of doctors not washing their

hands after autopsies of victims.

8. Why was it necessary for Joseph Lister to find a way to conduct aseptic surgery?

/_.-)High incidence of infection and mortality from surgery during his time:B. He was obsessed with making his patients happy while having surgery.C. Low rate of infection and mortality from surgery during his time.D. Too many patients tried to attack him because of infections from surgery.E. None of the above sounds reasonable

9. Which of the following individuals conducted experiments with rainwater to show themicroorganisms were not "heaven sent" in rain?

A. Anton von LeeuwenhoekB. Barbara McClintockC. Robert HookeD. Ferdinand CohnE. Barry Marshall

Page 2, v4

I0. Developed the three domains of classfication of organisms using molecular classificationtechniques.

A. Carolus LinnaeusB. Richard DawkinsC. Carl B. WoeseD. Lynn MargulisE. Robert Whittaker

_asur's definitive experiment that disproved spontaneous generation was successful

A. It allowed the entry of the vital force, a major concern of proponents of the theoryB. Heating destroyed the microorganisms in the nutrient broth without affecting vital forceC. It showed that microorganisms arepresent in air and can cause growth in exposed

liquidsD. The microorganisms became trapped in the curve of the swan neck flask, thus preventing

contamination of the growth mediumE. All of the above

12. Lady Mary Montaqu:

A. Discovered ingrafting being used for prevention of smallpox byTurkish women.B. Had survived smallpox, but was badly scarred by the disease.C. Tested the procedure on orphans and prisoners and demonstrated that it protected them

from the disease.

D. Her findings were not accepted by the British medical community.

1_. ca_lE. All of the above.e process of converting the nitrogen in the atmosphere to ammonia in the soil and water ised?

)_, Nitrogen oxidation:'i_,.Enrichment

C. Sulfur reductionD. Sulfur oxidationE. Nitrogen fixation

14. Which of the following individuals conducted experiments that proved that spontaneousgeneration did in fact happen.

A. Anton yon Leewenhock.B. Louis Pasteur.C. Robert Koch.D. John Needham.E. John Tyndall.

_The system identification, classification, and nomemclature of organisms?

formal of

_. Scientific nomenclature.D. Pasteurization.E. Tyndallization.

Page 3, v4

16. Discovered microorganisms living at boiling or near boiling temperatures?

A. Paul EthlichB. Anton Von LeeuwenhoekC. Robert HookeD. Thomas Brock

E. Jimmy Cracked CornWhich of the following were not one of Robert Koch's contribution to microbiology?A. Germ theory of disease B. Causative agent of diseaseS?,_-_Tuberculin D. Microbiological media

_ _None of the aboveWhich of the following is a protozoan that causes a severe intestinal infection?

_. Staphylococcus aureusB. Giardia lambliaC. Lactobacillus sanfrancisco

_. Bacillus anthracisVampirovibrio chlorellavorus

19. l_,ucMontagnier:.

A. Discoverer of the first viruses.B. Developed the first autoclaves.C. Worked with Pasteur on developing the process of attenuation.D. Discovered the human immunodefieiency virus.F_. Discovered the largest prokaryotic organism.

20. Which of the following laid the ground work for the field of virology.

A. Martinus BeijerinekB. Louis PasteurC. Sergei WinogradskyD. John TyndallE. Francisco Redi

21. Microorganisms that are found in acidic, basic, osmophilic, xerophilic or thermophilicenvironments, for example, would be considered to be?

A. AcidophilesB. OsmophilesC. ExtremophilesD. ThermophilesE. Xerophiles

22. Proteins that can cause Creutzfeldt-Jakob disease, a disease of the brain that results in theformation of holes in the brain tissue?

A. PenicllinB. ProtenomicsC. PrionsD. VimidsE. Tetanus

Page 4, v4

23. High solute (sugars) concentration loving microorganisms?

A. AlkalophilesB. AcidophilesC. OsmophilesD. BarophilesF_, Psychrophiles

24. During a very scientific productive period in his life, Louis Pasteur developed vaccines for allof the following except:

. rabiesanthrax_..' tuberculosis

chicken choleraE. none of the above

25. Discover of transposons or lumping genes"?

A. Lue MontagnierB. Barbara McClintockC. Stanley PrusinierD. Barry Marshall and Robin WarrenE. Alexander Fleming

26. Why was it necessary for Francisco Redi to repeat his experiments disproving spontaneousgeneration with the experimental jar covered with gauze instead of sealed with a lid?

A. To allow adult flies access to the spoiling meat in order for them to lay their eggs.B. To allow the odor of the spoiling meat to be released from the jar to attract adult flies.C. Odor of the spoiling meat is necessary for fly eggs to hatch into larvae.D. To allow the vital force access to the jars for spontaneous generation.E. None of the above.

27. Which of the following individuals determined that boiling was not areliable method ofsterilization for heat-sensitive liquids.

A. TyndallB. PasteurC. KochD. NeedhamE. Sr,allanzani

28. While conducting experiments that disproved spontaneous generation, Lazzaro Spallanzaniinadvertently discovered?

A. CanningB. VaccinationC. TydnallizationD. Autodaymg _1E Attenuation

Page 5, v4

29. Which ofthe following were Pasteur's contribution(s) to microbiology?

A. disproving Spontaneous GenerationB. development of vaccinesC. the aseptic technique proceduresD. discovery of attenuationE. all of the above

30. Why did the use of agar, as a solidifying agent have such an impact on microbiology?

A. It allowed the culturing of microorganisms in pure culture.B. It enabled the observation of cultural characteristics.C. It allowed isolation of one microorganism which enabled scientists to be able to study

that MO in detail.D. It allowed the separation of mixed cultures of microorganisms.E All of the above

31. Joseph Meister was associated with which scientist?

_ Francis Bacon.Louis Pasteur

C. Robert Koch.

I_, Fanny Hesse. ,"Richard Petri. ""

32. Which of the following individuals was the discoverer ofcells and laid the basis for the celltheory?

_A_.Louis PasteurRobert Hooke

C. Ferdinand ColinD. James Watson and Francis CrickE. Robert Koch

33. Which of the following individuals described animalcules?

A. Robert KochB. Anton von LeeuwenhoekC. Louis PasteurD. Francisco RediE. Martinus Beijerinck

34. This scientist's studies of microorganisms led to the development of the field of soilmicrobiology.

A. Louis PasteurB. Martinus BeijerinekC. Sergei WinogradskyD. John TyndallE. Francisco Redi

Page 6, v4

35. The cause of gastic and peptic ulcers.

A. Staphylococcus aureusB. Corynebacterium diphtheriaeC. Hemophilus influenzaeD. Neiserria meningitidisE Helicobacter pylori

36. Why was the discovery of the cause of gastic and peptic ulcers so difficult for scientists toazcept?

Because most bacteria do not produce endospores, thus they could not survive in thestomach.

,,/_Because bacteria are unable to live in alkaline conditions.._.)Becanse of the acidic conditions of the stomach and the presence of numerous types of

digestive enzymes and chemicals, lead scientists to conclude that no microorganismscould live, grow and reproduce in the stomach.

D. Due to the thermophilic conditions of the stomach, as result of numerous chemicalreactions, microorganisms can not live, grow and reproduce in the stomach.

E. None of the above

Why are boiling tempeartures unable to provide complete sterilization of a solution?

_.. Many microorganisms are resistant to boiling temperaturesEndospores are resistant to boiling temperatures

C. Moist heat is an ineffective mechanism of sterilizationD. Endospores are a structure that some bacteria produce to survive adverse conditionsF_ BandD

38. The study of prokaryotes:

Phycology - O-AC_.Mycology - '0) ,,_'_Virology- ",/_V_"_ tp _6 tBactenology- _0_"_ _Protozoology - _.a_ w _,-,

Page 7, v4

True and False. If the answer is True, mark the A column of your scantron. If theanswer is False, mark the B column of your scantron. Mark your answer for theappropriate question number.

Point Value- 1.0T F 39. Without microorganisms, all higher forms of Earth would cease to exist.

T F 40. Lazzaro Spallanzani's experiment demonstrating that spontaneous generation did not occurwere not accepted by the supporters of the theory, because he sealed out the "vital force"before heating his nutrient broth.

T F 41. We, are classified in the Domain Eukarya, Kingdom Animalia, Phylum Chordata, ClassMammalia, Order Primates, Family Hominoidea, Gemls Homo, and Species saphens.

T F 42. The microorganisms the ferment sugars into alcohol in wine are members of the genusAcetobacter. The microorganisms that ferment sugars into vinegar and cause the formationof sour wine are members of the genus Saccharomyces.

T F 43. The process by which a disease is weaken until till it not longer can cause disease is calledattenuation.

T F 44.,_¢The term prokaryote means true nucleus._)F 4_i Robert Koch developed the germ theory of disease. This theory states that a disease is

/'_ caused by a specific microorganism and not by a curse, miasma, or mysterious shadow thatfalls on or over someone.

T F 46. The term Archaea means "primitive bacteria".

T F 47. Edward Jenner, an Englishman, is credited with discovering vaccination. The pathogen that heworked with was the smallpox virus which caused smallpox.

T F 48. Supporters of the theory of spontaneous generation did not accept any experiments, thatdisproved the theory, where the "vital force" was prevented from entering a container withnutrient broth or where the"vital force" could be destroyed by sealing and then heating thenutrient broth.

T F 49. Sterile means that all microorganisms except spores and viruses have been removed from amaterial or are not present in a material.

T F 50. Alexander Fleming discovered a mold, PeniciUium notatum contaminating a petri dish withmedia in which he had been culturing an opportunistic pathogen, Staphylococcus aureus,inhibiting the growth of the pathogen.

Page 8, v4

Introduction to MicrobiologyMBIO 2815 Section 010Spring Semester 2009February 16, 2009Quiz l/2Team Number q

Directions:

Multiple Cholee: One correct answer per question. Correct answer could be "all ofthe above", "none of the above", or a eholee of several answer (for example; ChoiceE: A and B but not C and D). Mark your answers on your seantron for theappropriate question number.

True and False. If the answer is True, mark the A column. If the answer is False,mark the B colunm for the appropriate question number.

Point Value-l.0

REMEMBER, DO NOT CHANGE ANSWERS UNLESS YOU ARE ABSOLUTELYPOSITIVELY SURE THAT YOU MARKED THE WRONG ANSWERS.INVARIABLY, THE FIRST ANSWER TO COME TO YOUR MIND IS THECORRECT ONE.

T_F 1. Reservoirs are sites at which pathogens can remain viable and from which they can spreadand cause infections. A specific pathogen could be found in both animate and inanimatereservoirs.

2. Plague is occuring in the westem United States at an infrequent rote. This would be a

. omiitySporadic diseaseEndemic disease

D. Prevalence of diseaseE. Incidence of disease

3. Coagulase:

(_ Aids the attachment ofNeiserria gonorrhease to urogentiul epithelia.Causes the formation of clots around the pathogen to protect it from the host immunesystem.

C..,Result,in.the.destruction.of plasma.membranes_of_host_cells. ,t_D. Causes the destruction of neutrophils, cells that are active in phagocytosis.E. Mediates the attachment of Streptococcus pyogenes to epithelial cells and aids in the

avoidance of phagocyte cells.

_E_ 4. An e_ndemicdisease is constantly present, usually at low incidence, in a population.

_l, v5

T (E)5. Sylvatic reservoirs of disease are domestic animals.

6. Allochthonous microflom?

A. Invasion or oolonization of host.B. Infection that results in a change in the state of health of the host.C. Microorganisms that colonize and take up permanent reside on host.

_Microorganisms that can invade, colonize and cause disease in host.Transient microorganisms that are members of the normal flora.

T .heco. t.od, nteperiod, period gf'_liffeT:_-"d':_qi_ce, nt period. - - _'_'_:'W. *'_

8. Non-living material that serves as reservoirs:

A. Morbidity

(_) Sporadic diseaseFomitesD. Prevalence of diseaseE. Epidemiology

9. An organism that can carry a pathogen from host to host

_. Paademie diseaseVector(s) of diseaseZoonoses

D. Vehicles of transmissionE. Typhoid Mary

10. Hospital and nursing home patients are susceptible to serious infections because:

A. Many patients have weakened resistance to infectious diseases. _B. The use of antibiotics selects for antibiotic-resistant organisms.C. Many diverse human reservoirs are present.

_IAII of the above.None of the above.

I 1. Cause of a disease.

Opportunistic pathogen.Invasiveness. ..

_. Virulence.(D.) Pathogenicity."_. Etiological agent

12. Swelling?

A. Disease.B. Pathogen.

(_ Symptom.Sign.E Syndrome.

Page 2, v5

y t

13. You have awoken up and are feeling somewhat lousy. However, by noontime you are feelingreally good with lots of energy and go. This is an?

_. Contagious disease._Acute disease_k_/Latent disease.

Sporadic disease.E. Subacute disease.

14. Which of the following are not characteristic(s) of e_.2i,9.I_li_?

_. Easily neutralized by toxoids.

J_. Heat unstable, usually destroyed at 60-800C.Lethal dose is small.Metabolic product of growing cell.Mainly produced by Gram-negative bacteria.

Page 3, v5

Introduction ot MicrobiologyMBIO 2815 Section 010Spring 2009March 2, 2009Exam #2

Directions:

Multiple Choice. One correct answer per question. Correct answer could be "allof theabove', "None of the above _, or *a choice of one answer that includes two or more of thechoices given*.

Mark your answers on your scanlron for the appropriate question number.

Point Value- 1.0


I. An enzyme that breaks down hyaluronic acid, which holds connective tissue together?.

(_nases.

yaluronidase. _C. Coagulases. .:"D. Lecithinases.E. Lipophosphatases.

2. The process of phagocytosis:

A. Phagocytic cell makes contact with antigen and attaches to the surface of the antigen orthey can trap the antigen against the surface of a cell, fibrin clot or blood vessel wall.

B. Phagocytic cell extends it membrane around the antigen which pinches off into theinside of the cell forming a phagosome.

C. Phagosome fuses with lysosome forming the phagolysosome containing enzymesandtoxic forms of oxygen which result in the destruction and digestion of the antigen.

D. Phagolysosome moves to the plasma membranes, fuses with the membrane, and releases(_) undigested materials to the exterior of the cell via exocytosis."

All of the above.

3. Food and water.

A. Pandemic disease B. Typhoid Mary C_. Vehicles of transmission[ D. Zoonoses E. Vector(s)of disease

Page 1, vl

4. In some cases, our immune system is unable to protect us from a lethal disease when we arefirst expos_t_.ogen. Why is this so?

A. The _ of antibodies does not increase to a level that will destroy the pathogen quicklybefore it kills us.

B. B cells have to differentiate into clones which become plasma cells and memory cellsand this process takes approximately seven days to happen.

C. The pathogen could produce a disease that would kill us in a time frame that is shorter(_ than our immune system's ability to res_d destroy the pathogen. _-

All of the abov.oj_A.,_li " _ _- --_ll

Noneofthe _5. Which of the foll_ effect of abno_-_J_-g_ b_y tem_mture?

_ Deereases T cell production_B. Decreases the iron available for pathogen growth.C. Intensifies the effect of interferon.D. Enhances repair of damaged tissues.

E. Inhibitsthe growth of MOs. _00_. -g_x e of fo'low r _ _ ,_"_6.)jWhih the , ingarenotpartoiour_immunity .....

A. Skin and mucous membranes " ._(_ Antibodies ( \C. Complement proteinsD. InflammationE. Phagocytic leukocytes

7. Time frame in which repair of the body occurs, and individual returns to a pre-disease state.

A. Period of decline_. Acute period

Convalescent period ,,Incubation period:.

E. Prodromal period

@_aich following not a complement system7of the is function of

_Inflammation._, Cytolysis.'_ Opsonization.

_)! _ None of the abovealch of the following do not affect our susoepabdlty to disease.

A. Age.B. Combination of genetic information from parents.C: Drinking sufficient water and eating healthy meals._ Difficult boss at work or employees that harass you.(_ None of the above.

_ge2, vl

1_. Which of the following pertain to the function(s) of the skin and mucous membranes?

A. Washing action of various materials causes the removal of many pathogenic organismsthat are attempting to colonize and invade the body.

B. Chemical interactions, some produced by the normal flora and other produced by the

innate immunity, seek to inhibit the growth of pathogens trying to invade and infect thebody.C. Serves as a mechanical barrier, in which most pathogens are unable to penewate if they

remain healthy and unbroken._ lvl_y produce substances that trap antigens and enable their removal or destruction.

Al!,of the above. :..1I. Disease?

_. Infection that results in a change in the state of health of the host.Transient microorganisms that are members of the normal flora.C. Microorganisms that colonize and take up permanent reside on host.D. Microorganisms that can invade, colonize and cause disease in host.E. Invasion or colonization of host.

(_hich of the following antibody is found in secretions such as tears, saliva, mucous, intestine,d milk?

A. IgD

_, IgM_IgA

• IgG

_'_ Lclh sgE_tement(s) is/are true?

. M_lsCOUSmembranes may be composed of a single layer or multiple layers of epithelial_Mi roorganisms tend to be found on those mucosal surfaces exposed to theel

environment.

(C. Microorganisms are not normally found in the blood.D. :All of the above.

14. S_..dfic an_a,3.liIx_iesare produced by k_ (3lx_A. Stem cells _GO. "xt_ x'x

_Killer T cells

"J_t_,¢Plasma cells '_._¢_O-D(,_ Memory cells_. Helper T cells

15. A disease that is present in unusually high numbers throughout the world is called an:

(_ Epidemic.Pandemic.C. Endemic.D. Sporadic.E. Outbreak.

Page 3, v 1

16. Mary goes to see the doctor. She has a boil on her arm. This would be a?

. Secondary infection.• Local infection.

Endemic infection.D. Focal infection.E. A chronic infection.

17. Which of the following cells contain granules and are referredto as granulocytes?

A. Basophils. ' 'B. Eosinophils.C. Lymphocytes._1_ Neutrophils.

_ All of the above except choice C.

/_ _d._. Which of the following could be an antigen?t L

g. Upd' _ Monosaccharide

_uNucleotide_g_Polysaccharide

E. Fatty acid

19. Bacteria growing in the blood slream and lymph• ,,

A. Toxemia. (,_ Septicemia. C. Virema. D. Bacteremia. E. Protemia.

Which of the following is the correct lineage for the origin of m_es?

_. Stem cell to myeloid precursor to mast cell to macrophage. -'Stem cell to myeloid precursor to monocyte to macrophage.Stem cell to lymphoid precursor to mast cell to macrophage.Stem cell to lymphoid precursor to monocyte to macrophage.None of the above

21• What is the purpose of margination during inflammation?

_)To coat the antigen with serum proteins to improve its adherence to phagocytic cellslTo cause the phagocytic cells to stick to blood vessel walls at the site of injury ordamage to tissues.

C. To stimulate the phagocytic cells to undertake ameboid movement along the blood vesselwalls• _

D. To enable the phagocytic cells, chemicals, and fluids to move from the blood vessels intothe site of tissue injury and/or damage

E. To decrease the diameter of the blood vessels to inhibit the pathogen's ability to penetrate

into the blood stream and spread throughout the bodyBre have 7, 230 cases of typhoid fever in the state of Texas during the month of April,

• This would be the 7:

ncidence of diseaseporadic disease

",l_. FomitesD(_) Prevalence of disease,_ Mortality

Page 4, v I

23. Most cancers, heart disease, tetanus?

Non-communicable disease.Communicable disease. ,,--"

C. Contagious disease.D. None of the above.

24. If alpha and beta interferons were not released by viral infected host cells, which of thewing would result.'/

Alpha and beta interferons would not be released to signal uninfected cells that a viruswas present.

B. The mannin-bindin_ lectin pathway of complement fixation would not be activated.C. B cells would not differentiate in plasma and memory cells nor would they clone

themselves.D. Hypothalamic activity would not increase body temperature and play a role in the

destruction of the antigen.E. Suppresor T cells would be prevented from suppressing the immune response when the

antigen was not present.

25. Artificially acquired passive immunity:

_. Immunity the infant receives from the mother via placenta before birth and breast milkafter birth.Immune response due to vaccinations or immunizations.

/(_As a result of exposure to numerous antigens over one's lifetime.The immunity one derives from an injection of antibodies from another source.E. All of the above.

26. The organ that has a role in controlling the temperature of the human body.

A. liver.B. Kidney.

(_ Brain,Hypothalamus.

(_?hi ' Thymes gland"ch of the following processes are involved in interconnecting the innate immunity with

the adaptative immunity?

A. Phagocytic cells that serve as antigen-presenting cells.,,_,_ Complement system and the classical pathway of complement activation

Fever and its enhancement of T cell production.Inflammation and the release of cytokines by some macrophages.

All of the above.28. Function to activate other cells of the immune system to interact with and destroy antigens.

A.T SB. Tc

E. NK

Page 5, vl

29._/_h type of vaccine would you prefer for meningitis caused by Neiserria meningitidis?

_.._}Killed vaccineAttenuated vaccine

__.,_Whole cell vaccine

Microbe part vaccine ,-.,_ , (_Recombinant vaccine-_'q .

30. Which of the following are not function(s) of vasodilators?

_. Directly result in the destruction of the antigen.Attract neutrophils to the site of infection.C. Increase permeability of blood vessel walls.D. Serve as chemoatwactants to phagocytic cells.E. Increase the diameter of the blood vessels.

31. T lymphoctes mature in the:

A. Thyroid glandB. Parathyroid glans

. Hypothalamus _ThymusThalamus

32. Flu, common cold, measles, whooping cough, scarlet fever'?

• -.. A. Non-commumcable disease._. Communicable disease.

Contagious disease.None of the above.

33. The specific region or components of the antigen that antibodies interact with in order tocause the destruction and/or removal of the antigen from the body?

A. The antigen.B. The proteins.C. The liponucleic acids.

The polysaccharides.The antigenic determinants

ch of the following are not functions of antibodies?A. Activation of the complement system.B. Neutralization of toxins and viruses.

_ Clumping of antigens to that they are more easily phagoeytized.Antibody-dependent cell-mediated cytotoxicity.None of the above.

35. A family of ten, in southeastern Oklahoma have come down with epidemic typhus. This ismore eases of epidemic typhus seen in all Oklahoma in the last ten years. This would be anexample of a

.) Sporadic diseaseEndemic diseaseC. Pandemic diseaseD. Epidemic diseaseE. Subclinical disease

Page 6, v 1

36. Which of the following traits is a characteristic of anexotoxi_____n?

A. Low toxicity. ,_

_C. Heat stable, rpjov_xay0_,Species specific mode of action.

_E_ Lipid in composition.• Poorly immunogenic.

37, Which is a major invasive mechanism that prevents phagocytosis ofthe bacterium by the hostdefense systems?

@ Capsule.B. Exotoxin.

_.. Pili.Streptokinase.Enterotoxin.

38. Microbial products, damaged cells, peptides from complement system, and comtxments ofleukocytes can all serve as:

A. Vasodilators

(C_ Intiatorsof inflammation.Chemoattractants.Leukotriennes.

E. Kinins.

Page 7, v1

True and False. If the answer is True, mark the A column of your scantron. If theanswer is False, mark the B column of your scantron. Make sure that you are markingyour answers for the appropriate question number. Point Value-l.0

T_9. The classical pathway of complement fLxationrequires interaction between cell wailpolysaccharides and various factors for activation of this pathway to occur.

(_F 40. MHC stands for major histocompatibil!ty complex; which are chemical components on thesurface of your cells that enables your immune system to recognize those cells as self and to

not attack and destroy them. _ R_t:_

'_'__J_ Eadotoxins have a high toxicity, however for unknown reasons are rarely fatal. _._¢t.,_0Ao/_T

T_42. Plasma cells have a long life, remaining viable and producing antibodies for weeks.

T (._ 43. The variablity of the amino acid sequence of the antigen-binding site of the immunoglobulinis the reason why millions of different antibodies can be produced, each one for a different aimmunogen.

T @__44. Portals of enwance would include mucous, shared hypodermic needles, feces, urine,blood,salvia, coughing, sneezing, vomiting and respiration.

(_F 45. Opsonization is the process by which anugens are coated with proteins to enhancephagocytosis of an antigen.

T_46. The following are the con'ect requirements for an effective vaccine?

Low side effects or toxicity and not cause serious harm.Protect against exposure to natural, wild forms of a pathogen.Stimulates both B cell and T cell immune responses.Produce memory (Long-term, lasting effects).Does not require numerous doses or boosters. --_ I _-_ 0 O._dInexpensive.Relatively long-shelf life.Easy to administer.

(_F 47. Healthy individuals who harbor viable pathogens with inapparent infections would beconsidered chronic carriers.

T _)48. Neutrophils arrive a the site of infection or damage within 15 minutes after the event hasoccurred.

(_)F 49. Tetanus toxin blocks the release of glycine. Inhibiting glycine release allows continual releaseof acetyicholine. This prevents the inhibition of nerve transmission from motor neurons tomuscles, causing the muscles to undergo uncontrollable conwactions. These uncontrollablecona'ations are the main symptom of tetanus.

T F(_50. Plasma cells differentiate (clone) into B cells and memory cells during the Humoral immuneresponse. B cells manufacture antibodies and memory cells remember the antigen.

_8, vl

Extra Credit. The following are extra credit questions. They will count on your score onlyif you have chosen the right answers. Wrong answers will not count against your score.Point Value-l.O

(_)F 51. Why vaccination?. Because it serves as the primary immune response to a specific pathogen,preventing an individual from getting a disease that could result in the death of that individualbefore the immune system could response and destroy the pathogen, if the pathogen wascausing the primary infection and primary immune response.

(_)F 52. Enzymes that are able to degrade clots formed around pathogens by the host immune systemare called kinases.

T (_) 53. The three general characteristics of the innate immunity are: specificity, memory, andtolerance.

Page 9, vl

Chapter 2 Keywords Chemistry:

• Matter: three states (solid, liquid, and gaseous)

• Atoms: the smallest unit of matter that can be involved in chemical reactions-cannot be

subdivided into smaller substances without losing its properties- composed of protons,electrons and neutrons

• Neutrons-neutrally charged atoms or no charge

• Electrons-are negatively charged

• Protons-positively charged

• Nucleus-composed of neutrons and protons-electrons orbit the nucleus of the atom in: electron

orbitals, electron shells, and electron configurations

• Electrons make up larger volume while nucleus has a larger mass

• Element- unique atoms with specific varied combinations of protons, neutrons, and electrons

(24 essential to life, 4 most common-Carbon, Nitrogen, Oxygen, and Hydrogen)

• Isotope-same element with a differing number of neutrons with a different mass number (used

for medical diagnosis, treatment of cancer, trace the movement of elements through the

ecosystems, sterilization of heat sensitive materials, date fossils and geologic strata)

• Mass number-measurement that reflects the number of protons and neutrons in an atom of a

particular element

• Atomic Number-a measurement that reflects the number of protons in an atom of a particular

element

• Atomic Weight-the average of the mass numbers of all the isotopic forms for a particularelement

• Orbitals-represent the volume of space in which electrons are found

• Electron Shells- electrons occupy them, and fill them in pairs

I stshell- I orbital and 2 electrons

2"dshell- 4 orbitals and 8 electrons

3rdShell- 9 orbitals and 18 electrons

4thShell- 16 orbitals and 32 electrons

• Molecule- two or more of the same atoms

• Compounds- two or more different elements

• Chemical Bonds-of molecules and compounds result when two or more atoms share, donate

(lose), or accept (gain) electrons ( 3 types: Covalent, Ionic and Hydrogen)

• Valence-the number of electrons in the outermost shell of an element

• Covalent Bonds-form between atoms that share electrons rather than donating or receiving

them. Require the input of energy J

• Polar-asymmetrical distribution of charges (ex. Water)

• Non Polar- electrically neutral molecule

• Ionic Bonds-electrons are transferred completely from one atom to another atoms-NOT

SHARED- these bonds form between atoms with valences that complement each other-

Molecules with intact- ionic bonds are electrically NEUTRAL, when dissolved in liquid it called

produce charged particles called IONS.

• Ions- charged atoms

• Cations-positively charged ions-more protons than electrons

• *SAtoms having less than half filled- the electrons in the outermost orbital will loose these

electrons and become positively charged

• Anions-negatively charged ions

• *•Atoms having more than half filled-electrons in the outermost shellwill gain electrons having

more electrons than protons

• Ionization-the dissociation of ions in a solvent (separation of ions) basically things thatdissociate in H20

• Hydrogen Bonds- DO NOT bond atoms into molecules or compounds-they form a H atom

covalently bonded to a Oxygen or Nitrogen atom is attracted to an Oxygen or Nitrogen atom on

another molecule or oxygen and nitrogen in the same macromolecule-WEAK BOND-easily

formed or broken-indicated by a dotted line-provides structure and stability to macromolecules

like proteins and nucleic acids

• Electrolytes-substances such as acids, salts, and bases that release ionswhen dissolved in water-

termed electrolytes because their charges enable them to conduct an electrical current

• Van Der Waals Forces-weak attractive interactions between molecules of low polarity

• Solutes-substances dispersed in solvent

• Solvent-dissolving medium usually water

• Hydrophillic-water loving molecules that attract water to their surface (salt and sugar)

• Hydrophobic-water fearing molecules that repel water (benzene)

• Amphipathetic-both hydrophilic and hydrophobic properties such as phospholipids

• Isotonic*two solutions having the same osmotic pressure such that, when separated by a

semipermeable membrane, there is no net movement of water in either direction

• Hypotonic-having lower osmotic pressure than a reference solution (water moves into the cell

causes cell to lyse or burst)

• Hypertonic-having greater osmotic pressure than a reference solution (water moves out of the

cell causing the cell to shrink)

• pH-graduated numerical scale that ranges from O-14 used to rate the relative acidity and

basicity--Acids have more H and Bases have more OH

• Acid- 0-6.5 acidophile-component dissolved in water releases excess H ions

• Basic- 7.5-14 aJkalophile-component releases excess hydroxyl ions (OH), so there is no longer a

balance between the two ions

• Macromolecules-very large compounds that are assembled from smaller molecular subunits or

building blocks

• Monomers-a simple molecule that can be linked by chemical bonds to form larger molecules

• Polymers-a macromolecule made up of a chain of repeating units (starch, protein and DNA)

• Carbohydrates- 1:2:1 ratio a compound containing primarily carbon, hydrogen, and oxygen

(functions: energy source, storage material, cell wall structural component, glycocalyx

component,cellmembrane components,andcellsurfacerecognitionfactors)

• Monosaccharide-asimplesugarsuchasglucosethat is a basicbuildingblock for more complex

carbohydrates

• Disaccharides-2 monosaccharidesugarunits

• Oligosaccharides-3-8monosaccharidesugarunits

• Polysaccharides-acarbohydrate that can be hydrolyzed into a number of monosaccharide's

(cellulose,starch,andglycogen)

• Dehydration Synthesis-removal of OH group and H atom from 2 m0nosaccharidesand form a

covalent bond betweenthe two sugarunits

• Lipids-composedof glycerol and fatty acids, amphipatheic,functions:6 times the energy as

carb, energy storage materials, cell membrane components, and hormones-examples:

triglycerides,phospholipids,steroids,andwaxes

• Fatty Acids-monomersglyceroland fatty acids(1-3 fatty acids)replacementof fatty acids with

phosphateor other group

• Tdglycerides-importantstoragelipids(includesfats andoils)saturatedfat( NO double bondsex.

Animaloil, palmoil and coconutoil) and non saturatedfat ( i or more doublebonds)

• Ester bond-a covalent bond formed by reactingcarboxylicacid with an OH group: olive and

corn oils, lard, and butter fat are examplesof triacylglycerols--estersformed between glycerol

andthree fatty acids

• Peptide Bond-the covalent union between two amino acids that forms between the amine

groupof one andthe carboxylgroupof the other. The basicbond of proteins.

• Phospholipids-mainchemicalcompoundin a cellmembrane which determinespermeability\

• Waxes- longchainlipidswithout fatty acids--found on our skinwhich actsasa lubricantkeeping

it plyable,soft, and moist

• Steroids- are the precursor to hormones androgen-men and estrogen females, cholesterol,

ergosterol,membranesof eukaryotesandsomebacteria

• Proteins-amino acids (monomers), carboxyl and amino group, peptide bond, dehydration

synthesis,metabolic reactions,and structural componentsand examplesare enzymes,part of

cellwall membrane,cellwall, ribosomes,andantibodies

• Amino Acids- the buildingblocksof proteins--which exist in 20 different naturally occurringforms

• Denaturation-breaking of covalent and H bonds, and reforming so it is no longer functional

(reversibleor irreversible)ex. Fryingan egg. Agentsinclude:temperature, pH, Chemicals,and

pressure

• Catalyst-asubstancethat alters the rate of a reaction without beingconsumedor permanently

changedby it. Incells,enzymesare catalysts.

• PrimaryStructure- amino acidsequence(20 different)--initial proteinorganizationdescribedby

type, number, and order of amino acidsin the chain. The primary structurevaries extensively

from protein to protein.

• Secondary Structure-folding of protein and intra molecular hydrogen bonding--Formation of

alpha helices and beta sheets

• Tertiary Structure-continued formation of H bonds, covalent bonds, and hydrophobic

in_teractionsresults in more folding of the molecule

• Quaternary Structure-a protein formed by the interaction of 2 or more polypeptides--subunits

of polypeptides held together by various bonds

• Enzymes- are catalysts--drive chemical reactions, energy of activation, active site (where

substrate fits so action occurs)

• Activation enerRy-

• Nucleotide-both nucleic acids are polymers of repeating subunits called nucleotides--each of

which is composed of three smaller subunits: a nitrogen base, a pentose sugar, and a phosphate

• Replication-in DNA synthesis, the semiconservative mechanisms that ensure precise duplication

of the parent DNA strands

• Transcrtption-mRNA synthesis; the process by which a strand of RNAis produced against a DNA

template (a nucleic acid function)

• Translation-protein synthesis; the process of decoding the messenger RNA code into a

polypeptide

• Genome-the complete set of chromosomes and genes in an organism

• Metabolism-a general term for the totality of chemical and physical processes occurring in a cell

• Catabolism-the chemical breakdown of complex compounds into simpler unites to be used in

cell metabolism

• Anabolism-the energy-consuming process of incorporating nutrients into protoplasm through

biosynthesis

• Transport-

• Protection-

• Motility-self-propulsion

• Irritability-capacity of cells to respond to chemical, mechanical, or light stimuli. This property

helps you to adapt to the environment and obtain nutrients

• Reproduction-

• Synthesis Reaction-reactants bond together to form a new molecule--may require energy

input--most balance the equation on each side of the arrow

• Exchange Reaction-bond(s) are broken and atoms exchanged on molecules and bond(s) are

reformed--substrates (reactants)

• Decomposition Reaction-(degradation) reaction--breaking bond(s) on a molecule and releasing

two or more product molecules--energy release may occur

• Substrates-the specific molecule upon which an enzyme acts• Endprodu_s_

• Nucleic Acids-monomer (nucleotide which consists of a nitrogenous base, sugar and phosphate

group) examples: DNA, RNA, and ATP--functions: genetic info, transcription and translation,

energy carrier

• FunctionalGroups: in chemistry,a particular molecularcombinationthat reacts in predictablewaysandconfers particular propertieson a compound. Examples:-COOH,-OH, -CHO

• ATP-adenosinetriphosphate--a nucleotidethat isthe primarysourceof energy to cells• DNA-deoxyribonucleicacid--the nucleic acid often referred to as the "double helix." DNA

carriesthe master plan for an organism'sheredity.

• RNA-ribonucleic acid--the nucleic acid responsible for carrying out hereditary program

transmitted byan organism'sDNA.

• Purines-a nitrogen base that is an important encodingcomponentof DNA and RNA. The two

mostcommonpurinesare adenineandguanine.

• Pydmidines-nitrogenbasesthat help form the genetic code on DNAand RNA. Uracil,Thymine,

and Cytosineare the most important pyrimidines

MBIO 2815 Fall 2006 Quiz 12 Points Each - Write the Most Correct Answer in the Blank

ID#

1. Which early scientist was the first to see cells (and later coined the _-A• term "cell") using the compound microscope he built?

0 Robert Hooke C. Louis Pasteur

B. Robert Koch _; '_mtonvan Leeuwenhoek

2. What is the name for the chemical bond in which atoms share an electron? C_

A. Ionic (_ovalent

B. Hydrogen D. Cation

3. Carbohydrates contain numerous Carbon (C) - Oxygen (O) bonds which "_causes them to be:

A. Hydrophilic C. Able to dissolve in water

B. Hydrophobic (_ Both A andC

4. In peptidoglycan, how are adjacent carbohydrate strands (NAM andNAG) ________linked together?

A. Lipopolysaccharide C. Teichoic Acids

(_nino D. Hydrogen BondsAcids

5. Why do bacteria often become non-motile (lose their ability to move) when stressed? ]_

A. Bacteria make fewer flagella C. Bacteria absorb their flagellum to usewhen stressed them for nutrients

1

(B_.Motility requires high amounts of D. None of the above

energy

Introduction to MicrobiologyMBIO 2815 Section 010 --Spring Semester 2009Quiz #4

Directions:

Multiple Choice: One correct answer per question. Correct answer could be "all ofthe above", "none of the above", or a choice of several answer (for example; ChoiceE: A and B but not C and D). Mark your answers on your scantron for theappropriate question number.

True and False. If the answer is True, mark the A column. If the answer is False,mark the B column for the appropriate question number.

Point Value-l.0

REMEMBER, DO NOT CHANGE ANSWERS UNLESS YOU ARE ABSOLUTELYPOSITIVELY SURE THAT YOU MARKED THE WRONG ANSWERS.INVARIABLY, THE FIRST ANSWER.

1. Which of the following would be a purpose of feedback inhibition.

.._It prevents the active site of an enzyme from becoming clogged with substrate molecules.It conserves chemical resources.

C. It prevents the enzymes from wearing out so fasLD. It causes the cell to produce more enzymes so that it stays in "cellular shape."F_ None of the above.

T(_- Energy can be created or destroyed. It cannot, however be changed in form, This is the firstlaw of thermodynamics.

3. In aerobic respiration the final electron acceptor is:

A. NitrateB. Hydrogen

0_ PyruvateOxygenE. Sulfate

,iT F_ Oxidation and reduction are not always coupled due to the fact that sometimes only"-" hydrogens are removed during redox reactions.

Page 1, v2

5. Phosphorylation:

(_The addition of a PO 4 group to an inorganic moleculeB. Addition of electrons to an organic moleculeC. Removal of a PO4 group from an organic molecule

D. Has nothing to do with an organic mblecule,<

When talking ;i*b_li_'_ns,,l_e wouldI:_'------"_'_'di_th'--_'_'_*_'_..,'_complexmacromolecules into simpler molecules or even carbon dioxide, and _vater _s Well ffS,exergonie reactions, the breaking of covalent bonds, and the release of energy.

7. Which of the following is not correct in regards to competitive inhibition:

A_.Reversible or irreversible._ Involves the active site of an enzyme.

Competitive inhibitor must be very different than the normal substrate in chemicalstructure.

_D. Competitive inhibitor competes for the active site with the normal sabstrate.E. All of the above.

8. Step4ofGlycolysis: Fructose-l,6-diphosphate .................... toGlyceraldehyde-3-phosphate and Dihydroxyacetone phosphate.What happened in this step?

A. Substrate underwent degradation.B. Substrate was split into two molecules.C. This is an example of the splitting of sugar.

Six carbon substrate was converted into two 3 carbon endproducts.All of the above.

9. Number of substrate molecules an enzyme can convert to endproduct every second.

_) Turnover number.B. Reversible competitive inhibition.C. Irreversible non-competitive inhibition.D. Saturation point.E. Feedback inhibition.

T O 10. When an in_b_r binds to the allosteric site of the enzyme, it causes a configurational changeof the enzyme, which can result in the inhibition of the enzyme or the activation of theenzyme.

_F 11. Enzymes are catalysts which means that they are able to speed up reactions because theylower the activation energy required for the reaction to occur.

12. NAD+:

A. Cofactor.B. Nicotinamide adenine dinucleotide.C. Accepts or donates electrons and atoms.

_) norganic nonprotein component of an enzyme.All of the above.

Page 2, v2

r o

13. The portion of the enzyme to which substrates bind is referred to as the:

...active site.allosteric site.

C. catalysis site.D. substrate complex.E. junction of Van der Waals forces.

Page 3, v2

?

• Introduction to MicrobiologyMBIO 2815 Section 010Spring 2009March 11, 2009Quiz #3Team Number q

D#

Directions:

Multiple Choice. One correct answer per question. Correct answer could be all ofthe above, none of the above, or a choice that allows the selection of several answers.Mark your answers on your scantron for the appropriate question number. PointValue-l.0

True and False. If the answer is True, mark the A column of your scantron. If theanswer is False, mark the B column of your scantran. Point Value-l.0

1. The second eJ_c]zon shell has? %

_Nine orbitals and eighteen electronsFour orbitals and eight electronsC. Two orbitals and four electronsD. One orbital and two electronsE. Three orbitals and six electrons

2. When protein structure changes due to extremes of pressure or temperature, we would beobserving:

A. Dehydration.B. Decarboxylation.

_2 Phosphorylation.Denaturation.E Degradation.

T (_3. Chemical reactions that _ energy input are referred to as exergonic reactions. Anexample would be the dehydration synthesis reactions of polysaccharide and proteinfonna6on.

4. Smallest unit of matter that is involved in chemical reactions are?

(_) Atoms. B. Ions. C. Protons. D. Electrons.E. Neutrons. _i

T _ 5. A irreversibility denatured protein retains its primary structure.

Page l, vl

I6. In order for a protein to have a quaternary structure, it must be made up of:

_ Amino acids containing sulfur. B. A sequence of amino acids.Two or more polypeptides. D. Histenes.E. Chemically diverse bonding patterns.

7. When electrons are lost or gained by an atom, the atom acquires a charge and it becomes:

An ion. B. A protein. C. An isomer. D. An isotope.E. A proton.

8. A nuclei" " of' : _' . , "C '_ " t

B. Nitrogenous base, amino acid and phosphate gr'_o2_/ ; _ = " "_"C. Nitrogenous base, fatty acid and ester groupD. Nitrogenous base, monosaccharide and nitrate groupE. None of the above

T(_) 9. The type of .bond found between sodium and chloride ions in sodium chloride is a hydrogenbond. _ _C \

('T)F 10. Electron orbitals represent volumes in space around the nucleus of an atom in which theelectrons are found.

11. Which type of bond is formed within a molecule or between portions of a molecule like thatseen in the structure of proteins and nucleic acids?a

A. Hydrogen bond(_t Ionic bondC. van der Waals' forces bondD. Hydrophilic attraction bondE. Covalent bond

Page 2, vl

Introduction to MicrobiologyMBIO 2815 Section 010Spring Semester 2009April 8, 2009Quiz # 5Team

Directions:

Multiple Choice: One correct answer per question. Correct answer could be "all ofthe above", "none of the above", or a choice of several answ_q-_for example; ChoiceE: A and B but not C and D). Mark your answers on your s_ihtron for theappropriate question number. .**

True and False. If the answer is True, mark the A column. If the atiswer Is False,mark the B column for the appropriate question number. '_

Point Value-l.0

REMEMBER, DO NOT CHANGE ANSWERS UNLESS YOU ARE ABSOLUTELYPOSITIVELY SURE THAT YOU MARKED THE WRONG ANSWERS.INVARIABLY, THE FIRST ANSWER.

T _) 1. Glycolysis occurs in the cytoplasm of eukaryotic cells and in the cytoplasmic membrane of

prokaryotic cells.

ynthesis reactions include which of the following:

._. CalabolismBreakdown of organic moleculesC. Exergonic reactionsD. Energy releaseE. None of the above

3. The proton-motive force is formed as a result of:

A. the outside of the membrane becoming more positive than the inside of the membrane.B. the outside of the membrane becoming more acidic than the inside of the membrane.C. the outside of the membrane having a higher concentration of protons 0-I+) than the

inside of the membrane.(_D.}All of the above.

F_. Noneof the above.

Page 1, vl

4. What is the gross yield of ATP from glycolysis? What is the net yield of ATP fromglycolysis?

B. 3/2(2. 2/1D. 2/4E. 2/2

5. How many ATP arc.olxxiac,etk,_x',NADI_in,clecg, .o_maaspg_g,angLchemi_m_?

B. ThreeC. FourD. OneF_. Five

6. Succinate + FAD 't" Fumarate + FADH 2.

What oxidized arid dehydrogenated the substrate.

A_ The substrata.

(_The endproduct.An enzyme.

D. FAD

FADH2-

"7. The function of ATP synthase is to:

A. Inhibit the movement of H+ ions across the membrane.B. To add energy to hydrogen ions as they move down the electrochemical gradients.C. To bond phosphate groups to ADPs to synthesize ATPs.

(_To consume one ATP for every 2H+ ions that flow down theconcenumion gradient.To uanspon H+ ions across the membrane to form an electrochemcial gradient.

8. Cytochrome b passes electrons to cytochrome cl.

A. Cytochrome b is reduced and cytochrome c 1 is oxidized.B. Cytochrome b and c I pump two protons across the membrane.C. Cytochrome b is oxidized and cytochrome c1 is reduced.__ ytochrome b passes the two electrons, one at a time to cytochrome c1

C and D arccorrect, while A and B are incorrecL

T (._ 9. The theoretical maximum yield from each molecule of glucose during aerobic respiration, inprokaryotic cells, is between 30 and 35 molecules of ATP.

10. Isocitricaeid +NAD + tooooooooo a-ketoglutaricaeid+CO2+NADH+H+.

A. Isocitric acid was carboxylatecLB. NAD + was oxidized.

(D_. Dephosphorylization of the substmte occurred.Isocitric acid was oxidized,

E. NAD + was oxidized to NADH.

Page 2, vl

I 1. If a COO- group is removed from an organic molecule by an enzyme, one would say that thesubstrate has been:

A. Dechlorinated

_. DecarboxylatedOxidized and reducedD. DephosphorylatedE. Dehydrogenated

¢,-

T [,_ 12. FMN is an example of a flavoprotein found in the electron transport chain. It is composed ofa protein and a n__._I_group called flavin. It is able to accept and donate 2e-'s and onlyaccepts 2H + which it passes across the membrane to aid in the generation of the proton-motive force.

13. How many hydrogens are pumped or transported across the membrane per NADH inelectron transport and chemiosmosis?

(_SixOneC. FourD. ThreeE. Five

Page 3, vl

Extra C.

Point Value 0._1 pt per question.


14. Step Six of Glyeolysis: Glyeeraldehyde-3-phosphate + PO4 + NAD + ....................

to 1,3-diphosphoglycerie acid + NADH + H+.

What was hydrogenated?

A. Glyeeraldehyde-3-phosphate.B. NADH.C. 1,3-diphosphoglyceric acid.D. NAD +.E. None of the above.

15. Step One of Glyeolysis: Glucose + ATP ................. Glucose-6-phosphate + ADP.What is the substmte?

A. ATEB. Glucose-6-phosphate.C. Glucose.D. ADP.E. None of the above.

Page 4, vl

Introduction to MicrobiologyMBIO 2815 Section 010Spring Semester 2009April 13, 2009

Directions:Multiple Choice. One correct answer per question. Correct answer could be "all of theabove", "None of the above", or "a choice of one answer that includes two or more of thechoices givenL


Point Value- 1.0


_('1-_.The proton motive force includes which of the following:

A. Hydrogens are pumped across to the outside of the membrane.B. The outside of the membrane is more positive in charge while the inside of the

membrane is more negative in charge forming an electrical charge gradient.C. ThEre is a concentration gradient of hydrogen ions from outside of the cell to inside of

the cell.D. The movement of hydrogen ions down the concentration gradient releases energy for

_l_i tranportation of molecules.

All of the above.

are utilized by prokaryotic cells for the:A. Transport of materials across the membrane.B. Binding of materials so that they can be transported across the membrane.C. Synthesis of Gram-positive bacterial cell walls.

_t,t_Adherence of bacterial cells to surfaces.Transport of genetic material from one prokaryotic cell to another prokaryotic cell.

3. Smallest unit of matter that is involved in chemical reactions are?

_Atoms. B. Ions. C. Protons. D. Electrons.Neutrons.

4. Krebs cycle and ETS are part of? 4

A@. Oxidative phosphorylation.Fermentation.C. Embden-Meyerhoff-Parnas pathway.D. Substrate level phosphorylation.E. Lipid biosynthesis.

Page 1,vl

5. Liquid, solid, and gaseous are.

.States of matter.Types of atoms.

C. States of electrons.D. Three types of chemical bonds.E. Subatom!c particles.

6. _t L _.._- ue-_e_pn_ . :-_ ,_ ..........

What was phosphorylated?

A. Substrate.B. 1,3-diphosphoglyceric acid.C. Endproduct,

Glyceraldehyde-3-phosphate.and D, but not B and C.

7. Which of the following provides resistance to desiccation and nutrients during starvationconditions, protects against biocides, and enables the modification of an organism'senvironment.

A. Pili and fimbrae._. Fmbrae and flagella.

Glyc.tx_yx.Endospores.

E. Outer membrane.

8. Which of the following causes the dehydration of the core of the endospore?

The cortex.

The exosporiumThe spore coats.Dipicolinic acid-calcium complex.

E. Small acid soluble proteins.

9. The movement of water molecules from an area of high concentration to an area of lowconcentration across the membrane is:

(_. Concentratibn gradientOsmosisActive transport

D. Simple transport

__ Facilitated diffusion

ch of the following are characteristic(s) of in_.g.ral membrane proteins:_) Are firmly embedded in the membraneB. Typically span the membrane from outside to insideC. Serve as uansporter molecules

some cases, they function as enzymes

I of the above

Page 2, vl

11. Which of the following characteristics of an eukaryotic cell is incorrect?

A. Eukaryotie cell onlain multiple chromosomes.B. The eukaryotic cell wall may or may not be present If present it is simple in chemical

_._ composition and is based on the carbohydrate macromolecule(s).Eukaryotic cells divide or reproduced by binary fission, mitosis or meiosis.

D. Eukaryotic chromosomes are enclosed in a membrane-bound organelle.

_A number of membrane-bound organelles are present in eu .karyoticcells.ch of the following serve as a reservoir of structural components or as an energy reserverial for prokaryotie cells?

Cysts.._ Inclusion bodies or granules._x Endospores.D_ ATP molecules.

Fungal reproductive spores.

13. An organelle closely associated with the endoplasmic reticulum, that functions in themodification of proteins, and consists of a stack of several flatten, disc-shaped sacs calledcistemae.

_ Golgi bodies.Nucleus.

C. Vesicles. -.D. Ribosomes.E. Mitochrondrion.

14. Functions of feedback inhibition:

A. Allows cell to regulate metabolic processes or pathways.B. Conserves chemical resources.C. Prevent tying up resources in the synthesis of materials that are not required.D. Conserves energy.

t'_ All of the above.

?_ as a means of vertical motility by planktonic prokaryotes."-"_.ff3as vesicles 6 Hagella C. Cell inclusions _ EndosporesPili "

16. Which of the following make up the backbone of the Imcteria cell wall called pcptidoglycan?1) n-acetylmummic acid 2) diaminopimelic acid 3) Lysine 4) Phospholipids5) hopanoids 6) N-acetyl glucosamine 7) five glycine molecules bonded together8) potassium symporter

A. 1,3,6 _ 1,6 /_5,7,8 ..../D:_2,4,5 .._2,517. If the movement of glucose from the outside of the cell into the inside of the cell requires ,

transport proteins and ATP energy, this would be an example of'/ ;

A. Simple diffusion.B. Facilitated diffusion.

(_ Osmosis.Active transport. .;All of the above.

Page3,vl

18. The site of protein synthesis, storage, packing and transport of proteins in the eukaryotic cell?

A. Smooth Endoplasmic Reticulum.B. Golgi bodies.C. Ribosomes.D. Mitochondrion.

_)Rough Endoplasmic Reticulum.ch of the following are purines?

Adenine 2) Cytosine 3) Alanine 4) Guanine 5) Tryptophan6) Uracil 7) Thymine 8) Methionine

_. land4 _. 1,3,and7 _.4,6, and8

2, and 6 {/_ 1,4, and 5

20. Two pyruvate + Two NADHs _ Two lactate + Two NAD+:

t_ Ethunol fermentationNADH is oxidized and dehydrogenatedC. Pyruvate is oxidized and dehydrogenatedD. Formate dehydrogenase mediated this reaction

e E. All of the above

he function of an actin eytoskeleton in prokaryotes is: .,To assist in the transport of materials throughout the cell.To confer cell shape and influence peptidolglycan synthesis.'

_..To provide more structural integrity to the cell.To serve as an anchor point for bacterial flagella.

To maintain cell shape.22. Tetrapeptide side chains come off of:

. Peptidoglycan B. N-acetylmuramic acidN-acetyl glucosamine D. Diaminopimelic acid

E. Teichoic acids

23. Which of the following function to strengthen and maintain the integrity of the eukar_,oticcytoplasmic membrane.

AA_-ISterolsHopanols

C. SteroidsD. HopanoidsE. Hopanoids and sterols

Which of the following connects the sheets of peptidoglycan to the cytoplasmic membrane ofa Gram-negative bacterium?

,_.; Wall teichoic acids.B. Integral proteins.

Po ins._Icipoteichoie acids.

_one of the above.

Page 4, v 1

ch of the following is a function of the outer membrane of Gram-negative bacteria.

.It enables Gram-negative bacteria to survive adverse environmental conditions.It erovides the Gram-negative bacteria with its antigenic specificity.It enables the Gram-negative bacteria to remove toxic waste products away from the cell.

D. It functions as an exotoxin.

lt enables the Gram-negative bacterium to adhere to surfaces.8 of Glycolysis; Two 2-phosphoglyceric acid tooo_o_ooa:oo_o_ Two

sphoenolpyruvic acid + 2H20.

The purpose of this step?

A. Hydrolysis._Formation of a high energy covalent bond.)]_Phosphorylation._. Hydrogenation._. Reduction.

27. Which of the following are not functions of teichoic acids:

(_) They anchor cell wall to cytoplasmic membraneThey are partially responsible for the positive charge of the gram-positive bacterial cellsurface

C. They provide the antigenic specificity of the gram-positive bacterium

D. They function to open up cell wall for the expansion of the cell wall (cell wall synthesis)during cell growth

E. They bind divalent cations such as Ca2+ and Mg 2+

s each pyruvate molecule traverses the citric acid cycle, how many molecules of carbonoxide are generated?A. 1

29. Step 7 of Glycolysis: 1,3-diphosphoglyceric acid + ADP ....................... to 3-phosphoglyceric acid + ATP.

This is an example of:

A. Dehydrogentation.

. Oxidative phosphorylation.bSubstmte-level phosphorylation.Photophosphorylation.

F_, No phosphorylation.

j"

tins are:Peripheral proteins found in the cytoplasmic membrane of Gram-negative bacteria.

_. Integral proteins found in the cell wall of Gram-positive bacteria.(C). Proteins that serve as channels in the outer membrane of Gram-negative bacteria._. Proteins found in the paracrystalline layers of Archaea.

E. None of the above.

Page 5, v1

31. The following functional group is an:

A. Hydroxyl group._E.. Phosphate group•

Amino group.Carboxyl group.Ester group. , _,

32. What makes carbon an ideal atomic building block to form the backbone of organicmolecules?

Its molecular weightIts valence.Its atomic weight.

D. Its concentration gradient.E, Its normality.

33. Chlorine has 7 electrons in its third orbital, which is its outermost orbital. What is the totalnumber of electrons in chlorine?

A. 7I_22 _ •

_17 _ _'"%' -'z.-

_"x_"_E. 14 , ,\"

_ch of the following are incorrect in regards to ATP synthase? '.""I_ It functions in oxidation-reduction reactions.B. Allows H+ to flow down the electrochemical gradient through the membrane.

_D.. It captures the energy released by the H+ moving down the electrochemical gradient,• It functions to synthesize ATP from ADP + PO 4.

,_ _LV"It is a channel protein.,¢/ x x

(_ 3_The function(s) of the cytoplasmic membrane include:k._ A. Energy conversion in prokaryotes.

B. Highly selective semi-permeable barrier.C. Helps maintain the integrity of the cell._)Regulates the movement of materials across the membrane.

All of the above

Page 6, v 1

36. Which of the following are necessary for fermentation to occur?.

An organic molecule as the final electron acceptor.The presence of oxygen.

g_. Electron transport system and ehemiosmotie generationof ATE_. Degradation of pyruvic acid to carbon dioxide in Krebs cycle._E( Generation of NADHs in Krebs cycle, before fermentation takes place.

37. Which of the following are necessary for mitochondria to replicate on their own?

A. Golgi bodies.B. Ribosomes.C. Mitochondrial DNA.

(_ Mitochondrial 70S ribosomesC and D, but not A and B

38. The pH of a solution changed from 5 to 9.What happened to the hydroxide ion concentration of the solution?How many times did the hydrogen ion concentration change as a result of the change in

pH?What would you add to the solution to return the pH to 5?

C_. _Increased; 10,000; acidDecreased; 1,000; baseIncreased; 1,000; acid

D. Decreased, I00,000; acidIncreased; 100; base

39. When protein structure changes due to extremes of pressure or temperature, we would beobserving:

A. Dehydration. /-B. Decarboxylation.

(_ Phosphorylation.Denaturation.E. Degradation.

/_cNO3 + 2H + + 2e- to NO2 +H20: ""

(_ Aerobic respirationFermentation

_ RespirationAnaerobic respirationAerobic/anaerobic respiration

41. If NAD + is present in a biochemical reaction in a cell, which of the following will beoccurring?

A. Dehy_&ggemmtion/hy&ogena,tionB. 'o-O eaif yl onC. Oxidation/reduction.

_ bosphorylation/dephosphorylationA and C, but not B and D

Page 7, vl

step one of Krebs cycle, where does the energy come from for the enzyme to bond acetyloxaloacetic acid to form the endproduct citric acid?Acetyl CoA + Oxaloacefic acid ..................... > Citric acid + CoA.

A. Reduction of oxaloacetic acid.(_. Oxidation of acetyl CoA.

Breaking of the high energy CoA bond.Rearranging the atoms on both substrate molecules provides the energy.

E. Utilization of one ATP to provide the energy.

43. Which of the following examples are not considered to be participants of a metabolicreaction?

A. ATP or ADPB. NAD + or NADHC. Glucose-6-phosphate

Glucose

None of the above.

_( Dehydration synthesis is a process by which are formedinto

A. Nucleotides; nucleic acids and water._ Amino acids; proteins and water

Monosaccharides; polysaccharides and water._'_AGlycerol and fatty acids; lipids and water

(_AI! of the above.45. Why does an atom in which its outermost electron orbital is less than half filled lose

electrons?

_)Its easier to lose a few electrons, than to gain many electrons.B. Too much energy must be spent to gain electrons.C. Atoms do not lose electrons from their outermost orbitals.D. Its easier to gain a few electrons, than to lose electrons.E. None of the above are correct.

Step Five of Krebs Cycle: Succinyl CoA + ADP + PO4 toooooooooooo Succinic acid +ATP + CoA, is an example of:

._DPhecarboDephosph°rylati°n"otophosphorylation.osphorylation.

xylation.E. Oxidation/redaction.

Page 8, vl

l/r47. In the preliminary step of Krebs cycle, which of the following are occurring:

Pyruvic acid + NAD+ + Coenzyme A _ Aeetyl CoA + CO 2 + NADH + H+

A. Formation of a high energy CoA bond.B. Decarboxylation of the substrate.C. Oxidation of the substrate and redaction of the electron carrier.

(_) Dehydrogenation of substmte and hydrogenation of the electron carrier.All of the above.

48. Chitin is an example of a:

_. olysaccharide.Monosaccharide.

C. Disaccharide.D. Oligosaccharide.E. None of the above.

49. What is the function of oxygen in electron transport and chemiosmosis?

A. Serve as a final electron acceptor.B. Form covalent bonds with two H+.

I(I(I_Be reduced to water.All of the above.

f,

Page 9, vl

True and False. If the answer is True, mark the A column of your scantron. If theanswer is False, mark the B column of your scantron. Be sure to mark your answers in thethe appropriate question number row. Point Value is 1.0.

T F 50. Energy metabolism, i.e. the conversion of energy, in prokaryotic cells occurs along thecytoplasmic membrane and in the cytoplasm.

T (Ff')51. NAD + + 2e- + 2H+ to NADH 2.

OF 52. Translocases are important for protein export because many bacteria enzymes functionoutside of the cell.

. The outermembrane of Gram-negative bacteria is semi-permeable like the cytoplasmicmembrane.

T_54. All protein are enzymes, but not all enzymes are proteins.

T tCF'_55.Cofactors and coenzymes are non-essential for the activation of an enzyme. They alsoM..-/

function to accept or donate electrons and/or atoms.

TO56. In a biochemical sense, a catalyst is something that lowers the activation energy of the reaction

thus decreasing the reaction rote.

(_ F 57. Metabolism is the sum of all chemical reactions in the cell.This would include all degradationreactions which are catabolic in nature and all synthesis reactions which are anabolic innature.

(-_)@ _'X Endoplasmic reticulum connects the nuclear membrane with the cytoplasmic membrane.

(_F 59. As energy is changed in form, the entropy of the energy increases. This would be aabreviated summary of the second law of thermodynamics

(_)F Ethanol is two fermentation in which is converted6O. production a step process pyruvateacetaldehyde and carbon dioxide via decarboxylation and acetaldehyde is convert to to ethanolvia oxidation and reduction.

TT_(_Enzymes are typically highly specific in that they are able to catalyze only a single reaction.This is due to the fact that their structure provides a binding site where only the specificsubstmte or class of substrates can bind and intiate a chemical reaction.

@)_The unique folding of a protein is directed by the primary structure of the protein. Thisque folding determines the protein's biological activity.

(_)F 63. Small prokaryotes that were engulfed by larger prokaryotes and eventually becamemitochondria and/or chloroplasts is the based for the endosymbiotic theory of theseorganelles.

T (B)64. If a microorganism ferments two molecules of pyruvate to two molecules of lactic acid, itwould be referred to as a heterofermentative organism.

q_65. Each molecule FADH 2 yields are pumped acrossof three ATP because four H+ the

membrane and then allowed through the ATP synthase to produce the ATPs mentioned?

T(_)66. The difference between prokaryotic and eukaryotic ribosomes, is that the prokaryoticribosomes are 80S in mass and the eukaryotic ribosomes are 70S in mass.

(_F 67. The Electron Transport System needs to be or on alocated in membrane because of the need

to generate an electrochemical gradient for the synthesis of ATP,

Page 10, vl

Extra Credit. Mark your answers on your scafltron for the appropriate question number.Point Value is 1.0, except for C. Evans and D.Schultze who will receive

F_0._I pts.he differences between the eukaryotic and prokaryotic flagella are: the eukaryotie flagella isot hollow, moves in a whip-like fashion and contains a 9+2 arrangement of pairs of

- microtubules; while the prokaryotie flagella moves in a rotor-like fashion, is hollow and doesnot contain microtubules.f_,.r

T (F_:_, The following chemical structure is correct.

Phospho- Phosphate Riboseanhydride ester

h \Ii O II CHz,,: ":;, __--_nine

Phosphates tirOH OH

Fl_re 3-10 Omtk elolo_ of I/_-_o_anlm_ II/e020_6 Fearson Pmldce FLail,In_

_.A purpose of the low water content of the endospore core:

Provides dessication resistance.B. Inactivates enzymes.C. Converts DNA fro the "B form" to the "A form".D. Provides resistance to high pressures.E. None of the above.

71. When a carboxyl group is removed from an organic molecule like pymvate, this process iscalled:

A. Dehydrogenation B. Deketolization //C.]DecarboxylationD. Dephosphorylation E. Not of the above

72. Which of the following are the hydrophilic component of the phospholipid molecules thatmake up the lipid bilayer of the cytoplasmic membrane?

(_) Integral proteins.Glycerol-phosphate component.

C. Nueleotide molecules.Fatty acid component.

F_, Disaccharide component.

Page ll, vl

..... _ - --: • - .................... r ....... _-: ............. _ -'_'-_14 /

73. After FMN has been reduced and hydrogenated to FMNH2, what occurs next:

(_FMNH 2 passes two electron to Q, which is reduced, and pumps two H+s out of the celld is oxidized and dehydrogenated to become FMN.B. Fe/S protein passes two electron to Q, oxidation/reduction reactionsC. Fe/S protein is reduced by accepting two electronsD. FAD.H2 has to interact with Q before FMNH 2 is able to do anything with electrons and

hydrogensE. None of the above.

Page 12, vl

Introduction to MicrobiologyMBIO 2815 Section 010Spring Semester 2009April 29, 2009Exam #4

Team l

Directions:

Mark your answers on your scantron for the appropriate question number. Correctanswer could be all of the above, none of the above, or a choice that allows two ormore answers to be chosen. Point Value-l.0 per question

Remember, the first answer that you chose is invariably the correct answer. So donot change your answers UNLESS YOU ARE ABSOLUTELY POSITIVE THATYOU HAVE CHOSEN AND INCORRECT ANSWER.

1. Which of the following is not a function of DNA polymerases?

. Synthesis of the new daughter strandReading of the nucleotide sequence on the parental strand in the 5' to 3' directionRemoval of the primer

D. Proofreading new daughter strand and correction of mistakes_o E. Correction of mistakes during synthesis of the daughter strand

s the ribosome moves down the mRNA reads the cedon sequence and synthesizes thewing chain of amino adds, what would be the final step in the process.

A. The ribosome moves the mRNA through itself, by one codon so that the P site is filled

}9/"1 with a tRNA carrying the growing chain of amino acids and the A site is empty, wailingff/_for another tRNA carrying an amino acid with a complementary anticodorL_._B.))A stop codon has been reached and the chain of amino acids is released and the

'_J ribosome comes apart and translation by this ribosome has been completed.C. The ribosome removes the amino acid from the tRNA in the P site and bond that amino

acid to the amino acid carried by the tRNA in the A site.J_. The ribosomal subunits come together at the universal start codon, AUG, of the mRNA

to form a ribosome and began translation.(_ None of the above.

3. Which of the following are required for the AMES Test?

A. Agarmedium lacking histidine.B. Rat Liver extract.C. Culture of hislidine dependent Salmonella.

,i(,_ All of the above.

Page 1, v5

_f_T act°sidase:ransports lactose across the membrane.

_. The inducer that inactivates the mpressor protein allowing transcription of the lac_. operon.

Degrades lactose to glucose and galactose.Functions in the metabolism of disaccharides.

E. Is the activator portein of the lac operon.

5.TheP ....

with a tRNA carrying the growing chain of amino acids and the A site is empty, waitingfor another tRNA carrying an amino acid with a complementary anticodon.

B. A stop codon has been reached and the chain of amino acids is released and theQ ribosome comes apart and translation has been completed.

The ribosome removes the amino acid from the tRNA in the P site and bonds that aminoacid to the amino acid carried by the tRNA in the A site.

,_. The ribosomal subunits come together at the universal start codon, AUG, of the mRNAto form a ribosome and began translation.

F_, None of the above.

6. Why is there discontinuous synthesis of DNA on the lagging parental DNA strand?

A. DNA polymerase complex must read 5' to 3' on the lagging strand and thus synthesis isslower, i.e. discontinuous synthesis of lagging swand.

(_ Prirnase is only able to make single primers, one at a time•DNA polymerase complex is designed to read in one direction. On the lagging strand itis reading in reverse and is unable to stay bound to the lagging parental strand for verylong to conduct continuous synthesis of the daughter strand.

D. DNA ligase is only able to function during synthesis of the leading samad.F- None of the above.

7. 64 codons for twenty amino acids in translation is called:

(_ Degeneracy.B. Restriction enzymes.C. Chemiosmosis.D. Attenuation.E. Koch's postulates.

ransformalion:• The process by which genes can cut themselves out of the DNA molecule, move to

___._another location on the DNA molecule and re-insert themselves into the DNA molecule..! The process by which a prophage takes some of the host DNA with it, when it excises

,_, its self from the host cell DNA.

(_'_hf e process by which a MO can pick up free, naked DNA from the environment,transport it across its cell membrane and incorporate some of the DNA into itschromosome or cytoplasm.

D. The process by which DNA can be transferred from one MO to another MO via a pilusthat connects the two cells together.


Page 2, v5

9. When lactose is present:

A. RNA polymerase binds at the promoter region and begins the transcription of the threeslractural genes.

B. Repressor protein is unable to bind to the operator region of theLac Operon and preventWanscription.

C. Translation of the mRNA occurs with the formation of three proteins that function in themetabolism of lactose.

D. Some of the lactose is converted into allolactose which binds to and inactivates the

_ repressor protein.All of the above occur when lactose is present. ._ , '

Which of the the best definition offollowing gene?a

A. A sequence of nucleotides on DNA._. A sequence of nucleosides._. A sequence of amino acids that makes up a protein.{D) A sequence of nucleotides on DNA at encodes for a gene producL

_ A sequence of nucleotides on mRNA. C_ _ 3,_,.60c3

_ Which of the following are incorrect in regards to the need for inducible genes?// \\ A. Prevents the wasting of ATP energy resources of the cell.

Prevents the wasting of amino acid and nucleotide resources of the cell.Prevents the formation of gene products that maybe hazardous to the cell.Prevents synthesizing gene products that are not needed at thattime.

None of the above am incorrect in regards to inducible genes.

12. Fragments of DNA that have been synthesized during replication of the lagging strand?

A. Boren fragments, which require primase to fill in the gaps so thatthe synthesis of the(_) daughter strand is completed.

Okazaki fragments, which require DNA ligase to fill in the gaps so that the synthesis ofthe daughter strand is completed.

C. Required for semi-conservative replication to occur.D. Another term for the RNA primerthat is part of DNA replication.E. Okazaki fragments, which require RNA polymerase to fill in the gaps so that synthesis

of the daughter strand is completed.

13. Molecules of DNA that move from one site on a chromosome to another site on the samechromosome or a site on another chromosome.

_. ransposonsPlasmids 'C. Centromeres.D. Circular chromosomes _C ,A.

E. Mitoehrondrial DNA.3c_ x_ 03\ _Sv'O _ t.r

n organism whose genome carries a mutation, is called a:A. P6i_i' m_tation. 41B. Transformation.

D_.. Auxotroph.Mutant.Genotype.

Page 3, v5

15. Where does transcription take place in e_..___c cells?

.Nucleus.Ribosomes.

C. Cytoplasm.D. Mitochondri_.

E. Endoplasmic reticulum.

1__. ISemi-conservative replication in prokaryotes?Part republican and part democrat.Each daughter cell receives a DNA molecule consisting of two parental strands of DNA.

C. Each daughter cell receives a DNA molecule consisting of one parental strand and onedaughter strand.

D. Each daughter cell receives a DNA molecule consisting of both daughter strands.

l_epE. None of the aboveen Fredrick Gfiffth injected heat-killed smooth strain and healthy rough strain of .

tococcus pneumoniae into mice, why did the mice die and why was he able to isolateonly smooth strain from the dead mice.

A_.A virus transferred the genetic information from the dead smooth strain to the live rout,strain causing the rough strain to become the a pathogenic smooth strain and kill themice.

B. The smooth strain and the rough strain underwent sexual reproduction whieh resulted inthe rough swain picking up genetic information that cause it to change into the smoothpathogenic strain and kill the mice.

C. The live rough strain formed pilus with the dead smooth swain and the genetic "information for forming a capsule was transferred from the dead smooth swain to the

_)live rough strain enabling it to convert to the smooth pathogenic strain and kill the mice.The live rough strain picked up DNA from the heat-killed smooth strain. In that DNAwas the genetic information for the formation a capsule. The rough strain was then ableto form a capsule, thus become pathogenic by becoming a smooth strain that killed themice.

E. None of the above is the correct process or makes any sense.

18. Codon:

A_ Three nucleotide sequence on mRNA B. Three nucleotide sequence on DNAThree nucleotide sequence on rRNA D. Three nucleotide sequence on tRNA

E. Three nucleotide sequence on ATP

19. When the F factor becomes in_jrl_omted into the ceJl!schromosome, the cell is called a?

(_C Transposed cell., Hfr cell.

• Recombinant cell.D. Transformed cell.E Plasmid containing cell.

20. Genes that are being transcribed and translated continuously are?

). onstitutive genes.Repressed genes.

C. Some times inducible and other times repressed genes.D. Inducible genes.

Page 4, v5

(/ff_e are talking about the ability of a specific microorganism that ferments lactose to acids and

_: we would be describing its?

(/_. Phenotype.Genome. "-

C. Gene._. Plasmid.

Chromosome.

22. After a tRNA carrying an amino acid with the complementary anticodon binds in the P site,what occurs next in the translation process?

A tRNA carrying an amino acid with the complementary anticodon binds in the P site.A tRNA carrying an amino acid with the complementary anticodon binds in the A site.The ribosome moves the mRNA through itself, by one codon so that the P site is filledwith a tRNA carrying the growing chain of amino acids.

D. The ribosome removes the amino acid from the tRNA in the P site and bonds it to thetRNA carrying an amino acid in the A site.

F_, A stop codon has been reached and the chain of amino acids is released and the

Oh. ribosome comes apart and translation has been completed.e purpose of the AUG codon on a mRNA molecule?Causes the termination of translation of the mRNA molecule

_. Aids in replication of DNA by causing the initiation of the process."U. Required to attach amino acid molecules to tRNA molecules so that translation can

OCCUI'.

(_ Irtitiates the translation of the mRNA molecule's nucleotide the ribosome,sequence, byinto an amino acid sequence.

y ls necessary for the protein to have the correct sequence of amino acids and to fold intothe proper protein configuration.

Feedback Inhibition:I x A. An inhibitor binds at the active site of the enzyme preventing the normal substrate from

binding to the enzyme. Thus preventing the metabolic pathway from functioning.

(_A mechanism of controlling metabolic via the inhibitor (endproduct of aprocessesmetabolic pathway) which binds to the active site of the enzyme, changing theconfiguration of the enzyme, thus preventing the normal substrate from binding and thereaction from coeurring.

ft. The operon mechanism of metabolic control in which the promoter, opemture, repressorprotein, RNA polymeruse are all necessary to prevent enzyme action.sa mechanism of covalent modification of enzymes.

mechanism of controlling metabolic processes via the inhibitor (endproduct of a

etabolic pathway) which binds to the allosteric site of the enzyme, changing theconfiguration of the enzyme, thus preventing the normal substrate from binding and themelabolic pathway from functioning.

25. Phenylketouria is an example of or a:_ Point mutation.

B. Transformation.C. Auxotroph.D. Mutant.E. Genotype.

Page 5, v5

26. Three base sequence on tRNA?

A. RNA primer.

_. Regulatory gene.PAnticodun.

Nonsence codon.E. Sense codon.

27. Allolactose?

A. Regulator of the Lac Operon._. Repressor of the Lac Operon.

Inducer of the Lac Operon.Enzyme that conducts transcription.


Why is the regulatory gene located upstream from the promoter and operator sites on the lacperon?A. That is just the way things evolved. Whether it was located upstream or down stream ofr---- the promoter and operator sites, has no effect on its function._B-) It is necessary for the regulatory gene to be in this position, its transcripton and"_ translation can be regulated. This allows for the formation of the repressor for

repression of the operon and inhibition of the formation of the repressor for induction ofthe operon.

(_The regulatory gene has no function in repression or induction of the operon. " ,.It is necessary for the regulatory gene to be in this position, so that it can be Wanscribedand translated independently of the structural genes. This enables the formation of therepressor which can repress the operon or be inactivated so the the operon is induced.

29. Removal of a base or series of bases from the nuclcotide sequence of a gene?

_._ Frameshift mutation._) Deletion.C. Insertion.D. Point mutation.E. Inversion.

30. What is the function of a pileus during conjugation?

A. Adherence of the cell to surfaces so that conjugation can take place.,_ Functions in phagocytosis of live antigens in the human body.

Causes the formation of dental caries.Enables the transfer of the F factor from the F+ cell to the F- cell.

_. Functions in chemotaxis response of motile bacterial cells.

31. Site in ribosome which accepts the incoming tRNA carrying an amino acid, after translationhas started:

_. A-siteR-site

C. E-siteD. D-siteE. P-site

Page 6, v5

32. What type of mutation has occurred?

3' ACTAGTAGGCCGATACGACG 5' (Normal DNA)

3' ACTAGTAGC_CGA&Ci'ACGACG 5' (Mutated DNA

_. nversionFrame.shift mutationPoint mutation

D. DeletionE Base substitution.

33. Which of the following amino acid sequences is correct for the given mRNA sequence7

5'A.EI-GACU GGC -[:tCUU/k'U UGU UUU UGG UGA3'

,,K. st_p-tryptophan-pheny_a_anine-cysteine-tyr_sine-serine-g_y_ine-threonine-methi_nine

8 methionine-threonine-glycine-sen ne-tyrosine-phenylalanine-cysteine-trytopluan-stopmethi_nine-thre_ni_e_g_y_ine-serine_tyr_sine-_ysteine-pheny_a_anine-trypt_phan-st_p_D. threnortine-glycine-methioniue-arginine-lysine-valine-ghitamic acid-tryptophan-stop

._,,_ metbionine-threonine-glycine-serine-tyrosine-stop/_t_. ,,Which of the following sequences is the correct sequence of a molecule of mRNA that has

(,,_been transcribed from the following DNA sequence: 3' AAAGCGGAGCACTATAGTA5',_/ '_,,,_ 3'UUUCGCCUCGUOAUAUCAU5

r fO3,.)SrlTrCCd2CTCGTGATATCAT3 , '5VLrOCCCOAC AGAUAUCA,U3 3 C COTOATATCAT5

V,-J35. Tffe region of the operon where the repressor binds to inhibit transcription7

A. Regulatory gene. B. Promoter. CC_Operator.D. Inducer. E. Structural gene(s).

36. The function of the regulatory gene on an operon?

A. To regulate transcription and thus translation of the operon.B. Carries the genetic information for the formation of the repressor.

(_To be transcribed and translated to form the repressor.All of the above.

37. The phosphate group of a DNA nucleotide is bound to the of the sugarmolecule?

A. I carbonB. 2 carbonC. 3 carbon

4 cartx)n

Page 7, v5

i

38. The function of Helicases?

A. Reads a short portion of the DNA nucleotides and synthesizes an RNA primer.B. Complex of enzymes that synthesizes the new daughter strand by reading the nucleotide

sequence of the parental DNA strand.C. Keeps parental strands separated and prevents their rewinding back together during

DNA replication.Separates and unwinds the parental strands of DNA so that replication can take place.Fills in the gaps between Okazaki fragments by reading the parental DNA strand andcompleting the synthesis of the new DNA strand.

39. 3'A'I_AC_ATAGC_AGGCTGCCCACGAS' Parental strand5"FAATGtSTATCGATCCGA CGGGTGCT5' Daughter strand

What component will deal with the misplaced A in the daughter strand and what will thatcomponent do?

A. Primase; Will replace the A with a U, since this is part of the primer.B. Helicase; Will reopen the two strands of DNA at the site of error so that the error can be

corrected.C. DNA ligase; Will bind to the daughter strand, separate it from the parental strand,

mOVethe misplaced A and replace it with the correct C.NA polymerase complex; Will have proofread itself during replication, corrected the

r by replacing the A with a C during replication so that this error would not bepresent at the end of replication.

E. None of the above provides a sufficient answer.

_8, v5

True and False. If the answer is True, mark the A column of your scantron. If theanswer is False, mark the B column of your scantron. Remember to mark your answers in

F_ appropriate question number row on your scantron. Point Value-l.0T . When an F- cell receives a plasmid from an F+ cell, the F- cell remains as an F- cell.

(_F 41. There are three eategories of genes. They are; genes that code for RNA, structural genes thatcode for proteins, and regulatory genes that control gene expression.

T F_42. A nonsense mutation is a type of point mutation the can change a gene product into a proteinwith less function or a protein with an increase in function.

_)F 43. An mRNA molecules can be repeatedly translated in order to provide a sufficientconcentration of the gene products necessary to meet a particular metabolic need of amicroorganism.

_F 44. The anticodon on the tRNA molecule must be complementary to the codon on the mRNAmolecule for the tRNA to bind in the ribosome sites.

_)F 45. The reason that an RNA primer must be synthesized before DNA polymerase complex canbinds and begin replication of the DNA, is that DNA polymerase cannot synthesize the newdaughter strand unless an existing chain of nucleotides is already present.

T (__ 46. Codon usuage is random.

(_ F 47. We are talking about regulating gene expression. This would mean that we are talking aboutthe regulation of protein synthsis.

T(_ 48. During transcription of a gene or series of genes, the DNA strands are separated so that all ofthe genes on the chromosome can be Wanslated.

T(_9. Primase reads a short sequence of the parental strand of DNA forming a sequence of RNAnucleotides called the primer which enables the DNA polymerases to bind to parental strandsand began synthesis of the daughter strands due to the presence of a preexisting 5'-O1-I

During transcription, the RNA polymemse reads and transcribes the 3' to 5' DNA strand_nucleotide sequences into an mRNA nucleotide sequence which is 5' to 3'. During synthesisof the mRNA strand, thymine nucleetides are replaced with uracil nucleotides in the mRNAmolecule.

Page 9, v5

Extra eredit. Mark your answer on your scantron for the appropriate question number.

(_) Point Value- 1.0F 51. If a histidine-dependent Salmonella strain produces 9 colonies in the presence of a suspectedmutagen on histidine lackingmedium and the same strain of Salmonella produces only 5colonies on the histidine lacking medium in the absence of the suspected mutagen, one couldstate that the suspected mutagen is a mutagen.

52. A cluster of several genes whose expression is under the control of a single operator is calleda(n)?

(_). In_'onOpcron

C. ExonD, AnticodonE. Sense codon

53. B-galactoside permase:

A. Transports lactose across the membrane.B. The inducer that inactivates the repressor protein allowing transcription of the lac

operon._Degrades lactose to glucose and galactose.D. Functions in the metabolism of disaccharides.E. Is the activator portein of the lac operon.

54, Fredrick Cn-iffthd_vered this process:

_. Point mutation.,;TransformatiorL

C. Auxotroph.D. Mutant.E. Genotype.

Page 10, v5

IIlllllllIlJlIJIIJlllllIIllllIIlllIlllJllllIlllllIJllIllIllgpbou.weebly.com/uploads/2/6/6/4/26648965/mbio_2815.pdf ·...

Documents

Transcript of IIlllllllIlJlIJIIJlllllIIllllIIlllIlllJllllIlllllIJllIllIllgpbou.weebly.com/uploads/2/6/6/4/26648965/mbio_2815.pdf ·...