FACULTEIT DIERGENEESKUNDE

VAKGROEP VIROLOGIE, PARASITOLOGIE EN IMMUNOLOGIE LABORATORIUM VOOR IMMUNOLOGIE VAN DE HUISDIEREN

CYTOKINE RESPONSES AND DNA IMMUNIZATION IN THE PIG

TINE VERFAILLIE

Proefschrift voorgelegd aan de Faculteit Diergeneeskunde tot het verkrijgen van de graad van Doctor in de Diergeneeskundige Wetenschappen

Promotoren : Prof. Dr. E. Cox en Prof. Dr. B. Goddeeris Merelbeke, 2005

Table of contents

TABLE OF CONTENTS

LIST OF ABBREVIATIONS .............................................................................................

PART I : INTRODUCTION ............................................................................................

CHAPTER 1 : THE TH1/TH2 PARADIGM .....................................................................

1.1. Th-1 and Th2 cells : polarised forms of the specific immune response ......................

1.2. Factors responsible for Th1 or Th2 polarisation ..........................................................

1.3. The decision to polarise ...............................................................................................

1.4. The molecular base for Th1/Th2 polarisation ..............................................................

1.5. Regulation of T cell responses .....................................................................................

CHAPTER 2 : AN UPDATE ON PORCINE CYTOKINES .............................................

CHAPTER 3 : DNA VACCINES IN VETERINARY MEDICINE ..................................

3.1. The features of a DNA vaccine ....................................................................................

3.2. Immune mechanisms of DNA vaccination ..................................................................

3.3. Efficacy of DNA vaccines in large animals .................................................................

PART II : AIMS OF THE STUDY .................................................................................

PART III : EXPERIMENTAL STUDIES ......................................................................

CHAPTER 4 : COMPARATIVE ANALYSIS OF PORCINE CYTOKINE PRODUCTION BY MRNA AND PROTEIN DETECTION ............................................ CHAPTER 5 : LIGHTCYCLER RT-PCR AND COMPETITIVE RT-PCR ARE AS ACCURATE FOR QUANTIFYING CYTOKINE TRANSCRIPTS IN PIGS .................. CHAPTER 6 : PRIMING OF PIGLETS AGAINST F4 FIMBRIAE BY IMMUNISATION WITH FAEG DNA ............................................................................. CHAPTER 7 : IMMUNOSTIMULATORY CAPACITY OF DNA VACCINE VECTORS IN PORCINE PBMC : A SPECIFIC ROLE FOR CPG-MOTIFS? ................

Table of contents

PART IV : GENERAL DISCUSSION ............................................................................ References .......................................................................................................................... Curriculum Vitae .............................................................................................................. Publications, abstracts and proceedings ......................................................................... Summary ............................................................................................................................

List of abbreviations

List of abbreviations Ag Antigen APC Antigen-presenting cell CD Cluster of differentiation CT Cholera toxin CTL Cytotoxic T-lymphocyte(s) CTLA-4 Cytotoxic T lymphocyte antigen-4 C-maf Cpm Counts per minute ConA Concanavalin A DC Dendritic cell(s) DHEA Dihydroepiandrosteron DNA Deoxyribonucleic acid dNTP deoxynucleotide triphosphate Dppi Days post-primary immunisation Dpsi Days post-secundary immunisation DTH Delayed type hypersensitivity EBI3 Epstein-Barr virus-induced gene 3 E. coli Escherichia coli ELISA Enzyme-linked immunosorbent assay ETEC enterotoxigenic Escherichia coli FCS Foetal calf serum FHA Filamenteus hemaglutinin FOXP3 forkhead box P3 GATA-3 GITR Glucocorticoid-induced TNF-receptor family related receptor GM-CSF Granulocyte colony stimulating factor HCG Human chorionic gonadotropin HEWL Hen egg white lysozyme ICAM Intercellular adhesion molecule ICOS Inducible co-stimulator ID intradermal(ly) Ig Immunoglobulin IGIF Interferon-gamma-inducing factor IL Interleukin IFN Interferon IM intramuscular(ly) LC LightCycler LT Heat-labile enterotoxine LFA Lymphocyte function-associated antigen MAPK Mitogen-activated protein kinase mDC Monocyte-derived dendritic cell MHC Major histocompatibility complex class MØ macrophage mRNA messenger ribonucleic acid NFAT Nuclear factor of activated T cells NF-κβ Nuclear factor kappa-beta NK Natural killer NKT Natural killer T cell

List of abbreviations

OD Optical density ODN Oligodeoxynucleotide PBMC Peripheral blood monomorphonuclear cells PBS Phosphate buffered saline PCR polymerase chain reaction PHA Phytohemaglutinin PRR Pattern recognition receptor PS Post-stimulation PWM Pokeweed mitogen R receptor rp Recombinant protein RT reverse transcriptie SD Standard deviation SEM Standard error of the mean SI Stimulation index STAT signal transducer of activators of transcription T-bet Tc cytotoxic T-cell TCCR T-cell cytokine receptor TCR T-cell receptor TGF Transforming growth factor Th T-helper Thp T-helper precursor Tim-3 T-cell immunoglobulin mucin-3 TLR Toll-like receptor TNF Tumor necrosis factor Tr/Tregs Regulatory T cell

Introduction

1

INTRODUCTION

One of the greatest achievements in modern medical science has been the development

of effective vaccines resulting in remarkable reduction of many infectious diseases.

nevertheless, vaccination of neonates remains a very significant challenge for vaccine

research in both human and veterinary medicine. The immaturity of the immune system

combined with the immune suppressive effects of passively acquired maternal antibodies

often results in reduced or undetectable immune responses early in life (Siegrist and Lambert,

1998 ; Kovarik and Siegrist, 1998 ; Siegrist, 2001; Siegrist, 2003).

This is also a major problem in vaccine development against enterotoxigenic E.coli

(ETEC) that may affect neonatal and recently weaned pigs. ETEC infections are an important

cause of diarrhoea, weight loss, growth retardation and death in neonatal and newly weaned

pigs and is responsible for great economic losses (Jones and Rutter, 1972). In general, most

neonatal infections can be prevented by vaccination of the sows hereby providing lactogenic

immunity to the offspring. However, this passive protection decreases with aging and at

weaning lactogenic immunity disappears. So, newly weaned animals become highly

susceptible for enteropathogens. In order to protect newly weaned piglets against ETEC

infections they should be vaccinated during the suckling period but at present no commercial

vaccine is available that allows successful vaccination. A more recent approach in vaccine

development is DNA vaccination. Maternal antibodies will not inhibit the DNA vaccine itself

because antigen is not available until de novo synthesis occurs in the transfected cells. Several

studies in animals already showed that DNA vaccination represents a unique opportunity to

overcome the limitations of conventional vaccination strategies in early life in the face of

maternal-derived immunity (Fischer et al., 2003 ; Hassett et al., 1997 ; Martinez et al., 1997 ;

Pertmer et al., 2000 ; Van Drunen Littel-Van den Hurk et al., 1999 ; Manickan et al., 1997 ;

Weeratna et al., 2001 ; Van Loock et al., 2004 ; Bot et al., 2001). Especially heterologous

prime-boost strategies have shown promising result (Siegrist et al., 1998 ; Sedegah et al.,

2003 ; Griot et al., 2004 ; Bot and Bona, 2002).

In vaccination studies, antibody and proliferative responses are the most frequently

used parameters to measure immune responses generated. Additionally, cytokine profiles may

also give valuable information on the type of immune response elicited. Cytokines, which are

small- to medium sized proteins and glycoproteins, mediate highly potent biological effects

on many cell types. They have critical roles in haematopoiesis, inflammatory responses and

the development and maintenance of immune responses. Importantly, cytokines can influence

Introduction

2

the outcome of vaccination by exerting effects on various stages in the immune response,

including enhancement of antigen presentation, polarization of T helper subsets, regulation of

antibody isotype production and expansion of the T and B cell memory pool. Therefore,

attempts to define the immune response mechanisms operating in vaccinations or elimination

of foreign pathogens should involved studies on the regulatory functions of these cytokines.

In the 1980s, there was a massive explosion of literature on human and mouse

cytokines. In the last decade, rapid progress has also been made in the cloning and

characterization of cytokines from livestock and compagnion animals which made it possible

to develope sensitive techniques for the accurate detection of cytokines in several species

(Murtaugh, 1996). One of the most interesting proposals in immunology has been the division

of T helper cells into two classes (Th1 and Th2 cells) based on their cytokine profiles

(Mosmann et al., 1986).

In chapters 1 and 2 we will attempt to review the current status on the Th1/Th2

paradigm in general as well as in pigs. The potential of DNA vaccines in veterinary medicine

is described in chapter 3.

3

CHAPTER 1

THE TH1/TH2 PARADIGM

4

CHAPTER 1 : THE TH1/TH2 PARADIGM

1.1. Th-1 AND Th-2 CELLS : POLARISED FORMS OF THE SPECIFIC IMMUNE

RESPONSE

1.1.1. Th cell cytokines, phenotype and function

When confronted with a pathogen, it is important that the immune system activates the

appropriate type of response. Fortunally, it has developed reliable mechanisms that help naive

CD4+ T cells in this choice. Both experimental animal models of immunisation as well as

spontaneous human and animal diseases have demonstrated that CD4+ T lymphocytes have

the ability to produce a wide array of cytokines upon encountering foreign antigens. With the

application of two important techniques for analysing lymphocytes, namely methodes for

propagating cloned lines of T cells and assays for cytokines, Mosmann and colleagues (1986)

provided evidence that murine CD4+ T cell clones could be assigned to two different subsets

on the basis of distinct, non-overlapping cytokine secretion patterns in response to stimulation

with specific antigens or polyclonal mitogens. The T cells were designated T helper type 1

cells (Th1), characterised by the secretion of interleukin (IL)-2, tumour necrosis factor (TNF)-

β and interferon (IFN)-γ and T helper type 2 cells (Th2), characterised by the secretion of IL-

4, IL-5 and IL-10.

The functional differences between the Th subsets can largely be explained by the

biological activities of the subset-specific cytokines produced (Mosmann and Coffman,

1989).

- Th1 cells are responsible for the activation of macrophages to a microbicidal state,

the induction of IgG antibodies that mediate opsonization and phagocytosis and

the support of CD8+ antiviral effector T cells (Fig. 1). Th1 cells have been

demonstrated in numerous infectious disease models to activate appropriate host

defenses against intracellular pathogens including viruses, bacteria, yeast and

protozoa. Th1-dominant immune responses are also often associated with

inflammation and tissue injury because two Th1 cytokines, TNF-β and IFN-γ,

recruit and activate inflammatory leukocytes. The typical inflammatory reaction

called delayed type hypersensitivity (DTH) is often a price that is paid for

protective immunity against microbes. On the negative side, when the Th1

5

pathway is overreactive, it can generate organ-specific autoimmune diseases

(Singh et al., 1999).

Figure 1 : Effector functions of the Th1 subset of CD4+ helper T lymphocytes.

- Th2 cells stimulate the growth and differentiation of mast cells and eosinophils, as

well as the production of antibody isotypes, including IgE, which can mediate the

activation of these cells (Fig.2). Th2 cells are involved in the protection against

extracellular pathogens and are also central mediators in the pathogenesis of allergies

(reviewed by Abbas et al., 1996 ; Reiner and Seder, 1995 ; London et al., 1998).

Complement fixing and opsonizing Ab

Th1

Naive CD4+

T cell

CD8+

T cell B cell

IFN-γ IFN-γ

IFN-γ

Antigenic stimulus

Opsonization and phagocytosis

CTL

Macrophage activation

TNF-β

6

Figure 2 : Effector functions of the Th2 subset of CD4+ helper T Lymphocytes

Two other features of these Th clones are important in our understanding of the

generation of Th cell diversity. First, it was shown that each T cell subset produces cytokines

that serve as its own autocrine growth factor. A type of feed-forward loop promotes further

differentiation of that subset. Second, the two subsets produce cytokines that cross-regulate

each others development by blocking the generation of the other cell type and by blocking

each others effector functions. For instance, at the level of effector functions, IL-4 antagonises

much of the pro-inflammatory effect of IFN-γ and also inhibits the proliferation of Th1 cells

(Hsieh et al., 1993). Conversely, IFN-γ secreted by Th1 cells blocks the proliferation of Th2

cells (Demeure et al., 1994).

More recently, the possibility that some surface markers are preferentially associated

with Th1 or Th2 cells has also been extensively investigated (Tabel 1)(Annunziato et al., 1998

; Bonecchi et al, 1998 ; Baggiolini, 1998). Th1-preferentially expressed genes include the

IFN-γ receptor β-chain, IL-12 receptor β-chain, IL-18 receptor, the P-selectin glycoprotein

ligand-1 (PG-1), and the CXCR3 and CCR5 chemokine receptors (Davis et al., 1984 ; Bach et

Neutralizing Ab (IgG1)

Th2

Naive CD4+

T cell

Eosinophil B cell

IL-4, IL-13 IL-5

Antigenic stimulus

Eosinophil differentiation and activation

Mast cell degranulation

IgE IL-4 IL-10

7

al., 1995 ; Borges et al., 1997 ; Szabo et al., 1997 ; Bonecchi et al., 1998 ; Sallusto et al., 1998

; Xu et al., 1998b). Recently, the cell surface molecules Tim-3 and the NK receptor complex

CD94/NKG2 have been reported to be specifically expressed on Th1 lymphocytes (Monney

et al., 2002 ; Meyers et al., 2002). Tim-3 seems to regulate macrophage activation by Th1

cells whereas CD94/NKG2 may provide costimulatory signals. Markers preferentially

expressed on Th2 cells include an IL-1-like molecule T1/ST2, the inducible T cell co-

stimulator (ICOS) and the chemokine receptors CCR3 (eotaxin receptor), CCR4 and CCR8

(Bonecchi et al., 1998 ; D’Ambrosio et al., 1998 ; Lohning et al., 1998 ; Sallusto et al., 1998 ;

Xu et al., 1998a ; Zingoni et al., 1998 ; Coyle et al., 1999 ; Hoshino et al., 1999 ; Townsend et

al., 2000). The preferential expression of these markers on effector Th1 and Th2 cells may be

the consequence of ligand-induced events or of the cytokine environment. Surface antigens

that will distinguish Th cells in the early stages of Th1 and Th2 differentiation have not yet

been found. Although most surface markers are only preferentially expressed on Th1 or Th2

cells, in combination they can be used for identification purposes.

Tabel 1 : Surface molecules preferentially expressed by Th1 or Th2 cells. Th subset Surface molecule

Th1 IFN-γ Rβ Interferon gamma receptor β chain

IL-12 Rβ Interleukin 12 receptor β chain

IL-18 R Interleukin 18 receptor

PG-1 P-selectin glycoprotein ligand-1

CXCR3,CCR 5 Chemokine receptors

Tim-3 T-cell immunoglobulin mucin 3

CD94/NKG2 NK receptor complex

Th2 T1/TS2 IL-1 receptor like molecule

ICOS Inducible T-cell co-stimulator

CCR3,CCR4, CCR8 Chemokine receptors

1.1.2. Heterogeneity of Th subsets

Following the discovery of mouse Th1 and Th2 clones, numerous attempts were made

to define the patterns of cytokine production in T cells stimulated in different ways and in

cells isolated from experimental animals and from humans during the course of normal and

pathological immune responses. Early difficulties in identifying Th1 and Th2 cells among

8

human T lymphocytes generated considerable scepticism about the generality of the Th1/Th2

concept (Kelso et al., 1995). However, two important sets of findings indicate that subsets of

Th1 and Th2 cells do exist, and that the degree of polarisation and heterogeneity of T

lymphocytes may reflect the nature of the antigenic and environmental stimuli to which the

cells have been exposed.

- First, many experimentally induced and naturally occurring immune responses show

patterns of cytokine production and effector reactions that are clearly indicative for

Th1 or Th2 dominance. This is particulary true for responses to persistent infections

with microbes such as Leishmania, Listeria, Mycobacteria and Helminths (Sher and

Coffman, 1992 ; Kaufmann, 1993 ; Kemp et al., 1993). Moreover, studies of

Leishmania major infection in mice demonstrated that resistance and susceptibility to

disease were attributable to specific Th1- or Th2-based effector functions (Reiner and

Locksley, 1995). These data support the notion that while heterogeneity may exist,

Th1 vs Th2 effector responses are important in determining the ultimate outcome upon

pathogen challenge.

- Second, the degree of Th1/Th2 polarisation increases with the chronicity of immune

responses. Thus, mixed cytokine patterns are most noticable early after lymphocyte

activation and polarised responses in chronic disease states (Romagnani, 1994). The

same phenomenon is observed in vitro, where repeated antigenic stimulation of T cells

expressing single transgenic receptors leads to increasingly polarised and irreversibly

committed Th1 and Th2 populations (Croft and Swain, 1995 ; Murphy et al., 1996).

Not surprisingly, therefore, identifying polarised Th1 and Th2 cells in spontaneous

disease states may depend greatly on the type of immune response being investigated

(acute vs chronic).

At the cellular level, using sensitive assays for cytokine production such as in situ

hybridisation and immunostaining, it has become apparent that most T cells cannot easily be

classified into Th1 and Th2 subsets based on the original criteria (Carding et al., 1989 ;

Openshaw et al., 1995). Individual cells may exhibit complex and quite heterogenous patterns

of cytokine production, with various combinations of IL-2, IL-4, IL-5 and IFN-γ, and often

produce cytokines, such as IL-10 and TGF-β, that serve important functions but are not

characteristic for either subset. Therefore, T cells with an unrestricted pattern of cytokine

production have been called Th0 cells (Firestein et al., 1989 ; Paliard et al., 1988) and terms

9

as Th1-like and Th2-like, or Th1-dominant and Th2-dominant, are more accurate designations

for the subsets.

As more and more cytokines have been described and characterised, the Th1/Th2

hypothesis has evolved to include other cytokines, even cytokines that are not necessarily

secreted by CD4+ T cells but that also promote the development of either Th1 or Th2 cells.

Thus, cytokines such as IL-12, although not secreted by T cells, have been assigned to the

Th1-associated group of cytokines, whereas cytokines such as IL-9, IL-10 and IL-13 have

been assigned to the Th2-associated group of cytokines. Moreover, additional populations of

CD4+ cells called Th3 cells and T-regulatory (Tr)-1 cells have been described (Roncarolo et

al., 2001 ; Groux, 2001). Th3 cells secrete TGF-β and some IL-10 and are thought to regulate

mucosal immunity in mammals whereas Tr-1 cells secrete high levels of IL-10 and also low

levels of TGF-β and have been implicated in general suppression of immunity (Table

2)(Spellberg and Edwards, 2001).

Table 2 : Subtypes of CD4+ Th cells and their characteristic cytokines and effects.

Subtype Defining cytokines Effects

Th0 IL-2 Proliferate and differentiate to effector cells

Th1 IL-2, IFN-γ, ΙL-12 Cell-mediated immunity, pro-inflammatory

Th2 IL-4, IL-5, IL-9, IL-10, IL-13 Humoral immunity, anti-inflammatory

Th3 TGF-β, some IL-10 Regulates mucosal immunity, oral tolerance and stimulates B cell secretion of IgA

Tr1 High levels IL-10, some TGF-β Suppression, regulation of immune response

1.1.3. CD8+ Tc1 and Tc2 cells

CD8+ T cells form a major defense against viral infections and intracellular parasites.

Their production of IFN-γ and their cytolytic activity are key elements in the immune

response to these pathogens. It has become apparent in recent years that CD8+ cytotoxic (Tc)

cells are also heterogeneous in their ability to secrete cytokines. Similarly to Th cells, Tc cells

can be subdivided on the basis of the cytokines they secrete into Tc1, which secrete IFN-γ and

TNF-α, and Tc2, which secrete IL4, IL5 and IL-10 (Croft et al., 1994 ; Erard et al., 1993 ; Sad

et al., 1995). There is variability in the degree to which Tc2 cells can be polarised away from

the default Tc1 phenotype of IFN-γ secretion and cytotoxic activity. In contrast, acquisition of

10

the capacity to secrete IL-4 and IL-5 appears to be induced easily and reproducibly by in vitro

culture in the presence of IL-4 (Croft et al., 1994 ; Erard et al., 1993 ; Sad et al., 1995).

1.2. FACT0RS RESPONSIBLE FOR TH1 OR TH2 POLARISATION

After differentiation and emigration from the thymus to the peripheral immune organs,

CD4+ T helper cells are termed naive T helper precursor (Thp) cells. These are functionally

immature and capable of secreting only IL-2. Studies using T cells stimulated with polyclonal

activators and T cells from mice expressing transgenic antigen receptors of known specificity

have established the key concept that Th1 and Th2 cells are not derived from distinct cell

lineages. Rather, they may develop from the same T-cell precursor (Seder and Paul, 1994).

Table 3 : Factors involved in the differentiation of CD4+ T cells into the Th1 or Th2 phenotype. Factors Th1 Th2 Cytokines IL-12, IL-18, IL-23, IL-27, IFN-γ, IFN-α, IL-4, IL-6, IL-10, IL-13 Dose of Antigen low dose high dose

Peptide density high low

Peptide affinity to MHC high low

Costimulatory molecules B7.1, LFA-1 B7.1, B7.2, OX4O

Dendritic cells CD8α+ CD8α-

Age younger older

Hormones Androgen steroids DHEA Relaxin

Glucocorticoids Estrogens and progestins

Catecholamines prostaglandines

HCG

Thp activation and differentiation in the periphery requires at least two separate

signals. The first signal is delivered by the T cell receptor (TCR)/CD3 after its interaction

with antigen/MHC on antigen presenting cells (APC). The second signal is produced by a

number of costimulatory or accessory molecules (B7.1, B7.2, OX40 and LFA-1) typified by

the CD28/B7, CD28/OX40 and LFA-1/ICAM receptor-ligand pairs. Whether an immune

response will be dominated by Th1 vs Th2 CD4+ cells is clearly influenced by the nature of

these two signals (Seder and Paul, 1994). However, neither of these two signals is an as potent

11

determinant of Th cell fate as the cytokine environment itself (reviewed by Constant and

Bottomly, 1997 ; Abbas et al., 1996 ; London et al., 1998)(Table 3)(Fig.3).

1.2.1. The cytokine environment

So far, the clearest examples of factors affecting the differentiation pathways of Th

cells appear to be cytokines released by APC and/or other cell types at the triad "Ag/APC/Th

cell" recognition level. Two critical cytokines that control Th1 and Th2 differentiation are IL-

12 and IL-4 respectively. These two cytokines enhance the generation of their own Th subset

and simultaneously inhibit, directly or indirectly the generation of the opposing subset (Scott,

1991 ; Maggi et al., 1992 ; Paroncchi et al., 1992 ; Hsieh et al., 1993 ; Macatonia et al. ,1993 ;

Manetti et al., 1993 ; Powrie and Coffman, 1993 ; Seder et al., 1993 ; Trinchieri, 1993 ; Wu et

al., 1993), events likely to occur at a precursor stage (Thp) because once established, Th1 and

Th2 cannot revert (Scott, 1991 ; Murphy et al., 1996). The requirements for these two

cytokines have been demonstrated by the phenotype of mice lacking these cytokines, cytokine

receptors or the effector molecules downstream the receptor as described below.

Cytokines important for Th1 differentiation

IL-12 is the most prominent differentiation factor of the Th1 developmental program

and can be produced by cells of the innate immunity such as macrophages or dendritic cells

(DC)( Manetti et al., 1993 ; Seder et al., 1993 ; Macatonia et al., 1995). That IL-12 is a critical

cytokine for Th1 responses, has clearly been demonstrated in TCR-transgenic, as well as in

IL-12 knock-out mice (Hsieh et al., 1993 ; Magram et al., 1996). IL-12 is a heterodimeric

cytokine composed of two disulfide-linked subunits designated p35 and p40 (Trinchieri and

Scott, 1999). Simultaneous production of these subunits results in the secretion of the active

p70 heterodimer. The p35 subunit is expressed ubiquitously and constitutively at low levels.

In contrast, p40 production is highly regulated and induced by products of gram-positive and

gram-negative bacteria, parasites, viruses and fungi in monocytes, neutrophils, macrophages

and DC. The IL-12 receptor (IL-12R) consists of two receptor subunits, β1 and β2 (Chua et

al., 1994 ; Chua et al., 1995 ; Presky et al., 1996 ; Esche et al., 2000) and is primarily

expressed on activated T cells and NK cells (Farrar et al., 2002 ; Dong and Flavell, 2001 ;

Glimcher, 2001 ; O’shea and Paul, 2002). Importantly, among CD4+ lymphocytes functional

receptors for IL-12 appear to be restricted to recently activated, uncommitted cells and to Th1

cells, and are lost on differentiated Th2 cells (Szabo et al., 1995, Rogge et al., 1997).

12

Moreover, maintenance of the expression of IL-12Rβ2 is required for normal Th1

differentiation and the expression of IL-12Rβ2 can be considered a marker for Th1

differentiation (Szabo et al., 1997 ; Rogge et al., 1997 ; Rogge et al., 1999 ; Sinigaglia et al.,

1999).

Recently, two other members of the IL-12 family have been identified, IL-23 and IL-

27. Like IL-12, these two cytokines are mainly produced by hematopoietic phagocytic cells

(monocytes and macrophages) and dendritic cells. Likewise, their production is further

upregulated by IFN-γ (Trinchieri, 2003). IL-23 is a heterodimer consisting of a p19 subunit,

which is distantly related to the p35 subunit of IL-12 and which is combined with the p40

subunit of IL-12 (Oppmann et al., 2000). Microbial products induce the production of p19 in

macrophages, dendritic cells, T cells and endothelial cells. However, the p19 subunit requires

coexpression of p40 for secretion. IL-23 has been reported to preferentially induce the

proliferation of memory T-cells as well as the production of IFN-γ by these memory T cells

(Oppmann et al., 2000). In addition to its effect on T cells, IL-23 might influence DC by

enhancing their stimulatory capacity (Belladonna et al., 2002). In contrast to IL-12, IL-23

does not use IL-12Rβ2 as part of its receptor. Instead it interacts with a receptor comprising

IL-12Rβ1 and a second subunit designated IL-23R, which has homology to IL-12Rβ2

(Parham et al., 2002). The role of IL-23 in host defense explains why deficiency of p40 results

in a more severe phenothype than IL12p35 deficiency, since the lack of p40 results in

deficiency of both IL-12 and IL-23 (Decken et al., 1998 ; Piccotti etal., 1998 ; Camoglio et al.,

2002).

The heterodimeric IL-27 was first described by Pflanz et al. (2002) and consists of an

IL-12p40-related subunit called Epstein-Barr virus induced gene 3 (EB13)(Devergne et al.,

1997), and the p28 subunit, homologous to the p35 subunit of IL-12 (Pflanz et al., 2002).

Like IL-12 and IL-23, IL-27 requires expression of both of its subunits for production of

active IL-27. Expression of both components of the heterodimer is upregulated in APC upon

activation with LPS. IL-27 binds to a receptor designated T cell receptor (TCCR) or WSX-1,

a receptor expressed on T cells that is involved in early Th1 cell development (Chen et al.,

2000, Yoshida et al., 2001). IL12Rβ1 and IL-12Rβ2 do not appear to be involved in IL-27

signalling. The precise mechanisms by which IL-27 and TCCR act in early Th1 cell

development are unclear, but IL-27 seems to interact synergistically with IL-12 at an early

timepoint in Th1 cell commitment (Robinson and O'Garra, 2002), possibly by inducing the

expression of a functional IL-12 receptor in naive CD4+ T cells, making these cells sensitive

to IL-12-mediated Th cell development (Holscher, 2004).

13

Thus, although all three members of the IL-12 family induce IFN-γ production in T-

cells and NK cells, their specific effects on naive or memory Th cells as well as the magnitude

of the final response may be different. IL-12 and IL-27 rapidly induce IFN-γ in naive Th cells,

promote Th1 development and are important for the mainenance of these Th1 responses

(Pflanz et al., 2002 ; Trinchieri, 2003). IL-27 however, seems to be dependent on IL-12 or IL-

18 in this respect (Takeda et al., 2003). IL-23 is less efficient compared to IL-12 in inducing

IFN-γ production in naive Th cells but , unlike IL-12, it is particularly efficient in supporting

IFN-γ production and proliferation in memory T cells (Oppmann et al., 2000).

IL-18, originally designated IFN-γ-inducing factor (IGIF), can be secreted by

activated macrophages and DC (Stoll et al., 1998 ; Okamura et al., 1995 ; Gu et al., 1997). IL-

18 has molecular similarities to IL-1β. The receptor for IL-18 is a heterodimeric complex

consisting of an IL-18 binding chain, designated IL-18Rα, which is a member of the IL1R

family and the L-18Rβ chain, which is related to the IL1R accessory protein (Parnet et al.,

1996) . In contrast to IL-12, IL-18 by itself does not induce IFN-γ expression and

development of Th1 cells. However, in the additional presence of IL-12, IL-18 strongly

induces IFN-γ (Robinson et al., 1997; Barbulescu et al., 1998). The synergy between IL-12

and IL-18 is at least partially explained by the finding that each induces the receptor of the

other (Yoshimoto et al., 1998 ; Smeltz et al, 2001 ; Afkarian et al., 2002).

Another key cytokine in regulating Th1 differentiation is IFN-γ . Beside being the

signature cytokine of Th1 cells, IFN-γ is important for the stabilisation of the Th1 phenotype

itself by inducing a positive feedback loop, promoting its own production (Szabo et al., 2002).

Although the control of human and mouse Th differentiation is quite similar, one

important difference has emerged. In human T cells, the cytokine IFN-α also can control

Th1 development and IFN-γ production (Parronchi et al., 1992 ; Brinkmann et al., 1993 ;

Rogge et al., 1997) which is in contrast to the inability of IFN-α to induce Th1 development

in the mouse (Wenner et al., 1996 ; Rogge et al., 1998). This is due to species differences at

the molecular level of signal transduction (Cho et al., 1996 ; Farrar et al., 2000). Both IL-12

and IFN-α activate the signal transducing factor which induces Th1 development in human T

cells, whereas only IL-12 exerts these effects in murine cells (Fig. 5). Importantly, as IFN-α

receptors may not be down-regulated in Th2 cells like IL-12 receptors are, human T cells may

retain the capacity to activate signal transducing factors for induction of IFN-γ even during

skewing of responses towards the Th2 phenotype (Moser and Murphy, 2000). This provides

14

an attractive explanation for the observation that human T cells show less exclusive

polarisation for IFN-γ or for IL-4 than mouse T cells.

Cytokines important for Th2 differentiation

IL-4 initiates the Th2 developmental program (Hsieh et al., 1992 ; Seder et al., 1992 ;

Swain et al., 1990). This has been demonstrated in mice lacking IL-4, the IL-4 receptor or the

downstream signalling molecule for the IL-4 receptor (Kopf et al., 1993 ; Kuhn et al., 1991 ;

Kaplan et al., 1996b ; Shimoda et al., 1996 ; Takeda et al., 1996). A functional receptor for

IL-4 is expressed already on naive Th cells in contrast to the IL-12R. Two types of IL-4

receptor exist, both with the IL-4Rα chain as subunit. One has the common γ chain (γc) as

second subunit and the other the so-called type II IL-4 receptor has the IL-13R as second

subunit. IL-4 binding to either of these receptors activates STAT6 (Nelms et al., 1999).

Furthermore, it is now apparent that activated lymphocytes produce small amounts of IL-4

prior to commitment and the amount of IL-4 that accumulates at the site of a T cell response

increases with increasing lymphocyte activation (Schmitz et al., 1994). Thus, as the Th2-

inducing effect of IL-4 dominates over other cytokines (if IL-4 levels reach the necessary

threshold) and in the absence of Th1 polarising factors, Th2 differentiation is initiated.

The biological function of another cytokine, IL-13, partially overlaps with IL-4

because, in some instances, IL-13 drives Th2 development and IgE synthesis in an IL-4

independent manner (Minty et al., 1993 ; Punnonen et al., 1993 ; Barner et al., 1998 ; Cohn et

al., 1998 ; Emson et al., 1998 ; McKenzie et al., 1998) being especially important in the

asthmatic response (Will-Karp et al., 1998).

IL-6, a cytokine produced by several cell types including APC such as macrophages,

DC and B cells is involved in acute phase responses, B cell maturation and macrophage

differentiation (Hirano, 1998). IL-6 has been reported to promote Th2 differentiation by

triggering the initial production of IL-4 and at the same time to inhibit IFN-γ production and

Th1 differentiation by interfering with the IL-12-driven IFN-γ signalling (Diehl et al., 2000 ;

Diehl and Rincon, 2002).

1.2.2. Antigen dose and nature

Another factor important in determining the balance between Th1 and Th2 subsets in

immune responses is the dose and nature of the antigen (reviewed by Constant and Bottomly,

1997 ; Abbas et al., 1996). With few exceptions, low doses of antigen tend to induce Th1

15

dominant responses while high doses of antigen induce Th2 responses (Hoskens et al., 1995 ;

Bretscher et al., 1992). It is suggested that at low doses of antigen, the principal antigen-

presenting cells are dendritic cells, or macrophages if the antigen is a particulate microbe.

Both dendritic cells and macrophages produce IL-12 and tilt the balance of the specific

immune response towards Th1 differentiation. Conversely, when the antigen concentration is

high, it may be presented by APC that do not secrete IL-12 such as B cells thus favouring Th2

development. It is also possible that high concentrations of antigen lead to repeated T cell

stimulation, thus increasing IL-4 production and Th2 development.

A role for peptide density and peptide binding affinity in influencing the profile of the

cytokine response has also been suggested. Although the usage of the same TCR by both Th1

and Th2 cells is clearly proved (Reiner et al., 1993), it appears that certain epitopes can

preferentially induce one of the two subsets of Th cells. More importantly, varying either the

antigenic peptide (changes as little as those concerning a single amino acid residue are

sufficient) or the MHC class II molecules can determine whether Th1-like or Th2-like

responses are obtained (Evavold et al., 1992). Likewise, by using a set of antigenic peptides

with various class II binding affinities but unchanged T-cell specificity, it has been shown that

stimulation with the highest affinity antigenic peptide resulted in IFN-γ production, whereas

those with relatively lower MHC class II binding induced only IL-4 secretion (Kumar et al.,

1995).

1.2.3. Costimulatory molecules

The role of an APC in the differentiation pathway of a naive Th cell is potentially

powerful because the APC provides the precursor Th cell with its first activation signals. A

feature of APC is their selective expression of costimulatory molecules, which work together

with antigen to enhance specific T-cell responses. The best-defined costimulators are two

structurally related proteins, B7.1 (CD80) and B7.2 (CD86) which can be expressed on

activated B cells, dendritic cells, Langerhans cells, activated monocytes and activated T cells,

and bind to CD28 on T cells (Lenschow et al., 1996). The activation of naive cells is

dependent on B7-mediated costimulation. High levels of costimulation may promote Th2

responses by increasing the initial production of IL-4 by T cells, resulting in an autocrine IL-4

loop. In contrast, Th1 development depends on IL-12 produced by APC and is less influenced

by the magnitude of the T cell response. The possibility that B7.1 and B7.2 can deliver

different costimulatory signals, B7.1 favoring both Th1 and Th2 responses and B7.2

16

preferentially favoring Th2 responses has also been suggested but not definitively proven

(Kuchroo et al., 1995 ; Brown et al., 1996 ; Nakajima et al., 1997).

Th2 cells are also preferentially expanded by CD28-dependent OX40 signalling

(Akiba et al., 2000 ; Lane, 2000 ; Murata et al., 2000). An opposing role for the LFA-

1/ICAM-1 interaction in regulating Th2 development has been demonstrated by salomon and

Bluestone (1998) because blocking this interaction results in the overproduction of Th2.

The issue of costimulation and effector T cell development is further complicated by

the possibility that different T cell subsets vary in their dependence on costimulation at

various stages of activation and differentiation. Th2 development may be enhanced by

increasing the initial costimulation by APC. In contrast, fully differentiated Th2 cells respond

to antigen without costimulation by B7, whereas Th1 cells continue to require B7 for their

activation (Mcknight et al., 1994). Thus, the timing and level of costimulation rather than

simply its presence or absence, may be critical determinants of the nature and magnitude of T

cell responses.

1.2.4. Dendritic cell subsets

The identification of phenotypically distinct subsets of dendritic cells has revealed

unique functions for these subsets in the development of Th cells (Maldonado-Lopez et al.,

1999 ; Pulendran et al., 1999 ; Rissoan et al., 1999 ; Smith and Fazekas de St. Groth, 1999).

In mice, DC can be separated into CD8α+ and CD8α- subpopulations derived from

lymphoid and myeloid lineages, respectively (Wu and Shortman, 1996). The CD8α+ DC

have the ability to produce large amounts of IL-12 thereby inducing Th1 responses. By

contrast, the CD8α- DC do not have the ability to produce large amounts of IL-12 and

preferentially induce Th2 responses. The contribution of these DC to Th2 development

however remains unclear suggesting that the Th2 pathway may occur as a default in the

absence of IL-12 (Moser and Murphy, 2000). However, a proposal for active induction of Th2

development by DC has been made. This study reports the differential responsiveness of

murine DC lines when they ingested candida albicans as a unicellular yeast which resulted in

the production of IL-12 and Th1 priming whereas IL-4 was produced and not IL-12 when

they ingested the hyphal form of the fungus. Both the Th1- or Th2-skewing effect of the DC

depends on the capacity of the DC to produce IL-12 or IL-4 respectively, as has been

demonstrated by the use of DC deficient for IL-12 or IL-4 (d'Ostiani et al., 2000). This studies

17

also supports the hypothesis that the Th cell response depends on the nature of the pathogen

and not on the type of DC.

In humans, DC are also phenotypically and functionally heterogeneous (Kalinski et

al., 1999 ; Rissoan et al.,1999 ; Liu et al., 2001). The CD11c+ DC are termed DC1 or myeloid

DC and express high levels of the granulocyt macrophage-colony stimulating factor (GM-

CSF) receptor but low levels of the IL-3 receptor (CD123). They are associated with elevated

IL-12 production and Th1 priming. In contrast, CD11c- DC are called DC2 or

plasmacytoid/lymphoid DC. They express high levels of CD123 but little GM-CSF receptor.

DC2 cells do not produce large amounts of IL-12 and may drive Th2 polarisation.

Additionally, the plasmacytoid DC have been shown to constitute the major source of type I

IFN (IFN-α/β) upon virus challenge and may therefore in humans also promote Th1

development as efficiently as IL-12 secreting DC due to the differences in IFN-α signalling

between humans and mice (cfr 1.2.1.)(Cella et al., 1999 ; Siegal et al., 1999).

1.2.5. Hormones

Glucocorticoids are powerful stimulators of type 2 outcomes and powerful inhibitors

of type 1 outcomes, directly inducing IL-4 and IL-10 production from lymphocytes and APC

(Daynes et al., 1990 ; Ramirez, 1998) while suppressing the secretion and effects of IFN-γ and

IL-12 (Larsson and Linden, 1998 ; Vieira et al., 1998 ; Franchimont et al., 2000).

Furthermore, they suppress secretion of IL-2 (Boumpas et al., 1991 ; Sierra-Honigmann and

Murphy, 1992), which inhibits activated Th1 cells from proliferating while allowing Th2 cells

to expand.

Like glucocorticoids, estrogens and progestins have been shown to suppress type 1

immunity in favor of type 2 immunity. Both inhibit IL-12 and IFN-γ secretion from APC and

T cells, while stimulating IL-4, IL-10 and IL-13 secretion (Guilbert, 1996 ; Szejeres-Bartho

and Wegmann, 1996 ; Kanda and Tamaki, 1999). Enhanced tolerance during pregnancy is a

Th2-dominant effect. Placental secretion of estrogens, progestins, IL-4 and IL-10 (Chaouat et

al., 1995 ; Bennett et al., 1997), are largely responsible for the natural suppression of cell

mediated immunity that accompanies pregnancy and allows for the fetus to be tolerated

during gestation.

Conversely, the testosteron derivative dehydroepiandrosterone (DHEA) has been

shown to potentiate IL-2 secretion as well as the development of Th1 clones (Daynes et al.,

18

1990 ; Suzuki et al., 1991 ; Kim et al., 1995). Therefore, male hormones favor cell-mediated

immune responses, whereas female hormones favor humoral immunity.

Perhaps the most important hormones regulating type 1 and type 2 outcomes are

catecholamines. They inhibit the production of type 1 cytokines (Sanders et al., 1997) and

stimulate the transcription and secretion of type 2 cytokines (Coqueret et al., 1994 ; Suberville

et al., 1996 ; Elenkov et al., 1996, Ramer-Quinn et al., 1997).

Finally, other hormones have been shown to modulate type 1 and type 2 outcomes.

Among these are human chorionic gonadotropin (HCG), prostaglandins and α-

melanocyte-stimulating hormone, each of which has been shown to suppress type 1

cytokine responses while stimulating type 2 responses (Shimizu et al., 1994 ; Katamura et al.,

1995 ; Fabris et al., 1977).

1.2.6. Age-related shift

Ageing is accompanied by a number of changes in immune functions such as

decreased lymphoproliferative responses to both mitogens and antigens, reduced delayed type

hypersensitivity reactions and decreased antibody responses to vaccination and infection

(Miller, 1996). Although the most consistent and dramatic age-related changes have been

demonstrated in T cells, the exact mechanism(s) responsible for age-associated alterations in

immune functions have not been established. Murine models have demonstrated that there is

an age-associated dysregulation in cytokine production, as evidenced by consistently

decreased production of IL-2 (Shearer, 1997) and a generally increased production of IL-4

(Hobbes et al., 1993 ; Albright et al., 1995). These data, coupled with the increased incidence

of cancer and the recurrence of latent virus infections in aged humans have led to the

hypothesis that the process of ageing per se induces a switch from a predominantly Th1

cytokine profile, supporting a dominant cell-mediated immune response, to a predominantly

Th2 cytokine profile, promoting a dominant humoral response (Shearer, 1997 ; Hobbs et al.,

1994). However, whether such an age-related shift to a Th2 response occurs in humans is not

proven yet (Gardner and Murasko, 2002).

19

Figure 3 : Complex of factors that act in concert to determine the Th1 /Th2 polarisation.

1.3. THE DECISION TO POLARISE

After having discussed the factors responsible for polarisation to Th1 or Th2

responses, the question arises of how the immune system determines which outcome is

superior for a given danger signal or what factors thell the immune system to preferentially

produce IL-12 or IL-4, the key factors responsible for inducing polarisation, at the start of a

given immune response?

It is now clear that innate immune cells, not T cells, make the “decision” to stimulate a

type 1 or type 2 response. Phagocytes instruct T cells to adopt a Th1 or Th2 phenotype by

secreting polarising cytokines, thereby altering the local microenvironment around the newly

activated lymphocyte. The information used by innate immune cells to decide which

cytokines to secrete include (1) the presence of certain “danger signals” (Matzinger, 1998) in

the local microenvironment and (2) systemic factors affecting the host at the moment the

danger signals are revealed.

Th1 Th2 Polarising cytokines from T-lymphocytes

Polarising cytokines from non-specific innate responses

(IL-12, IL-18, IL-23, IL-27, IFN-γ, IFN-α)

IFN-γ IL-4

CD8α+ CD8α-

Environmental Genetic

Ag dose Ag nature Adjuvants

Age (?)

Differential TCR and co-stimulatory signals

Cell division regulated gene expression

Transcription factor antagonism

IL-6, IL-13

Hormones

20

(1) Microbes contain within them information that directly induces secretion of IL-12

by phagocytic cells. Gram-negative endotoxin or LPS and gram-positive cell wall

lipotechoic acid bind to nonpolymorphic receptors on innate immune cells and directly

induce secretion of IL-12 and other pro-inflammatory cytokines such as IFN-α and

IFN-γ (Skeen et al, 1996 ; Cleveland et al., 1996). Furthermore, bacterial DNA is rich

in immunostimulatory sequences (Pisetsky, 1999). Well described immunostimulatory

sequences include poly-G sequences and CpG motifs, which are hexamers of purine-

purine-CG-pyrimidine-pyrimidine (Yamamoto et al., 1992 ; Krieg et al., 1995).

Eukaryotic DNA contains very few CpG motifs, and even when they occur in

eukaryotic genomes they tend to be methylated. Unmethylated prokaryotic CpG DNA

is capable of directly inducing IFN-α, IFN-γ and IL-12 secretion from B-cells, NK

cells and monocyte/macrophages (Chace et al., 1997 ; Krieg et al., 1998 ; Sparwasser

et al., 1998 ; Cowdery et al., 1999). Heat shock proteins, which are synthesised in

response to cellular stresses in both prokaryotic and eukaryotic cells, are capable of

directly inducing IL-12 secretion from innate immune cells (Skeen et al., 1996). Even

host heat shock proteins induce IL-12, which indicates that the innate immune system

is genetically programmed to scan local microenvironments for any sign of danger,

even if it is an indirect sign of host tissue destruction rather than direct evidence of a

microbial invader (Chen et al., 1999).

(2) Systemic host states at the time of antigen stimulation also modulate type1/type2

outcomes. Initial production of IFN-α and IFN-γ by innate immune cells and NK cells

can upregulate the local production of IL-12, thereby inducing a type 1 response

(Skeen et al., 1996 ; Flesch et al., 1995 ; Libraty et al, 1997 ; Emoto et al., 1999).

Conversely, pre-existing IL-4, IL-10 and IL-13 inhibit secretion of IL-12, thereby

blocking Th1 polarisation (Skeen et al., 1996). Elevated catecholamine, glucocorticoid

and estrogen/progesterone levels all directly suppress the development of a local

cytokine milieu rich in IL-12, and instead induce IL-4, IL-10 and IL-13. Therefore,

hosts who are undergoing physiological stress, are pregnant, or are taking

glucocorticoids or cyclosporine are innately prone to developing type 2 responses,even

to antigens that would normally elicit a type 1 response (Spellberg and Edwards,

2001).

1.4. THE MOLECULAR BASE FOR TH1/TH2 POLARISATION

21

Signals through the TCR as well as through cytokine receptors elicit a complex series

of molecular interactions that culminate in the transcription of cytokine genes. Faithful

transcription of genes is orchestrated by the cooperative interactions of multiple ubiquitous

and cell-type specific transcription factors, bound to multiple regulatory elements in the

promoters of genes. These protein-protein and protein-DNA contacts, together with their

interactions with the basal transcriptional machinery, results in the regulation of genes and the

development of polarised Th-subsets.

It is now clear that IFN-γ and IL-4 exert their effects on Th1 and Th2 differentiation

by controlling the expression of the transcription factors T-bet (Szabo et al., 2000) and

GATA-3 (Zheng and Flavell, 1997). T-bet and GATA-3 are necessary for the development of

CD4+ Th1 and Th2 effector phenotypes, respectively (Szabo et al., 2000; Pai et al., 2004).

They interact with each other and the cytokines that induce them through feedback loops (Ho

and Glimcher, 2002 ; Yates et al., 2004).

1.4.1. Transcriptional regulation of Th2 cell development

IL-4 binding to its receptor on Th precursor cells activates the signalling factor “signal

transducer of activators of transcription” (STAT)-6 which then translocates to the nucleus and

rapidly induces the expression of GATA-3 (Kaplan et al., 1996 ; Shimoda et al., 1996 ;

Takeda et al., 1996). GATA-3 has been shown to promote Th2 cell development strongly

when expressed by a transgene or by a retrovirus (Ouyang et al., 1998 ; Zheng and Flavell,

1997). As Th2 cells can also develop in the absence of STAT6, alternative signalling

pathways through CD28 (Rodrigeuz-Palmero et al., 1999) may induce GATA-3. Other T-cell

costimulatory molecules implicated in promoting the Th2 response include CD40L, OX40

and immune costimulatory molecule ICOS. Unlike CD28, which is constitutively expressed,

all of these molecules are induced after the activation of Th cells and thus probably are most

important in sustaining or regulating Th effector-cell functions (Jankovic et al., 2001,

Ohshima et al., 1998). Importantly, GATA-3 transcription itself seems to be responsive to

GATA-3 protein, providing an intrinsic signal that maintains Th2 commitment at the cellular

level (Ouyang et al., 2000). Furthermore, the expression of GATA-3 might be under positive

regulation of IL-6 and repression through engagement of LFA-1 (Diehl and Rincon, 2002 ;

Murphy and Reiner, 2002 ; Luksch et al., 1999).

22

Figure 4 : Model of signalling pathways leading to Th2 differentiation. For details, see text.

After translocation to the nucleus, the role of GATA-3 lays in facilitating the IL-4

locus accessibility by promoting epigenetic modifications (Lee et al., 2000 ; Takemoto et al.,

2000). Following remodelling of the Th2 cytokine genes, acute transcription of the IL-4 gene

is mediated by signals downstream of the TCR and therefore is independent of IL-4

signalling. The mediators of this effect include lineage-specific (such as c-Maf) and non-

specific (such as NFAT and NF-κβ) transcription factors (Ho et al., 1996 ; Kim et al., 1999 ;

Ho and Glimcher, 2002)(Fig. 4). This pathway forms a positive feedback loop for IL-4

induction and Th2 differentiation. At the same time, GATA-3 induction inhibits Th1

differentiation by increasing IL-4 production as well as by downregulation of STAT4 and not

through effects on IL-12Rβ2 chain or T-bet as described earlier by Ho and Glimcher

(2002)(Usui et al., 2003).

‘Open’ chromatin

+

Stat6

GATA-3

‘chromatin remodeling’

‘Closed’ chromatin

IL-4

IL-4 CD28 TCR-CD3-CD4 complex

c-MAF NFAT NF-κβ

acute transcription activity

Th2

IL-6 ICOS

LFA-1

23

1.4.2. Transcriptional regulation of Th1 cell development

Szabo and colleagues (2000) found a novel transcription factor T-bet, a member of the

T-box family of transcription factors, that is restricted to develloping and committed Th1

cells. In addition to its role in inducing the expression of IFN-γ, T-bet seems to be involved in

chromatin remodelling of the gene that encodes IFN-γ, induction of expression of the IL-12

receptor β2-subunit (IL-12Rβ2) and in stabilising its own expression, either through an

intrinsic autocatalytic loop or through the autocrine effect of IFN-γ signalling (Mullen et al.,

2001 ; Afkarian et al., 2002). The initial T-bet study suggested that IL-12 induces T-bet

through STAT4 activation, providing the link between IL-12 and Th1 development. However,

more recent work indicates that the expression of T-bet seems to be induced readily in naive

cells through IFN-γ signalling, mediated by STAT1. T-bet thus appears to act before and

independently of IL-12-induced STAT4 activation (Afkarian et al., 2002 ; Lighvani et al.,

2001 ; O’Shea and Paul, 2002 ; Robinson and O’Garra, 2002)(Fig. 5).

Figure 5 : Model of signaling pathways leading to Th1 differentiation. For details, see text. * IFN-α signalling through Stat4 occurs only in humans.

‘chromatin remodeling’

NFAT Stat1

T-bet

‘Closed’ chromatin ‘Open’ chromatin

IFN-γ

IFN-γ TCR-CD3-CD4

complex

acute transcription activity

IL-12 IL-18

NF-κβ p38 GADD45

Stat4

Th1

+

IL-27 IL-23

? ?

IFN-α∗

24

IFN-γ and T-bet alone are not sufficient to permit full Th1 development but the

committed Th1 cell, which expresses receptors for IL-12 and IL-18 has at least two other

pathways available to induce the acute transcription of IFN-γ namely the TCR signalling

pathway mediated through NFAT or a cytokine signalling pathway that can include combined

IL-12 and IL-18 signalling (Robinson et al., 1997 ; Yang et al., 1999). Proposed factors that

mediate cytokine-induced IFN-γ production are STAT4, NF-κβ, p38 mitogen activated

protein kinase (p38 MAPK) and GADD45 (Robinson et al., 1997 ; Yang et al., 2001 ; Lu et

al., 2001 ; Rincon et al., 1998)(Fig. 5). Issues that are not completely resolved yet include the

mechanisms of action of IL-27 through the TCCR receptor in early Th1 cell priming and of

IL-23 in the proliferation of and IFN-γ production in memory T cells.

Either directly or indirectly, T-bet may also inhibit GATA-3 expression and IL-4

production (Szabo et al., 2000). It therefore provides positive feedback for Th1 development

and negative feedback for Th2 development.

1.4.3. Epigenetic effects involved in Th1/Th2 development

In the past few years, several lines of evidence have indicated that, beside transcription

factors, chromatin structure also has an integral role in Th cell differentiation. The induction

of competence for effector-cytokine gene expression seems to involve the derepression of

silent chromatin contexts as described above (Bird et al., 1998 ; Hutchins et al., 2002 ;

Agarwal and Rao, 1998 ; Agarwal et al., 2000). It is generally accepted that there are various

chromatin modifications, lacking in naive cells, that accompany the acquisition of effector-

cytokine gene activity. Transcriptional inactive gene loci are frequently characterised by

condensed chromatin, in which DNA is tightly packed around nucleosomes with deacetylated

histones. CpG nucleotides of transcriptional control regions are often methylated. In this state,

transcription is inhibited through to reduced accessibility of the DNA for transcription factors

due to methylation-dependent recruitment of transcriptional repressors. Transcriptional

“open” chromatin correlates with acetylated histones and DNA hypomethylation (Reviewed

by Bird and Wolffe, 1999 ; Hsieh, 2000 ; Robertson and Wolffe, 2000).

For example, the IL-4 locus acquires DNAse-I hypersensitivity, indicating binding of

specific factors to the DNA, in Th2 cells but not in naive Th or Th1 cells (Agarwal and Rao,

1998). Similarly, the gene encoding IFN-γ acquires nuclease hypersensitivity in some of its

introns in Th1 cells but not Th2 cells (Agarwal and Rao, 1998). Moreover, in differentiated

25

Th1 and Th2 cells, the “forbidden” cytokine loci seem to become repositioned to centromers

and they can also show evidence of de novo CpG methylation (Grogan et al., 2001 ; Lee et al.,

2002).

1.4.4. Cytokine memory of Th cells

Memory is one of the key features of the adaptive immune system. Specific B and T

lymphocytes are primed for a particular antigen and upon challenge with it will react faster

than naive lymphocytes. They also memorise the expression of key effector molecules, in

particular cytokines, which determine the type and scale of the immune reaction. While in

primary activations differential expression of cytokine genes depend on antigen-receptor

signalling and differentiation signals, in later activations the expression is triggered by

antigen-receptor signalling and is dependent on the cytokine memory. After primary

activation of naive T cells, cytokines are secreted transiently over days with different kinetics

for different cytokines (Assenmacher et al., 1994 ; 1998 ; Cardell et al., 1993 ; Lederer et al.,

1996). After reactivation, T cells secrete cytokines within hours and with similar kinetics for

different cytokines (Cardell and Sander, 1990 ; Openshaw et al., 1995). Preactivated T cells

can memorise the expression of those effector cytokines that they had been instructed to

express during primary activation, a phenomenon termed “cytokine memory”.

Thus, in the induction and maintenance of cytokine memory in individual T cells,

information on the initial differentiating cytokine signals can be stored at several levels,

including the selective and stable expresssion of transcription factors, cytokine receptors,

epigenetic modifications of the cytokine genes to be memorised and epigenetic inactivation of

those not to be memorised. Some of these molecular events obviously make te cells refractory

to instructive signals of adverse T cell developmental programs (reviewed by Löhning et al.,

2002).

1.4.5. Relationship between pathogens, the innate immune system and Th cell development

A general overview of the Th cell development bridging the innate and adaptive

immunity was proposed by Murphy and Reiner (2002) and is depicted in figure 6.

26

Figure 6 : Relationships between pathogens, the innate immune system and Th-development.

For details, see text.

Type 1 pathogen TLRs

MØ/DC

Antigen

IL-12 IL-12 IL-18 IFN-γ

Th1 Th1 Naive CD4

TCR

IL-12R β1

IL-12R

β1 β2 IL-12R

IL-18R

TCR

antigen

IL-4

STAT1

T-bet

T-bet autoactivation

°°°°

NK °°° °° °°°

°°°°

TCCR IL-27

IFN-γ IL-23

STAT4

Type 2 pathogen

°°°

°°

°

°° °°

NKT ° °°°

? TLRs

MØ/DC

?

Naive CD4

β1 β1 β1 TCR TCR STAT6

IL-4

GATA3 autoactivation Alternative Th2 triggers ICOS/CD28, IL-6

Th2 Th2

Allergic response

antigen

IL-12R

? IL-4

Adaptive immunity

antigen

Innate immunity

Adaptive immunity

Innate immunity

27

For Th1 cell development, the important contribution of the innate immune system, which

was recognised initially in 1993, should be emphasized (Hsieh et al., 1993). The interaction of

microbial components with PRRs on DCs, such as TLR, results in the nuclear translocation of

the transcriptional factor NF-κβ, followed by the synthesis of Th1-promoting cytokines,

including IL-12, IL-18, IL-23 and IL-27 (Brightbill et al., 1999). NK cells can respond to the

IL-12 environment and proceed to release IFN-γ which reinforces the APCs production of IL-

12 and also helps driving the naive T cells commitment process. IFN-γ augments the

expression of T-bet that acts in primary Th1 cell commitment by remodelling at the IFN-γ

locus and by driving expression of the IL-12R. Next, IL-12 derived perhaps from pathogen-

activated macrophages or DCs can amplify Th1 responses by augment the production of IFN-

γ by T cells and by promoting the expression of the IL-18R. The latter opens up an alternative

pathway for IFN-γ production, which might operate for as long as the inflammatory cytokines

are produced.

For Th2 cell development, it is still uncertain whether any active innate signals drive

this process. Potentially, it might occur in response to an extrinsic source of IL-4 or as a

default pathway in the absence of inhibition by innate immune signals. In naive T cells, basal

expression of GATA3 is low, but might be sufficient for low-level production of IL-4 by

some naive T cells, leading to a cascade of Th2 cell development if no inhibition is

encountered. Furthermore, the expression of GATA3 might be under positive regulation by

CD28, IL-6 and ICOS signalling,and repression through engagement of LFA-1. So, the

priming DC might influence Th2 cell commitment through expression of CD80/CD86, PD1

and ICAM.

1.5. REGULATION OF T CELL RESPONSES

In addition of playing different roles in protection, polarised Th1-like and Th2-like

responses are in some cases thought to be responsible for several immunopathological

disorders. Th1-dominated responses are thought to be involved in the pathogenesis of organ-

specific autoimmune disorders (such as type 1 diabetes mellitus, multiple sclerosis and

rheumatoid arthritis), acute allograft rejection and unexplained recurrent abortions. Allergen

reactive Th2 cells are thought to be primarily involved in the triggering of type 2

hypersensitivity disorders, including allergy, asthma, eczema, hay fever and urticartia. In

addition, Th2-cell-cytokine predominance has been hypothesized in chronic graft-versus-host

28

disease, progressive systemic sclerosis, systemic lupus erythematosus and the progression to

AIDS in HIV infection (reviewed by Lucey et al., 1996 ; Romagnani, 2000 ; Kidd, 2003). Nevertheless, inflammatory diseases associated with the immune response to infection

and auto-immune diseases associated with uncontrolled reactivity to self-antigens, are

relatively infrequent, suggesting that specific mechanisms exist to limit collateral damage. In

the Th1/Th2 model, this is explained in part through reciprocal regulation by cytokines

secreted by the other subtype. While IL-4 antagonises much of the pro-inflammatory effects

of IFN-γ and inhibits the proliferation of Th1 cells, IFN-γ, secreted by Th1 cells, blocks the

proliferation of Th2 cells. However, further subtypes of CD4+ T cells with

immunosuppressive function and cytokine profiles distinct from either Th1 or Th2 cells,

termed regulatory T cells (Tregs) help to control infection-induced immunopathology and are

considered to have a role in the maintenance of self-tolerance (McGuirk et al., 2002 ; Walsh

et al., 2004).

1.5.1. The biology of regulatory T cells

It is now firmy established that there are two subsets of Tregs : naturally (or

constitutively) occurring regulatory T cells, and adaptive (or inducible) regulatory T cells

which probably have complementary and overlapping functions in the control of immune

responses (Reviewed by Bluestone and Abbas, 2003 ; Mills, 2004 ; de Jong et al., 2005 ;

O’Garra et al., 2004 ; Jiang and Chess, 2004)(Fig.7). However, the lineage relationship, if

any, between these subtypes remains to be defined.

Natural occurring regulatory T cells

The natural occurring regulatory T cells are CD4+CD25+ cells that obtain their

regulatory function in the thymus and are primarily involved in central and peripheral

tolerance to self-antigens (Bach, 2003 ; Cozzo et al., 2003). They constitute 5-10% of the

peripheral T cells in normal mice and humans. CD25 is not a definitive marker of natural

regulatory T cells since CD25 is an activation marker for T cells and is therefore also

expressed by effector Th1 and Th2 cells. Additional markers expressed by these cells include

CD45RB, CTLA-4 and glucocorticoid-induced TNF receptor family-related receptor (GITR),

whose relative expression levels can be used to define and isolate CD4+CD25+ Tregs, have

been identified (Wood and Sakaguchi, 2003). However, as with CD25, none of these

molecules alone represents a definitive marker for naturally occuring Tregs, as they are also

29

expressed by nonregulatory T cells, after activation. The most promising marker of natural

regulatory T cells to date is the transcriptional repressor FOXP3 (forkhead box P3), which is

thought to program the development and function of this subset (Hori et al., 2003 ; Fontenot

et al., 2003).

Figure 7 : Natural and inducible regulatory T cells. Natural regulatory T cells express the cell-surface marker CD25 and the transcriptional repressor FOXP3. These cells mature and migrate from the thymus. Other populations of antigen-specific regulatory T cells can be induced from naive CD4+CD25- and CD8+CD25- T cells in the periphery under the influence of semi-mature dendritic cells, IL-10, TGF-β and IFN-α. The inducible populations of regulatory T cells include distinct subtypes of CD4+ T cells : T regulatory 1 (Tr1) cells and Th3 cells.

Thymus

CD4+CD25+FOXP3+

Treg cell

Nat

ural

regu

lato

ry

T c

ell

Indu

cibl

e re

gula

tory

T c

ells

Naive CD8+ CD25- T cell

Naive CD4+ CD25- T cell

CD8+ Regulatory T cell

Th3 cell

Tr1 cell

Antigen (foreign or self)

Antigen (foreign or self)

30

Adaptive regulatory T cells

In contrast to natural regulatory T cells, adaptive regulatory T cells originate, like Th1

and Th2 cells, from uncommitted peripheral naive or central memory Th cells upon activation

by APC in a certain immunological context. At present, induced Treg subsets are largely

identified on the basis of their secretion of immunosuppressive cytokines. As with

CD4+CD25+ Tregs, there is no specific cell-surface marker to distinguish them from other T

cell subsets. The adaptive Tregs include distinct subtypes of CD4+ T cells such as T

regulatory 1 (Tr1) cells, which secrete high levels of IL-10, no IL-4 and no or low levels of

IFN-γ and T helper 3 (Th3) cells,which secrete high levels of TGF-β (Levings et al., 2001;

Groux et al., 1997 ; Doetze et al, 2000 ; Cavani et al., 2000 ; Chen et al., 1994 ; Fukaura et al.,

1996 ; Roncarolo et al., 2001). Th3 cells were first identified because of their role, through the

secretion of TGF-β, in the development of immune tolerance following ingestion of antigens

(Chen et al, 1994). Tr1 cells were first characterised on the basis of their role in preventing

autoimmune colitis (Groux et al., 1997).

Because Th2 cells secrete the immunosuppressive and anti-inflammatory cytokines

IL-10 and IL-4, these cells might also have regulatory functions, as well as effector functions,

but they are distinguished from Th3 and Tr1 cells by the production of large amounts of IL-4

and smaller amounts of IL-10, as well as the lack of TGF-β production.

In addition to these well-defined populations of CD4+ regulatory T cells, there is also

evidence for an immunosupressive function of CD8+ regulatory T cells that secrete either IL-

10 or TGF-β (Garba et al., 2002 ; Haynes et al., 2000). Furthermore, IL-10 and TGF-β

producing regulatory γδ T cells were identified, which can suppress the antitumour activity of

CTLs and NK cells (Seo et al., 1999 ; hanninen and harrison, 2000). In addition, natural killer

T (NKT) cells ,which co-express NK-cell and T-cell markers, can secrete regulatory

cytokines, including IL-10 (Sonoda et al., 2001). Therefore, NKT and γδ Τ cells can also be

categorised as regulatory T cells.

1.5.2. Mechanisms of action

The mechanism of the suppressive function of natural and inducible regulatory T cells

is still debated, but in different model systems, suppressive activity has been shown to be

mediated either throug secretion of immunosuppressive cytokines or through cell cell-contact

31

(reviewed by Mills, 2004). As shown in figure 8, the mechanism of suppression used by the

natural CD4+CD25+ Tregs seems to be multifactorial and includes cell-cell contact. They

express the inhibitory costimulatory molecule CTLA-4, which interacts with CD80 and/or

CD86 on the surface of APC thereby delivering a negative signal for T-cell activation

(Takahashi et al., 2000 ; Read et al., 2000 ; Shevach et al., 2000). However, there is also

conflicting evidence concerning roles for secreted IL-10 and secreted or cell-surface TGF-β

(Read et al., 2000 ; Belkaid et al., 2002). NKT cells and inducible populations of regulatory T

cells (Tr1 cells, Th3 cells and CD8+ Tregs) secrete IL-10 and/or TGF-β. These

immunosuppressive cytokines inhibit the proliferation and cytokine production by effector T

cells, including Th1 cells, Th2 cells and CD8+ CTL, either directly or through their inhibitory

influence on the maturation and activation of DCs or other APCs (Moore et al., 2001 ; Taga et

al., 1993 ; Gorelik and Favell, 2002 ; Gorelik et al., 2002.

Figure 8 : Regulation of T cell responses by Tregs. For details, see text.

Tr1

CD8+

Th3

Inducible Tregs

natural Tregs

Cell-cell contact CTLA-4 CD25- ↓ Proliferation

IL-10 and/or TGF-β

CTL

Th2

Th1

APC

↓ MHC and co-stimulatory molecules ↓APC function ↓ inflammatory cytokines

↓ CTL activity ↓ IFN-γ

↓ Proliferation ↓ IL-4

↓ Proliferation ↓ IFN-γ

?

32

IL-10 potently inhibits the production of pro-inflammatory cytokines such as IL-1β,

IL-6, IL-12, TNF-α and chemokines by APC and downregulates the expression of MHC

class II and costimulatory molecules, including CD80 and CD86, thereby influencing T cell

differentiation, proliferation and migration (Moore et al., 2001). In addition, IL-10 directly

regulates T cells by inhibiting their ability to produce IL-2 and IFN-γ and to proliferate (Taga

et al., 1993).

TGF-β has potent anti-proliferative effects on CD4+ T cells due to its ability to inhibit

IL-2 production and to upregulate cell cycle inhibitors (Gorelik and Favell, 2002). Moreover,

TGF-β inhibits Th1 cell responses through its effects on expression of the transcription factor

T-bet and the IL-12R (Gorelik et al., 2002). TGF-β also inhibits Th2 cell responses through

its effect on GATA3 expression (Heath et al., 2000). At the level of APCs, TGF–β can inhibit

the activation of macrophages and their ability to produce pro-inflammatory cytokines. In

addition, it prevents the maturation of DC and, like IL-10, inhibits upregulation of MHC class

II (Gorelik and Favell, 2002). The production and action of these two cytokines are

interrelated and likely involve a positive feedback loop in which IL-10 enhances expression of

TGF-β and vice versa (Fuss et al., 2002 ; Cottrez and Groux, 2001 ; Kitani et al., 2000 ;

Levings et al., 2002).

1.5.3. Pathogen immune evasion

Although the primary function of regulatory T cells in infection is to prevent

inflammatory pathology and the development of auto-immune diseases mediated by Th1

cells, it is also possible that pathogens that cause persistent or chronic infections have

exploited these cells to counteract protective immune responses and thereby prolong their

survival in the host. One strategy is to induce a state of immunosuppression, either through

direct interference with host immune effectormechanisms or through the production of

immunosuppressive cytokines. Several viruses, bacteria and parasites, many of which cause

chronic or persistent infection in humans and some of which are associated with

immunosuppression, are capable of inhibiting IL-12 and/or stimulating IL-10 and TGF-β

production by macrophages or DC (McGuirk et al., 2002 ; Taoufik et al., 1997 ; Marie et al.,

2001 ; Van der Kleij et al., 2002 ; Barnes et al, 1992 ; Ryan et al., 2001 ; Alcami, 2003). For

certain pathogens, immunomodulatory molecules have been identified, including HIV gp120,

measles virus nucleoprotein (NP), bordetella pertussis filamentous haemaglutinin (FHA),

33

Escherichia coli heat labile enterotoxin (LT), cholera toxin (CT), Leishmania phosphoglycans

and Schistosoma mansoi egg glycolipid, which bind to cell-surface receptors and either

activate or inhibit signalling for cellular IL-10 or IL-12, respectively. Alternatively, certain

viruses have evolved immunosuppressive strategies by encoding homologs of anti-

inflammatory cytokines, including IL-10 (Alcami, 2003). Thus, pathogen-stimulated IL-10 or

TGF-β production by innate cells might suppress the immune response early in certain

infections and this immunosuppression is sustained following the induction of Tr1 or Th3

cells.

34

CHAPTER 2

AN UPDATE ON PORCINE CYTOKINES

35

CHAPTER 2 : AN UPDATE ON PORCINE CYTOKINES

Since the 1980s, there has been a massive explosion of literature on mouse and human

cytokines. Only the last 10 years however, rapid progress has been made in the cloning and

characterisation of cytokines from livestock and companion animals. Since then, CDNA

clones, recombinant proteins and monoclonal antibody probes for a wide variety of cytokines

from veterinary species became available. In regard to our research on porcine cytokines we

summarised in table 4 the currently known and sequenced porcine cytokines with their main

functions.

Table 4 : Cloned porcine cytokines and their functions

Cytokine (Genbank accession number)

Source Function

IFN-α (M28623) MØ and monocytes but any cell type can

Inhibition of viral replication, antiproliferative activity and increase of MHC I.

IFN-β (M86762) Fibroblasts but any cell type can

Inhibition of viral replication, antiproliferative activity and increase of MHC I.

IFN-γ (X53085, S63967) T cells, NK cells and MØ

MØ activation, viral protection and increased MHC II and I expression.

TNF-α (M29079) MØ Induces inflammation and co-stimulates lymphocyte proliferation.

TNF-β (X54859) T cells Activates tumor apoptosis, neutrophils, MØ and B cells.

IL-1α (X52731) IL-1β (M86725)

Many cells Co-stimulators of Th2 cells and stimulation of acute-phase response.

IL-2 (X58428, X56750) Th1 cells Activation of T, B and NK cells.

IL-4 (X68330, L12991) Th2 cells Activates B-cell growth and their differentiation, inhibition of IL-1, IL-6 and TNF-α.

IL-5 (AJ133452, AJ010088) T cells, mast cells Movement, maturation and proliferation of Eosinophils.

IL-6 (M86722, M80258) MØ, T- and B cells, bone marrow stroma cells, fibroblasts and keratinocytes.

Promotes IL-2 production and T-cell differentiation.

36

IL-7 (AB035380,NM214135) Bone marrow Stroma

Growth of pre-B cells and pre-T cells.

IL-8 (M86923) MØ, fibroblasts, lymphocytes, granu-locytes, endothelial cells, hepatocytes, keratinocytes

Chemoattractant for neutrophils (activation), basophils and T cells.

IL-10 (L20001) MØ and Th2 cells Inhibits activation of Th1 and NK cells and suppresses MØ.

IL-12p40 (U08317) IL-12p35 (L35765)

MØ Stimulates Th1 cells with secretion of IFN-γ and IL-2, activation of NK cells and T cells.

IL-13 (AF385625) T cells B cell growth and differentiation, IgE isotype switching, inhibits MØ inflammatory cytokine production.

IL-15 (U58142) Activated lymphocytes

Enhances T cell proliferation.

IL-16 (AB106555) T cells, B cells, mast cells, DC, epithelial cells, fibroblasts and eosinophils

Acts as a chemoattractant for CD4+ T cells and eosinophils.

IL-17 (AB102693) T cells Inflammation, involved in the proliferation, maturation and chemotaxis of neutrophils.

IL-18 (U68701) MØ Growth and differentiation factor for Th1 cells, induction of IFN-γ.

IL-21 (AB073020) Activated CD4+ T cells

Regulation of the activation of T and NK cells, costimulates B cell proliferation and is a switch factor for the production of IgG isotypes.

IL-27p28 (AY788913) APC Promoting Th1 responses and IFN-γ production.

GM-CSF (D21074) T cells, MØ, endothelial cells and fibroblasts

Stimulates proliferation of granulocytes, MØ, erythrocyte progenitors and activates neutrophils, MØ and eosinophils.

TGF-β1, TGF-β2, TGF-β3 (M23703, M70142, X14150)

Many cell types Inhibitors of cell proliferation, increase of cell density, fibrosis and angiogenesis. Switch towards IgA.

GM-CSF = granulocyte colony stimulating factor ; TNF : tumor necrosis factor ; IFN : interferon ; IL : interleukin ; TGF : transforming growth factor ; MØ : macrophages , NK cells : natural killer cells. Adapted from Blecha 2001. In biology of the domestic pig. 2001 Ed. Wilson G. Pond and HJ. Mersmann. P 689-711.

37

Now what about the Th1/Th2 paradigm in pigs....? Although it is still unclear to what

extent the Th1/Th2 paradigm applies to pigs, in vitro studies on IFN-γ and IL-12 showed that

both cytokines play a role in the regulation of porcine Th1 or cell mediated immune responses

similar to their murine and human counterparts (Lesnick and Derbyshire, 1988 ; Zuckermann

et al., 1998). Secondly, activated pig macrophages can produce inflammatory cytokines such

as IL-1α, IL-1β, IL-6, IL-8 and TNF-α which mediate and modulate immune responses but if

overexpressed may increase the severity of the disease (Murthaugh et al., 1996). However, in

contrast to mice and humans, it appears that porcine cells do not readily produce IL-4 as the

major Th2 cytokine, suggesting that another cytokine with similar functions such as IL-13

may mediate some or all functions attributed in other species to IL-4 (Reddy et al., 2000 ; de

Waal Malefyt et al., 1993 ; Minty et al., 1993).

In a study on th1/Th2 profiles in pigs, the effects of antigen and cytokine environment

on antigen-exposed APC were evaluated in terms of in-contact T cell cytokine profiles

(Raymond and Wilkie, 2004). T cells cultured with hen egg white lysozyme (HEWL)-treated

monocyte-derived DC (mDC) expressed large amounts of IL-13 and moderate amounts of IL-

10 and IFN-γ mRNA suggesting a Th2-bias, while T cells cultured with killed Mycobacterium

tuberculosis-treated mDC expressed increased IFN-γ, decreased IL-10 and unchanged IL-13

mRNA, which suggests a Th1 bias. The results indicate that pig T cells respond by producing

characteristic cytokine patterns reflecting the nature of the initiating antigen and modifying

cytokines. Therefore, pig APC function similarly to mouse and human APC which regulate

differentiation of T cells towards type 1,2 or 3 and the study confirms that antigen determines

the type of immune response that develops (Banchereau et al., 2000).

In several species so far studied, IgG isotype expression is controlled by Th1 and Th2

cytokines and differential Ig isotype expression permits diverse isotype-related functions

(Miletic and Frank, 1995 ; Miletic et al., 1996). Typically, complement and phagocytosis-

activating Ig isotypes are induced by Th1 cytokines. In mice, IFN-γ induces IgG2α, while IL-

10 promotes switching to IgG1 and IgA (Snapper et al., 1988 ; Stevens et al., 1988 ;

Mosmann and Coffman, 1989). In humans, isotype production is also controlled by cytokines

such that IFN-γ stimulates IgG1 and IgG3 production while IL-4 stimulates IgE and IgG4

(Snapper and Mond, 1993 ; Sutherland et al., 1993). In pigs, in vitro studies of Ig production

by B cells cultured in the presence of recombinant porcine (rp) cytokines varies by individual,

however, pigs tend to generate a high IgG1/IgG2 ratio in respons to rp IL-10 and the inverse

in response to rp IFN-γ or rp IL-12 classifying IgG1 as a Type 2 isotype and IgG2 as a Type 1

38

(Crawley et al., 2003). Differential Ig isotype production should favor an isotype with a

functional advantage to control the infection. Nevertheless, functional attributes of pig Ig

isotypes have not clearly been described yet (Crawley and Wilkie, 2003).

CHAPTER 3

DNA VACCINES IN VETERINARY MEDICINE

39

CHAPTER 3 : DNA VACCINES IN VETERINARY MEDICINE

The majority of currently licensed vaccines are produced using conventional

technologies not significantly different from those pioneered by Jenner and Pasteur. Live

attenuated vaccines can be very effective because they induce both cellular and humoral

immune responses. However, mechanisms of attenuation are often poorly defined and the risk

associated with the potential for reversion to a virulent phenotype is a major concern. Killed,

inactivated vaccines are safer but they may be less effective than attenuated vaccines,

because, although they are able to induce strong antibody responses, cellular immune

responses are usually poor.

A more recent development in vaccine methodology is DNA vaccination (reviewed by

Babiuk et al., 1999, Sharma and Khuller, 2001 ; Gurunathan et al., 2000 ; Leitner et al., 2000 ;

Watts and Kennedy, 1999). The concept of DNA as a vaccine was initially described in 1990

by Wolff et al. (1990) demonstrating that direct intramuscular injection of purified bacterial

plasmid DNA resulted in the expression of an encoded reporter gene. The ability of proteins

expressed from DNA plasmids in vivo to elicit a protective host immune response was

subsequently established using an influenza model in mice, confirming the potential for naked

DNA to be used as a vaccine (Ulmer et al., 1993). Since then, experimental vaccines have

been developed against many pathogens in many different species. Unfortunately, the

majority of the most succesful demonstrations of the efficacy of DNA immunisation have

been performed in the mouse.

Although the results in humans and large animals were not as encouraging, there

continues to be an interest in developing this technology for these species since DNA

vaccines present several important advantages over conventional vaccines. (a) The immunity

induced against the endogenously produced vaccine results in antigen presentation through

both MHC I and MHC II pathways, resulting in a broad spectrum of humoral and cellular

immune responses, similar to what one would expect from a natural viral infection (Ulmer et

al., 1998). (b) Since the antigen is produced endogenously, there is no need for adjuvants or

problems associated with injection site reactions produced by adjuvants. This should ensure

better meat quality in food producing animals (Van Donkersgoed et al., 1999). (c) DNA

vaccines are easily constructed and purified in a relatively cost-effective manner. Since the

host acts as the bioreactor, there is no need to develop extensive protein-purification methods.

Additionally, they are heat-stable and easily transportable when stored in lyophilised form. (d)

DNA vaccines also do not require dangerous pathogens to be cultured. e) Possibly one of the

40

major advantages of DNA vaccines is that they can induce immune responses in neonates

even in the presence of maternal antibodies (van Drunen Littel-van den Hurk et al., 1999). (f)

Because DNA vaccins only contain a single protein, they can function as marker vaccins in

disease monitoring (van Oirschot et al., 1996).

Thus, DNA vaccination has many attractive qualities but there may also be some

disadvantages. Two of the major concerns are DNA integration into the host genome which

could lead to an increased risk of malignancy and development of anti-DNA antibodies

inducing auto-immune diseases. Neither of these have been proven yet and more research is

required before definitive conclusions can be reached (Babiuk et al., 1999).

3.1. THE FEATURES OF A DNA VACCINE

Typically, a DNA vaccine consists of a foreign gene of interest cloned into a bacterial

plasmid. The basic requirements for the backbone of a plasmid DNA vector are an eukaryotic

promotor, a cloning site, a polyadenylation sequence, a selectable marker and a bacterial

origin of replication (Gurunathan et al., 2000). A strong eukaryotic promotor, typically viral

promotors such as those derived from cytomegalovirus (CMV) or Rous sarcoma virus (RSV),

provide high levels of gene expression in a wide variety of mammalian cells. Incorporation of

a polyadenylation sequence such as the bovine growth hormone (BGH) or SV40

polyadenylation sequence, provides stabilisation of the mRNA transcripts and proper

translation. The most commonly used selection markers are bacterial antibiotic resistance

genes such as ampicillin and kanamycin. Finally, the plasmid must contain an origin of

replication (such as ColE1) to allow growth in bacteria providing high plasmid copy numbers

thereby enabling high yield of plasmid DNA on purification (Dunham, 2002).

An important component of DNA vaccines, in addition of the basic requirements

described above is the presence of immunostimulatory sequences (ISS) within the plasmid

DNA (Pisetsky, 1996 ; Sato et al., 1996). These sequences consist of unmethylated cytosine-

phosphate-guanosine (CpG) dinucleotides flanked, typically, by two 5’ purine and two 3’

pyrimidine residues. Such CpG motifs can activate the innate immune system and may

therefore act as an endogenous adjuvant which is antigen independent (Klinman et al., 1999).

41

3.2. IMMUNE MECHANISMS OF DNA VACCINATION

The exact mechanism by which DNA vaccines induce an immune response in the host

is still incompletely understood. It is thought that "professional" antigen-presenting cells

(such as macrophages and DC) play the dominant role in priming the immune system to

vaccine antigen. They do so by presenting vaccine peptides on MHC class I molecules,

following direct transfection or through "cross"-presentation, and on MHC class II molecules

after antigen capture and processing within the endocytic pathway. The somatic cells such as

myocytes and keratinocytes, which constitute the predominant cells transfected after DNA

inoculation via muscle or skin injection respectively, then serve primarily as antigen factories

(Fig. 9)(reviewed by Shedlock and Weiner, 2000). Although each of these mechanism is

significant in stimulating at least one facet of immunity, it remains debatable as to which one

plays the dominant role in the induction of protection.

Figure 9 : The potential mechanisms of DNA vaccination. Professional APC are at the center of the DNA vaccine-mediated immune responses by (1) MCH I and II-restricted presentation following direct transfection by plasmid DNA, (2) MHC II-restricted presentation of antigen captured from transfected somatic cells and (3) MHC I-restricted “cross”-presentation of vaccine antigen acquired from apoptotic cells. Immunostimulatory qualities of the plasmid vaccine stimulate the APC maturation and migration to the lymph nodes, where they can interact with T cells.

3. MHC I-restricted cross-presentation

Apoptotic cell

Antigen-loaded MHC I

DNA plasmids Mature DC

1. MHC I and II-restricted presentation

maturation Transfection

Immature DC

2. MHC II-restricted presentation

Secreted antigen Antigen-loaded MHC II

Somatic cell

42

3.3. EFFICACY OF DNA VACCINES IN LARGE ANIMALS

DNA vaccines are often less effective in large animals than in mice. It is generally

believed that if the transfection efficiency, i.e. more cells are transfected, as well as the level

of gene expression by each transfected cell increases there should be a concommitant increase

in the magnitude of the immune response. This can be achieved in a number of ways.

3.3.1. Improving transfection efficiëncy

Most frequently, DNA vaccines have been delivered by intramuscular (IM) or

intradermal (ID) injection. Although it is difficult to quantitate, it is believed that 90% of the

administered DNA never gets into the cytoplasma and of the 10% that does so, less than 1%

enter the nucleus where gene expression occurs (Boutorine and Kostina, 1993 ; Barry et al.,

1999). One of the earlier approaches used to enhance gene delivery is a ballistic method

which fires gold particles coated with DNA into the skin, using a “gene gun” eliciting

immune responses equivalent to needle delivery but with up to 100-fold less DNA. Other

delivery methods recently developed to improve vaccine efficacy include jet injection

(Haensler et al., 1999 ; Furth et al., 1995 ; Sawamura et al, 1999 ; Mumper and Cui, 2003),

cationic PLG microparticles (O’Hagan et al., 2001), in vivo electroporation (Glasspool-

Malone et al., 2000 ; Widera et al., 2000 ; Babiuk et al., 2002) and suppositories (Loehr et al.,

2001).

3.3.2. Enhancing antigen expression

Another important consideration when optimising the efficacy of DNA vaccines is the

appropriate choice of plasmid vector. Beside the basic requirements for the backbone of a

plasmid vector as mentioned above, additional factors should be considered (reviewed by

Garmory et al., 2003).

- In most studies on DNA immunisation, expression vectors are used wich contain

strong viral promotors. However, not only the choice of promotor is critical but the presence

of an intron is at least as important (Chapman et al., 1991 ; Lee et al., 1997). It is thought that

the beneficial effect of introns on expression is primarily due to an enhanced rate of

polyadenylation and/or nuclear transport associated with RNA splicing (Huang and Gorman,

1990).

43

- One step possibly hindering protein synthesis from plasmid vectors may be

translation of mRNA transcripts since each animal species has his own set of tRNA codons

that is optimal for translation. A number of studies have indeed reported that increased

immune responses may be obtained by DNA vaccination with a transgene sequence with

optimised codon usage (Uchijima et al., 1998 ; Deml et al., 2001 ; Narum et al., 2001 ;

Stratford et al., 2000 ; Vinner et al., 1999).

- Prokaryotic genes do not possess Kozak sequences which flank the AUG initiator

codon within mRNA, influencing its recognition by eukaryotic ribosomes and translation

efficiëncy (Kozak, 1987 ; Kozak, 1997). Therefore, the expression levels might increase by

the insertion of a Kozak sequence (An et al., 2000 ; Qin et al., 2003 ; Steinberg et al., 2005).

3.3.3. Modulating the immune environment

Even if the optimised plasmid enters the cell and the nucleus, the quantity of protein

that is produced is generally very low. Thus, if the vaccines also encoded some co-stimulatory

molecules important for enhancing immunity, it should be possible to improve the kinetics

and magnitude of the immune response. This immune environment can be improved in a

number of ways.

- First, the plasmid backbone can be constructed to contain additional immune

stimulatory CpG motifs since it has been shown that the innate immune system of vertebrates

recognise CpG motifs as “danger” signals leading to various signal transduction events

including the production of various cytokines involved in immune activation (Krieg et al.,

1998 ; Krieg and Davis, 2001 ; Sato et al., 1996). However, since most studies were

conducted in mice and CpG motifs are species-specific more comprehensive studies in large

animals with (additional) CpG motifs in the vector are needed to establish their efficacy.

- In contrast to CpG motifs which can be considered rather broad-spectrum

immunomodulatory molecules, it is also possible to incorporate genes into the plasmid

encoding cytokines or co-stimulatory molecules which would create a micro-environment

for both attraction of antigen-presenting and responsive cells as well as expansion of cells.

Different cytokines were tested in different species and disease situations which makes a

comparison difficult. However, results show that GM-CSF appears to be the cytokine that

most consistently has a beneficial effect on the efficacy of a DNA vaccine through its effect

on the recruitment and maturation of DC. Also IL-12 and IL-18 may be promising candidates

(Reviewed by van Drunen Littel-van den Hurk et al. ,2004). In addition of using cytokines,

the use of gene-encoded co-stimulatory molecules such as B7.1/2 (Santra et al., 2000 ; Kim et

44

al., 1998), ICAM I (Kim et al., 1999) and CD40L (Sin et al., 2001) were also reported to be

effective.

- Finally, promising results were obtained in studies using DNA vaccine constructs

wich produce an antigenic protein fused to an second protein, such as CTLA-4 which targets

the antigen (produced by transfected somatic cells) to APC thereby enhancing DNA vaccine

efficacy (Chaplin et al., 1999 ; Drew et al., 2001 , Shkreta et al., 2003 ; Tachedjian et al.,

2003).

The approaches outlined above may together allow for the rational and optimised

design of DNA vaccines. It is expected that many exciting developments will arise in the next

decade hopefully enabling this technology to give rise to commercial vaccines in domestic

animals.

References Abbas AK, Murphy KM, Sher A. (1996) Functional diversity of helper T lymphocytes. Nature. 383(6603):787-93. Afkarian M, Sedy JR, Yang J, Jacobson NG, Cereb N, Yang SY, Murphy TL, Murphy KM. (2002) T-bet is a STAT1-induced regulator of IL-12R expression in naive CD4+ T cells. Nat Immunol. 3(6):549-57. Agarwal S, Avni O, Rao A. (2000) Cell-type-restricted binding of the transcription factor NFAT to a distal IL-4 enhancer in vivo. Immunity. 12(6):643-52. Agarwal S, Rao A. (1998) Modulation of chromatin structure regulates cytokine gene expression during T cell differentiation. Immunity. 9(6):765-75. Akiba H, Miyahira Y, Atsuta M, Takeda K, Nohara C, Futagawa T, Matsuda H, Aoki T, Yagita H, Okumura K. (2000) Critical contribution of OX40 ligand to T helper cell type 2 differentiation in experimental leishmaniasis. J Exp Med. 191(2):375-80. Albright JW, Zuniga-Pflucker JC, Albright JF. (1995) Transcriptional control of IL-2 and IL-4 in T cells of young and old mice. Cell Immunol. 164(2):170-5. Alcami A. (2003) Viral mimicry of cytokines, chemokines and their receptors. Nat Rev Immunol. 3(1):36-50. Annunziato F, Galli G, Cosmi L, Romagnani P, Manetti R, Maggi E, Romagnani S. (1998) Molecules associated with human Th1 or Th2 cells. Eur Cytokine Netw. 1998 Sep;9(3 Suppl):12-6. Assenmacher M, Lohning M, Scheffold A, Manz RA, Schmitz J, Radbruch A. (1998) Sequential production of IL-2, IFN-gamma and IL-10 by individual staphylococcal enterotoxin B-activated T helper lymphocytes. Eur J Immunol. 28(5):1534-43. Assenmacher M, Schmitz J, Radbruch A. (1994) Flow cytometric determination of cytokines in activated murine T helper lymphocytes: expression of interleukin-10 in interferon-gamma and in interleukin-4-expressing cells. Eur J Immunol. 24(5):1097-101. Bach JF (2003) Regulatory T cells under scrutiny. Nat Rev Immunol. Mar;3(3):189-98.

45

Bach EA, Szabo SJ, Dighe AS, Ashkenazi A, Aguet M, Murphy KM, Schreiber RD. (1995) Ligand-induced autoregulation of IFN-gamma receptor beta chain expression in T helper cell subsets. Science. 270(5239):1215-8. Baggiolini M (1998) Chemokines and leukocyte traffic. Nature. 392(6676):565-8. Banchereau J, Briere F, Caux C, Davoust J, Lebecque S, Liu YJ, Pulendran B, Palucka K (2000) Immunobiology of dendritic cells. Annu Rev Immunol. 18:767-811. Barbulescu K, Becker C, Schlaak JF, Schmitt E, Meyer zum Buschenfelde KH, Neurath MF (1998) IL-12 and IL-18 differentially regulate the transcriptional activity of the human IFN-gamma promoter in primary CD4+ T lymphocytes. J Immunol. 160(8):3642-7. Barner M, Mohrs M, Brombacher F, Kopf M. (1998) Differences between IL-4R alpha-deficient and IL-4-deficient mice reveal a role for IL-13 in the regulation of Th2 responses. Curr Biol. 8(11):669-72. Barnes PF, Chatterjee D, Abrams JS, Lu S, Wang E, Yamamura M, Brennan PJ, Modlin RL. (1992) Cytokine production induced by Mycobacterium tuberculosis lipoarabinomannan. Relationship to chemical structure. J Immunol. 149(2):541-7. Belkaid Y, Piccirillo CA, Mendez S, Shevach EM, Sacks DL (2002) CD4+CD25+ regulatory T cells control Leishmania major persistence and immunity. Nature. 420(6915):502-7. Belladonna ML, Renauld JC, Bianchi R, Vacca C, Fallarino F, Orabona C, Fioretti MC, Grohmann U, Puccetti P. (2002) IL-23 and IL-12 have overlapping, but distinct, effects on murine dendritic cells. J Immunol. 168(11):5448-54. Bennett WA, Lagoo-Deenadayalan S, Whitworth NS, Brackin MN, Hale E, Cowan BD (1997) Expression and production of interleukin-10 by human trophoblast: relationship to pregnancy immunotolerance. Early Pregnancy. 3(3):190-8. Bird JJ, Brown DR, Mullen AC, Moskowitz NH, Mahowald MA, Sider JR, Gajewski TF, Wang CR, Reiner SL. (1998) Helper T cell differentiation is controlled by the cell cycle. Immunity. 9(2):229-37. Bird AP, Wolffe AP. (1999) Methylation-induced repression--belts, braces, and chromatin. Cell. 99(5):451-4. Bluestone JA and Abbas AK (2003) Natural versus adaptive regulatory T cells. Nat Rev Immunol. 3(3):253-7. Bonecchi R, Bianchi G, Bordignon PP, D'Ambrosio D, Lang R, Borsatti A, Sozzani S, Allavena P, Gray PA, Mantovani A, Sinigaglia F. (1998) Differential expression of chemokine receptors and chemotactic responsiveness of type 1 T helper cells (Th1s) and Th2s. J Exp Med. 187(1):129-34. Borges E, Tietz W, Steegmaier M, Moll T, Hallmann R, Hamann A, Vestweber D. (1997) P-selectin glycoprotein ligand-1 (PSGL-1) on T helper 1 but not on T helper 2 cells binds to P-selectin and supports migration into inflamed skin. J Exp Med. 185(3):573-8. Boumpas DT, Paliogianni F, Anastassiou ED, Balow JE (1991) Glucocorticosteroid action on the immune system: molecular and cellular aspects. Clin Exp Rheumatol. 9(4):413-23 Bretscher PA, Wei G, Menon JN, Bielefeldt-Ohmann H. (1992) Establishment of stable, cell-mediated immunity that makes "susceptible" mice resistant to Leishmania major. Science. 257(5069):539-42. Brightbill HD, Libraty DH, Krutzik SR, Yang RB, Belisle JT, Bleharski JR, Maitland M, Norgard MV, Plevy SE, Smale ST, Brennan PJ, Bloom BR, Godowski PJ, Modlin RL. (1999) Host defense mechanisms triggered by microbial lipoproteins through toll-like receptors. Science. 285(5428):732-6. Brinkmann V, Geiger T, Alkan S, Heusser CH. (1993) Interferon alpha increases the frequency of interferon gamma-producing human CD4+ T cells. J Exp Med. 178(5):1655-63.

46

Brown JA, Titus RG, Nabavi N, Glimcher LH. (1996) Blockade of CD86 ameliorates Leishmania major infection by down-regulating the Th2 response. J Infect Dis. 174(6):1303-8. Camoglio L, Juffermans NP, Peppelenbosch M, te Velde AA, ten Kate FJ, van Deventer SJ, Kopf M (2002) Contrasting roles of IL-12p40 and IL-12p35 in the development of hapten-induced colitis Eur J Immunol. 32(1):261-9. Cardell S, Hoiden I, Moller G. (1993) Manipulation of the superantigen-induced lymphokine response. Selective induction of interleukin-10 or interferon-gamma synthesis in small resting CD4+ T cells. Eur J Immunol. 23(2):523-9. Cardell S, Sander B. (1990) Interleukin 2, 4 and 5 are sequentially produced in mitogen-stimulated murine spleen cell cultures. Eur J Immunol. 20(2):389-95. Carding SR, West J, Woods A, Bottomly K. (1989) Differential activation of cytokine genes in normal CD4-bearing T cells is stimulus dependent. Eur J Immunol. 19(2):231-8. Cavani A, Nasorri F, Prezzi C, Sebastiani S, Albanesi C, Girolomoni G. (2000) Human CD4+ T lymphocytes with remarkable regulatory functions on dendritic cells and nickel-specific Th1 immune responses. J Invest Dermatol. 114(2):295-302. Chaouat G, Assal Meliani A, Martal J, Raghupathy R, Elliot J, Mosmann T, Wegmann TG (1995) IL-10 prevents naturally occurring fetal loss in the CBA x DBA/2 mating combination, and local defect in IL-10 production in this abortion-prone combination is corrected by in vivo injection of IFN-tau. J Immunol. 154(9):4261-8. Chua AO, Chizzonite R, Desai BB, Truitt TP, Nunes P, Minetti LJ, Warrier RR, Presky DH, Levine JF, Gately MK, et al. (1994) Expression cloning of a human IL-12 receptor component. A new member of the cytokine receptor superfamily with strong homology to gp130. J Immunol. 153(1):128-36 Chua AO, Wilkinson VL, Presky DH, Gubler U (1995) Cloning and characterization of a mouse IL-12 receptor-beta component. J Immunol. 155(9):4286-94. Chen Q, Ghilardi N, Wang H, Baker T, Xie MH, Gurney A, Grewal IS, de Sauvage FJ. (2000) Development of Th1-type immune responses requires the type I cytokine receptor TCCR. Nature 407(6806):916-20. Chen Y, Kuchroo VK, Inobe J, Hafler DA, Weiner HL. (1994) Regulatory T cell clones induced by oral tolerance: suppression of autoimmune encephalomyelitis. Science. 265(5176):1237-40. Cho SS, Bacon CM, Sudarshan C, Rees RC, Finbloom D, Pine R, O'Shea JJ. (1996) Activation of STAT4 by IL-12 and IFN-alpha: evidence for the involvement of ligand-induced tyrosine and serine phosphorylation. J Immunol. 157(11):4781-9. Cleveland MG, Gorham JD, Murphy TL, Tuomanen E, Murphy KM (1996) Lipoteichoic acid preparations of gram-positive bacteria induce interleukin-12 through a CD14-dependent pathway. Infect Immun. 64(6):1906-12 Cohn L, Tepper JS, Bottomly K. (1998) IL-4-independent induction of airway hyperresponsiveness by Th2, but not Th1, cells. J Immunol. 161(8):3813-6. Constant SL, Bottomly K. (1997) Induction of Th1 and Th2 CD4+ T cell responses: the alternative approaches. Annu Rev Immunol. 297-322. Coqueret O, Lagente V, Frere CP, Braquet P, Mencia-Huerta JM (1994) Regulation of IgE production by beta 2-adrenoceptor agonists. Ann N Y Acad Sci. 725:44-9. Cottrez F, Groux H. (2001) Regulation of TGF-beta response during T cell activation is modulated by IL-10. J Immunol. 167(2):773-8. Cowdery JS, Boerth NJ, Norian LA, Myung PS, Koretzky GA (1999) Differential regulation of the IL-12 p40 promoter and of p40 secretion by CpG DNA and lipopolysaccharide.J Immunol. 162(11):6770-5.

47

Coyle AJ, Lloyd C, Tian J, Nguyen T, Erikkson C, Wang L, Ottoson P, Persson P, Delaney T, Lehar S, Lin S, Poisson L, Meisel C, Kamradt T, Bjerke T, Levinson D, Gutierrez-Ramos JC. (1999) Crucial role of the interleukin 1 receptor family member T1/ST2 in T helper cell type 2-mediated lung mucosal immune responses. J Exp Med. 190(7):895-902. Cozzo C, Larkin J 3rd, Caton AJ (2003) Cutting edge: self-peptides drive the peripheral expansion of CD4+CD25+ regulatory T cells. J Immunol. 171(11):5678-82 Crawley A, Raymond C, Wilkie BN (2003) Control of immunoglobulin isotype production by porcine B-cells cultured with cytokines. Vet Immunol Immunopathol.;91(2):141-54. Crawley A, Wilkie BN (2003) Porcine Ig isotypes: function and molecular characteristics. Vaccine. 21(21-22):2911-22. Croft M, Carter L, Swain SL, Dutton RW. (1994) Generation of polarized antigen-specific CD8 effector populations: reciprocal action of interleukin (IL)-4 and IL-12 in promoting type 2 versus type 1 cytokine profiles. J Exp Med. 180(5):1715-28. Croft M, Swain SL. (1995) Recently activated naive CD4 T cells can help resting B cells, and can produce sufficient autocrine IL-4 to drive differentiation to secretion of T helper 2-type cytokines. J Immunol. 154(9):4269-82. D'Ambrosio D, Iellem A, Bonecchi R, Mazzeo D, Sozzani S, Mantovani A, Sinigaglia F. (1998) Selective up-regulation of chemokine receptors CCR4 and CCR8 upon activation of polarized human type 2 Th cells. Immunol. 161(10):5111-5. Davis MM, Chien YH, Gascoigne NR, Hedrick SM. (1984) A murine T cell receptor gene complex: isolation, structure and rearrangement. Immunol Rev. 81:235-58. Das J, Chen CH, Yang L, Cohn L, Ray P, Ray A. (2001) A critical role for NF-kappa B in GATA3 expression and TH2 differentiation in allergic airway inflammation. Nat Immunol. 2(1):45-50. Daynes RA, Araneo BA, Dowell TA, Huang K, Dudley D (1990) Regulation of murine lymphokine production in vivo. III. The lymphoid tissue microenvironment exerts regulatory influences over T helper cell function. J Exp Med. 171(4):979-96. Decken K, Kohler G, Palmer-Lehmann K, Wunderlin A, Mattner F, Magram J, Gately MK, Alber G (1998) Interleukin-12 is essential for a protective Th1 response in mice infected with Cryptococcus neoformans. Infect Immun. 66(10):4994-5000 de Jong EC, Smits HH, Kapsenberg ML (2005) Dendritic cell-mediated T cell polarization. Springer Semin Immunopathol. 26(3):289-307. Demeure CE, Wu CY, Shu U, Schneider PV, Heusser C, Yssel H, Delespesse G (1994) In vitro maturation of human neonatal CD4 T lymphocytes. II. Cytokines present at priming modulate the development of lymphokine production. J Immunol. 152(10):4775-82. de Waal Malefyt R, Figdor CG, de Vries JE (1993) Effects of interleukin 4 on monocyte functions: comparison to interleukin 13. Res Immunol. 144(8):629-33. Diehl S, Anguita J, Hoffmeyer A, Zapton T, Ihle JN, Fikrig E, Rincon M. (2000) Inhibition of Th1 differentiation by IL-6 is mediated by SOCS1. Immunity. 13(6):805-15. Diehl S, Rincon M. (2002) The two faces of IL-6 on Th1/Th2 differentiation. Mol Immunol. 39(9):531-6. Dong C, Flavell RA (2001) Th1 and Th2 cells. Curr Opin Hematol. 8(1):47-51. d'Ostiani CF, Del Sero G, Bacci A, Montagnoli C, Spreca A, Mencacci A, Ricciardi-Castagnoli P, Romani L. (2000) Dendritic cells discriminate between yeasts and hyphae of the fungus Candida albicans. Implications for initiation of T helper cell immunity in vitro and in vivo. J Exp Med. 191(10):1661-74.

48

Doetze A, Satoguina J, Burchard G, Rau T, Loliger C, Fleischer B, Hoerauf A. (2000) Antigen-specific cellular hyporesponsiveness in a chronic human helminth infection is mediated by T(h)3/T(r)1-type cytokines IL-10 and transforming growth factor-beta but not by a T(h)1 to T(h)2 shift. Int Immunol. 12(5):623-30. Elenkov IJ, Papanicolaou DA, Wilder RL, Chrousos GP (1996) Modulatory effects of glucocorticoids and catecholamines on human interleukin-12 and interleukin-10 production: clinical implications. Proc Assoc Am Physicians. 108(5):374-81. Emoto M, Emoto Y, Buchwalow IB, Kaufmann SH (1999) Induction of IFN-gamma-producing CD4+ natural killer T cells by Mycobacterium bovis bacillus Calmette Guerin. Eur J Immunol. 29(2):650-9. Emson CL, Bell SE, Jones A, Wisden W, McKenzie AN. (1998) Interleukin (IL)-4-independent induction of immunoglobulin (Ig)E, and perturbation of T cell development in transgenic mice expressing IL-13. J Exp Med. 188(2):399-404. Erard F, Wild MT, Garcia-Sanz JA, Le Gros G. (1993) Switch of CD8 T cells to noncytolytic CD8-CD4- cells that make TH2 cytokines and help B cells. Science. 260(5115):1802-5. Evavold BD, Williams SG, Hsu BL, Buus S, Allen PM. (1992) Complete dissection of the Hb(64-76) determinant using T helper 1, T helper 2 clones, and T cell hybridomas. J Immunol. 148(2):347-53. Fabris N, Piantanelli L, Muzzioli M (1977) Differential effect of pregnancy or gestagens on humoral and cell-mediated immunity. Clin Exp Immunol. 28(2):306-14. Farrar JD, Asnagli H, Murphy KM (2002) T helper subset development: roles of instruction, selection, and transcription. J Clin Invest. 109(4):431-5. Farrar JD, Smith JD, Murphy TL, Murphy KM. (2000) Recruitment of Stat4 to the human interferon-alpha/beta receptor requires activated Stat2. J Biol Chem. 275(4):2693-7. Firestein GS, Roeder WD, Laxer JA, Townsend KS, Weaver CT, Hom JT, Linton J, Torbett BE, Glasebrook AL. (1989) A new murine CD4+ T cell subset with an unrestricted cytokine profile. J Immunol. 143(2):518-25. Flesch IE, Hess JH, Huang S, Aguet M, Rothe J, Bluethmann H, Kaufmann SH (1995) Early interleukin 12 production by macrophages in response to mycobacterial infection depends on interferon gamma and tumor necrosis factor alpha. J Exp Med. 181(5):1615-21. Fontenot JD, Gavin MA, Rudensky AY (2003) Foxp3 programs the development and function of CD4+CD25+ regulatory T cells. Nat Immunol. 4(4):330-6. Franchimont D, Galon J, Gadina M, Visconti R, Zhou Y, Aringer M, Frucht DM, Chrousos GP, O'Shea JJ (2000) Inhibition of Th1 immune response by glucocorticoids: dexamethasone selectively inhibits IL-12-induced Stat4 phosphorylation in T lymphocytes. J Immunol. 164(4):1768-74. Fukaura H, Kent SC, Pietrusewicz MJ, Khoury SJ, Weiner HL, Hafler DA. (1996) Induction of circulating myelin basic protein and proteolipid protein-specific transforming growth factor-beta1-secreting Th3 T cells by oral administration of myelin in multiple sclerosis patients. J Clin Invest. 98(1):70-7. Fuss IJ, Boirivant M, Lacy B, Strober W. (2002) The interrelated roles of TGF-beta and IL-10 in the regulation of experimental colitis. J Immunol. 168(2):900-8. Garba ML, Pilcher CD, Bingham AL, Eron J, Frelinger JA. (2002) HIV antigens can induce TGF-beta(1)-producing immunoregulatory CD8+ T cells. J Immunol. 168(5):2247-54. Gardner EM, Murasko DM. (2002) Age-related changes in Type 1 and Type 2 cytokine production in humans. Biogerontology. 3(5):271-90. Glimcher LH (2001) Lineage commitment in lymphocytes: controlling the immune response. J Clin Invest. 108(7):s25-s30.

49

Glimcher LH, Murphy KM. (2000) Lineage commitment in the immune system: the T helper lymphocyte grows up. Genes Dev. 14(14):1693-711. Gorelik L, Flavell RA. (2002) Transforming growth factor-beta in T-cell biology. Nat Rev Immunol. 2(1):46-53. Gorelik L, Constant S, Flavell RA. (2002) Mechanism of transforming growth factor beta-induced inhibition of T helper type 1 differentiation. J Exp Med. 195(11):1499-505. Grogan JL, Mohrs M, Harmon B, Lacy DA, Sedat JW, Locksley RM. (2001) Early transcription and silencing of cytokine genes underlie polarization of T helper cell subsets. Immunity. 14(3):205-15. Groux H. (2001) An overview of regulatory T cells. Microbes Infect. 3(11):883-9. Groux H, O'Garra A, Bigler M, Rouleau M, Antonenko S, de Vries JE, Roncarolo MG. (1997) A CD4+ T-cell subset inhibits antigen-specific T-cell responses and prevents colitis. Nature. 389(6652):737-42. Guilbert LJ (1996) There is a bias against type 1 (inflammatory) cytokine expression and function in pregnancy. J Reprod Immunol. 32(2):105-10. Gu Y, Kuida K, Tsutsui H, Ku G, Hsiao K, Fleming MA, Hayashi N, Higashino K, Okamura H, Nakanishi K, Kurimoto M, Tanimoto T, Flavell RA, Sato V, Harding MW, Livingston DJ, Su MS. (1997) Activation of interferon-gamma inducing factor mediated by interleukin-1beta converting enzyme. Science. 275(5297):206-9. Hanninen A, Harrison LC. (2000) Gamma delta T cells as mediators of mucosal tolerance: the autoimmune diabetes model. Immunol Rev. 173:109-19. Heath VL, Murphy EE, Crain C, Tomlinson MG, O'Garra A. (2000) TGF-beta1 down-regulates Th2 development and results in decreased IL-4-induced STAT6 activation and GATA-3 expression. Eur J Immunol. 30(9):2639-49. Hirano T. (1998) Interleukin 6 and its receptor: ten years later. Int Rev Immunol. 16(3-4):249-84. Ho IC, Glimcher LH. (2002) Transcription: tantalizing times for T cells. Cell. 109 Suppl:S109-20. Ho IC, Hodge MR, Rooney JW, Glimcher LH. (1996) The proto-oncogene c-maf is responsible for tissue-specific expression of interleukin-4. Cell. 85(7):973-83. Hobbs MV, Weigle WO, Ernst DN. (1994) Interleukin-10 production by splenic CD4+ cells and cell subsets from young and old mice. Cell Immunol. 154(1):264-72. Hobbs MV, Weigle WO, Noonan DJ, Torbett BE, McEvilly RJ, Koch RJ, Cardenas GJ, Ernst DN. (1993) Patterns of cytokine gene expression by CD4+ T cells from young and old mice. J Immunol. 150(8):3602-14. Holscher C (2004) The power of combinatorial immunology: IL-12 and IL-12-related dimeric cytokines in infectious diseases. Med Microbiol Immunol (Berl). 193(1):1-17. Hori S, Nomura T, Sakaguchi S (2003) Control of regulatory T cell development by the transcription factor Foxp3. Science. 299(5609):1057-61. Hoshino K, Kashiwamura S, Kuribayashi K, Kodama T, Tsujimura T, Nakanishi K, Matsuyama T, Takeda K, Akira S. (1999) The absence of interleukin 1 receptor-related T1/ST2 does not affect T helper cell type 2 development and its effector function. J Exp Med. 190(10):1541-8. Hosken NA, Shibuya K, Heath AW, Murphy KM, O'Garra A. (1995) The effect of antigen dose on CD4+ T helper cell phenotype development in a T cell receptor-alpha beta-transgenic model. J Exp Med. 182(5):1579-84. Hsieh CL. (2000) Dynamics of DNA methylation pattern. Curr Opin Genet Dev. 10(2):224-8. Hsieh CS, Macatonia SE, Tripp CS, Wolf SF, O'Garra A, Murphy KM. (1993) Development of TH1 CD4+ T cells through IL-12 produced by Listeria-induced macrophages. Science. 260(5107):547-9.

50

Hsieh CS, Heimberger AB, Gold JS, O'Garra A, Murphy KM. (1992) Differential regulation of T helper phenotype development by interleukins 4 and 10 in an alpha beta T-cell-receptor transgenic system. Proc Natl Acad Sci U S A. 89(13):6065-9. Hutchins AS, Mullen AC, Lee HW, Sykes KJ, High FA, Hendrich BD, Bird AP, Reiner SL. (2002) Gene silencing quantitatively controls the function of a developmental trans-activator. Mol Cell. 10(1):81-91. Jankovic D, Liu Z, Gause WC (2001) Th1- and Th2-cell commitment during infectious disease: asymmetry in divergent pathways. Trends Immunol. 22(8):450-7. Jankovic D, Kullberg MC, Noben-Trauth N, Caspar P, Paul WE, Sher A. (2000) Single cell analysis reveals that IL-4 receptor/Stat6 signaling is not required for the in vivo or in vitro development of CD4+ lymphocytes with a Th2 cytokine profile. J Immunol. 164(6):3047-55. Jiang H, Chess L (2004) An integrated view of suppressor T cell subsets in immunoregulation. J Clin Invest. 114(9):1198-208. Kalinski P, Hilkens CM, Wierenga EA, Kapsenberg ML. (1999) T-cell priming by type-1 and type-2 polarized dendritic cells: the concept of a third signal. Immunol Today. 20(12):561-7. Kanda N, Tamaki K (1999) Estrogen enhances immunoglobulin production by human PBMCs. J Allergy Clin Immunol. 103(2 Pt 1):282-8. Kaplan MH, Schindler U, Smiley ST, Grusby MJ. (1996) Stat6 is required for mediating responses to IL-4 and for development of Th2 cells. Immunity. 4(3):313-9. Katamura K, Shintaku N, Yamauchi Y, Fukui T, Ohshima Y, Mayumi M, Furusho K (1995) Prostaglandin E2 at priming of naive CD4+ T cells inhibits acquisition of ability to produce IFN-gamma and IL-2, but not IL-4 and IL-5. J Immunol. 155(10):4604-12. Kaufmann SH. (1993) Immunity to intracellular bacteria. Annu Rev Immunol. 11:129-63. Kelso A (1995) Th1 and Th2 subsets: paradigms lost? Immunol Today. 16(8):374-9. Kidd P (2003) Th1/Th2 balance: the hypothesis, its limitations, and implications for health and disease. Altern Med Rev. 8(3):223-46. Kim HR, Ryu SY, Kim HS, Choi BM, Lee EJ, Kim HM, Chung HT (1995) Administration of dehydroepiandrosterone reverses the immune suppression induced by high dose antigen in mice. Immunol Invest. 24(4):583-93 Kim J, Sif S, Jones B, Jackson A, Koipally J, Heller E, Winandy S, Viel A, Sawyer A, Ikeda T, Kingston R, Georgopoulos K. (1999) Ikaros DNA-binding proteins direct formation of chromatin remodeling complexes in lymphocytes. Immunity. 10(3):345-55. Kitani A, Fuss IJ, Nakamura K, Schwartz OM, Usui T, Strober W. (2000) Treatment of experimental (Trinitrobenzene sulfonic acid) colitis by intranasal administration of transforming growth factor (TGF)-beta1 plasmid: TGF-beta1-mediated suppression of T helper cell type 1 response occurs by interleukin (IL)-10 induction and IL-12 receptor beta2 chain downregulation. J Exp Med. 192(1):41-52. Kopf M, Le Gros G, Bachmann M, Lamers MC, Bluethmann H, Kohler G. (1993) Disruption of the murine IL-4 gene blocks Th2 cytokine responses. Nature. 362(6417):245-8. Krieg AM, Yi AK, Matson S, Waldschmidt TJ, Bishop GA, Teasdale R, Koretzky GA, Klinman DM (1995) CpG motifs in bacterial DNA trigger direct B-cell activation. Nature. 374(6522):546-9 Krieg AM, Love-Homan L, Yi AK, Harty JT (1998) CpG DNA induces sustained IL-12 expression in vivo and resistance to Listeria monocytogenes challenge. J Immunol. 161(5):2428-34.

51

Kuchroo VK, Das MP, Brown JA, Ranger AM, Zamvil SS, Sobel RA, Weiner HL, Nabavi N, Glimcher LH. (1995) B7-1 and B7-2 costimulatory molecules activate differentially the Th1/Th2 developmental pathways: application to autoimmune disease therapy. Cell. 80(5):707-18. Kuhn R, Rajewsky K, Muller W. (1991) Generation and analysis of interleukin-4 deficient mice. Science. 254(5032):707-10. Kumar V, Bhardwaj V, Soares L, Alexander J, Sette A, Sercarz E. (1995) Major histocompatibility complex binding affinity of an antigenic determinant is crucial for the differential secretion of interleukin 4/5 or interferon gamma by T cells. Proc Natl Acad Sci U S A. 92(21):9510-4. Lane P. (2000) Role of OX40 signals in coordinating CD4 T cell selection, migration, and cytokine differentiation in T helper (Th)1 and Th2 cells. J Exp Med. 191(2):201-6. Larsson S, Linden M (1998) Effects of a corticosteroid, budesonide, on production of bioactive IL-12 by human monocytes. Cytokine. 10(10):786-9. Lederer JA, Perez VL, DesRoches L, Kim SM, Abbas AK, Lichtman AH. (1996) Cytokine transcriptional events during helper T cell subset differentiation. J Exp Med. 184(2):397-406. Lee DU, Agarwal S, Rao A. (2002) Th2 lineage commitment and efficient IL-4 production involves extended demethylation of the IL-4 gene. Immunity. 16(5):649-60. Lee HJ, Takemoto N, Kurata H, Kamogawa Y, Miyatake S, O'Garra A, Arai N. (2000) GATA-3 induces T helper cell type 2 (Th2) cytokine expression and chromatin remodeling in committed Th1 cells. J Exp Med. 192(1):105-15. Lenschow DJ, Walunas TL, Bluestone JA. (1996) CD28/B7 system of T cell costimulation. Annu Rev Immunol. 14:233-58. Lesnick CE, Derbyshire JB (1988) Activation of natural killer cells in newborn piglets by interferon induction. Vet Immunol Immunopathol. 18(2):109-17. Levings MK, Bacchetta R, Schulz U, Roncarolo MG. (2002) The role of IL-10 and TGF-beta in the differentiation and effector function of T regulatory cells. Int Arch Allergy Immunol. 129(4):263-76. Levings MK, Sangregorio R, Galbiati F, Squadrone S, de Waal Malefyt R, Roncarolo MG (2001) IFN-alpha and IL-10 induce the differentiation of human type 1 T regulatory cells. J Immunol. 166(9):5530-9. Libraty DH, Airan LE, Uyemura K, Jullien D, Spellberg B, Rea TH, Modlin RL (1997) Interferon-gamma differentially regulates interleukin-12 and interleukin-10 production in leprosy. J Clin Invest. 99(2):336-41. Lighvani AA, Frucht DM, Jankovic D, Yamane H, Aliberti J, Hissong BD, Nguyen BV, Gadina M, Sher A, Paul WE, O'Shea JJ. (2001) T-bet is rapidly induced by interferon-gamma in lymphoid and myeloid cells. Proc Natl Acad Sci U S A. 98(26):15137-42. Lohning M, Richter A, Radbruch A. (2002) Cytokine memory of T helper lymphocytes. Adv Immunol 80:115-81. Lohning M, Stroehmann A, Coyle AJ, Grogan JL, Lin S, Gutierrez-Ramos JC, Levinson D, Radbruch A,Kamradt T. (1998) T1/ST2 is preferentially expressed on murine Th2 cells, independent of interleukin 4, interleukin 5, and interleukin 10, and important for Th2 effector function. Proc Natl Acad Sci U S A. 95(12):6930-5. London CA, Abbas AK, Kelso A. (1998) Helper T cell subsets: heterogeneity, functions and development. Vet Immunol Immunopathol. 63(1-2):37-44. Lu B, Yu H, Chow C, Li B, Zheng W, Davis RJ, Flavell RA. (2001) GADD45gamma mediates the activation of the p38 and JNK MAP kinase pathways and cytokine production in effector TH1 cells. Immunity. 14(5):583-90.

52

Lucey DR, Clerici M, Shearer GM (1996) Type 1 and type 2 cytokine dysregulation in human infectious, neoplastic, and inflammatory diseases. Clin Microbiol Rev. 9(4):532-62. Luksch CR, Winqvist O, Ozaki ME, Karlsson L, Jackson MR, Peterson PA, Webb SR (1999) Intercellular adhesion molecule-1 inhibits interleukin 4 production by naive T cells. Proc Natl Acad Sci U S A. 96(6):3023-8. Macatonia SE, Hsieh CS, Murphy KM, O'Garra A. (1993) Dendritic cells and macrophages are required for Th1 development of CD4+ T cells from alpha beta TCR transgenic mice: IL-12 substitution for macrophages to stimulate IFN-gamma production is IFN-gamma-dependent. Int Immunol. 5(9):1119-28. Macatonia SE, Hosken NA, Litton M, Vieira P, Hsieh CS, Culpepper JA, Wysocka M, Trinchieri G, Murphy KM, O'Garra A. (1995) Dendritic cells produce IL-12 and direct the development of Th1 cells from naive CD4+ T cells. J Immunol. 154(10):5071-9. Maggi E, Parronchi P, Manetti R, Simonelli C, Piccinni MP, Rugiu FS, De Carli M, Ricci M, Romagnani S. (1992) Reciprocal regulatory effects of IFN-gamma and IL-4 on the in vitro development of human Th1 and Th2 clones. J Immunol. 148(7):2142-7. Magram J, Connaughton SE, Warrier RR, Carvajal DM, Wu CY, Ferrante J, Stewart C, Sarmiento U, Faherty DA, Gately MK. (1996) IL-12-deficient mice are defective in IFN gamma production and type 1 cytokine responses. Immunity. 4(5):471-81. Maldonado-Lopez R, De Smedt T, Michel P, Godfroid J, Pajak B, Heirman C, Thielemans K, Leo O, Urbain J, Moser M. (1999) CD8alpha+ and CD8alpha- subclasses of dendritic cells direct the development of distinct T helper cells in vivo. J Exp Med. 189(3):587-92. Manetti R, Parronchi P, Giudizi MG, Piccinni MP, Maggi E, Trinchieri G, Romagnani S. (1993) Natural killer cell stimulatory factor (interleukin 12 [IL-12]) induces T helper type 1 (Th1)-specific immune responses and inhibits the development of IL-4-producing Th cells. J Exp Med. 177(4):1199-204. Marie JC, Kehren J, Trescol-Biemont MC, Evlashev A, Valentin H, Walzer T, Tedone R, Loveland B, Nicolas JF, Rabourdin-Combe C, Horvat B. (2001) Mechanism of measles virus-induced suppression of inflammatory immune responses. Immunity. 14(1):69-79. Matzinger P (1998) An innate sense of danger. Semin Immunol. 10(5):399-415. McGuirk P, Mills KH. (2002) Pathogen-specific regulatory T cells provoke a shift in the Th1/Th2 paradigm in immunity to infectious diseases. Trends Immunol. 23(9):450-5. McKenzie GJ, Emson CL, Bell SE, Anderson S, Fallon P, Zurawski G, Murray R, Grencis R, McKenzie AN. (1998) Impaired development of Th2 cells in IL-13-deficient mice. Immunity. 9(3):423-32. McKnight AJ, Perez VL, Shea CM, Gray GS, Abbas AK. (1994) Costimulator dependence of lymphokine secretion by naive and activated CD4+ T lymphocytes from TCR transgenic mice. J Immunol. 152(11):5220-5. Meyers JH, Ryu A, Monney L, Nguyen K, Greenfield EA, Freeman GJ, Kuchroo VK (2002) Cutting edge: CD94/NKG2 is expressed on Th1 but not Th2 cells and costimulates Th1 effector functions. J Immunol. 169(10):5382-6. Miletic VD, Frank MM (1995) Complement-immunoglobulin interactions. Curr Opin Immunol. 7(1):41-7. Miletic VD, Hester CG, Frank MM (1996) Regulation of complement activity by immunoglobulin. I. Effect of immunoglobulin isotype on C4 uptake on antibody-sensitized sheep erythrocytes and solid phase immune complexes. J Immunol. 156(2):749-57. Miller RA. (1996) The aging immune system: primer and prospectus. Science. 273(5271):70-4. Mills KH (2004) Regulatory T cells: friend or foe in immunity to infection? Nat Rev Immunol. 4(11):841-55.

53

Minty A, Chalon P, Derocq JM, Dumont X, Guillemot JC, Kaghad M, Labit C, Leplatois P, Liauzun P, Miloux B, et al. (1993) Interleukin-13 is a new human lymphokine regulating inflammatory and immune responses. Nature. 362(6417):248-50. Monney L, Sabatos CA, Gaglia JL, Ryu A, Waldner H, Chernova T, Manning S, Greenfield EA, Coyle AJ, Sobel RA, Freeman GJ, Kuchroo VK (2002) Th1-specific cell surface protein Tim-3 regulates macrophage activation and severity of an autoimmune disease. Nature. 415(6871):536-41 Moore KW, de Waal Malefyt R, Coffman RL, O'Garra A. (2001) Interleukin-10 and the interleukin-10 receptor. Annu Rev Immunol. 19:683-765. Moser M, Murphy KM. (2000) Dendritic cell regulation of TH1-TH2 development. Nat Immunol. 1(3):199-205. Mosmann TR, Cherwinski H, Bond MW, Giedlin MA, Coffman RL. (1986) Two types of murine helper T cell clone. I. Definition according to profiles of lymphokine activities and secreted proteins. J Immunol. 136(7):2348-57. Mosmann TR, Coffman RL. (1989) TH1 and TH2 cells: different patterns of lymphokine secretion lead to different functional properties. Annu Rev Immunol. 7:145-73. Mullen AC, High FA, Hutchins AS, Lee HW, Villarino AV, Livingston DM, Kung AL, Cereb N, Yao TP, Yang SY, Reiner SL. (2001) Role of T-bet in commitment of TH1 cells before IL-12-dependent selection. Science. 292(5523):1907-10. Murata K, Ishii N, Takano H, Miura S, Ndhlovu LC, Nose M, Noda T, Sugamura K. (2000) Impairment of antigen-presenting cell function in mice lacking expression of OX40 ligand. J Exp Med. 191(2):365-74. Murphy KM, Reiner SL. (2002) The lineage decisions of helper T cells. Nat Rev Immunol. 2(12):933-44. Murphy E, Shibuya K, Hosken N, Openshaw P, Maino V, Davis K, Murphy K, O'Garra A. (1996) Reversibility of T helper 1 and 2 populations is lost after long-term stimulation. J Exp Med. 183(3):901-13. Murtaugh MP, Baarsch MJ, Zhou Y, Scamurra RW, Lin G (1996) Inflammatory cytokines in animal health and disease. Vet Immunol Immunopathol. 54(1-4):45-55. Nakajima A, Watanabe N, Yoshino S, Yagita H, Okumura K, Azuma M. (1997) Requirement of CD28-CD86 co-stimulation in the interaction between antigen-primed T helper type 2 and B cells. Int Immunol. 9(5):637-44. Nelms K, Keegan AD, Zamorano J, Ryan JJ, Paul WE (1999) The IL-4 receptor: signaling mechanisms and biologic functions. Annu Rev Immunol. 17:701-38. O'Garra A, Vieira PL, Vieira P, Goldfeld AE (2004) IL-10-producing and naturally occurring CD4+ Tregs: limiting collateral damage. J Clin Invest. 114(10):1372-8. Ohshima Y, Yang LP, Uchiyama T, Tanaka Y, Baum P, Sergerie M, Hermann P, Delespesse G (1998) OX40 costimulation enhances interleukin-4 (IL-4) expression at priming and promotes the differentiation of naive human CD4(+) T cells into high IL-4-producing effectors. Blood. 92(9):3338-45. Okamura H, Tsutsi H, Komatsu T, Yutsudo M, Hakura A, Tanimoto T, Torigoe K, Okura T, Nukada Y, Hattori K, et al.(1995) Cloning of a new cytokine that induces IFN-gamma production by T cells. Nature. 378(6552):88-91. Openshaw P, Murphy EE, Hosken NA, Maino V, Davis K, Murphy K, O'Garra A. (1995) Heterogeneity of intracellular cytokine synthesis at the single-cell level in polarized T helper 1 and T helper 2 populations. J Exp Med. 182(5):1357-67. Oppmann B, Lesley R, Blom B, Timans JC, Xu Y, Hunte B, Vega F, Yu N, Wang J, Singh K, Zonin F, Vaisberg E, Churakova T, Liu M, Gorman D, Wagner J, Zurawski S, Liu Y, Abrams JS, Moore KW, Rennick D, de Waal-Malefyt R, Hannum C, Bazan JF, Kastelein RA. (2000) Novel p19 protein engages IL-12p40 to form a cytokine, IL-23, with biological activities similar as well as distinct from IL-12. Immunity. 13(5):715-25.

54

O'Shea JJ, Paul WE. (2002) Regulation of T(H)1 differentiation--controlling the controllers. Nat Immunol. 3(6):506-8. Ouyang W, Lohning M, Gao Z, Assenmacher M, Ranganath S, Radbruch A, Murphy KM. (2000) Stat6-independent GATA-3 autoactivation directs IL-4-independent Th2 development and commitment. Immunity. 12(1):27-37. Ouyang W, Ranganath SH, Weindel K, Bhattacharya D, Murphy TL, Sha WC, Murphy KM. (1998) Inhibition of Th1 development mediated by GATA-3 through an IL-4-independent mechanism. Immunity. 9(5):745-55. Pai SY, Truitt ML, Ho IC (2004) GATA-3 deficiency abrogates the development and maintenance of T helper type 2 cells. Proc Natl Acad Sci U S A. 101(7):1993-8. Paliard X, de Waal Malefijt R, Yssel H, Blanchard D, Chretien I, Abrams J, de Vries J, Spits H. (1988) Simultaneous production of IL-2, IL-4, and IFN-gamma by activated human CD4+ and CD8+ T cell clones. J Immunol. 141(3):849-55. Parham C, Chirica M, Timans J, Vaisberg E, Travis M, Cheung J, Pflanz S, Zhang R, Singh KP, Vega F, To W, Wagner J, O'Farrell AM, McClanahan T, Zurawski S, Hannum C, Gorman D, Rennick DM, Kastelein RA, de Waal Malefyt R, Moore KW. (2002) A receptor for the heterodimeric cytokine IL-23 is composed of IL-12Rbeta1 and a novel cytokine receptor subunit, IL-23R. J Immunol. 168(11):5699-708. Parnet P, Garka KE, Bonnert TP, Dower SK, Sims JE (1996) IL-1Rrp is a novel receptor-like molecule similar to the type I interleukin-1 receptor and its homologues T1/ST2 and IL-1R AcP. J Biol Chem. 271(8):3967-70. Parronchi P, De Carli M, Manetti R, Simonelli C, Sampognaro S, Piccinni MP, Macchia D, Maggi E, Del Prete G, Romagnani S. (1992) IL-4 and IFN (alpha and gamma) exert opposite regulatory effects on the development of cytolytic potential by Th1 or Th2 human T cell clones. J Immunol. 149(9):2977-83. Pflanz S, Timans JC, Cheung J, Rosales R, Kanzler H, Gilbert J, Hibbert L, Churakova T, Travis M, Vaisberg E, Blumenschein WM, Mattson JD, Wagner JL, To W, Zurawski S, McClanahan TK, Gorman DM, Bazan JF, de Waal Malefyt R, Rennick D, Kastelein RA. (2002) IL-27, a heterodimeric cytokine composed of EBI3 and p28 protein, induces proliferation of naive CD4(+) T cells. Immunity. 16(6):779-90. Piccotti JR, Li K, Chan SY, Ferrante J, Magram J, Eichwald EJ, Bishop DK (1998) Alloantigen-reactive Th1 development in IL-12-deficient mice. J Immunol. 160(3):1132-8. Pisetsky DS (1999) The influence of base sequence on the immunostimulatory properties of DNA. Immunol Res. 19(1):35-46. Powrie F, Coffman RL. (1993) Cytokine regulation of T-cell function: potential for therapeutic intervention. Trends Pharmacol Sci. 14(5):164-8. Presky DH, Yang H, Minetti LJ, Chua AO, Nabavi N, Wu CY, Gately MK, Gubler U (1996) A functional interleukin 12 receptor complex is composed of two beta-type cytokine receptor subunits. Proc Natl Acad Sci U S A. 93(24):14002-7. Pulendran B, Smith JL, Caspary G, Brasel K, Pettit D, Maraskovsky E, Maliszewski CR. (1999) Distinct dendritic cell subsets differentially regulate the class of immune response in vivo. Proc Natl Acad Sci U S A. 96(3):1036-41. Punnonen J, Aversa G, Cocks BG, McKenzie AN, Menon S, Zurawski G, de Waal Malefyt R, de Vries JE. (1993) Interleukin 13 induces interleukin 4-independent IgG4 and IgE synthesis and CD23 expression by human B cells. Proc Natl Acad Sci U S A. 90(8):3730-4. Ramer-Quinn DS, Baker RA, Sanders VM (1997) Activated T helper 1 and T helper 2 cells differentially express the beta-2-adrenergic receptor: a mechanism for selective modulation of T helper 1 cell cytokine production. J Immunol. 159(10):4857-67. Ramirez F (1998) Glucocorticoids induce a Th2 response in vitro. Dev Immunol. 6(3-4):233-43.

55

Raymond CR, Wilkie BN (2004) Th-1/Th-2 type cytokine profiles of pig T-cells cultured with antigen-treated monocyte-derived dendritic cells. Vaccine. 22(8):1016-23. Read S, Malmstrom V, Powrie F. (2000) Cytotoxic T lymphocyte-associated antigen 4 plays an essential role in the function of CD25(+)CD4(+) regulatory cells that control intestinal inflammation. J Exp Med. 192(2):295-302. Reddy NR, Borgs P, Wilkie BN (2000) Cytokine mRNA expression in leukocytes of efferent lymph from stimulated lymph nodes in pigs. Vet Immunol Immunopathol. 74(1-2):31-46. Reiner SL, Locksley RM. (1995) The regulation of immunity to Leishmania major. Annu Rev Immunol. 13:151-77. Reiner SL, Seder RA. (1995) T helper cell differentiation in immune response. Curr Opin Immunol. 360-6. Reiner SL, Wang ZE, Hatam F, Scott P, Locksley RM. (1993) TH1 and TH2 cell antigen receptors in experimental leishmaniasis. Science. 259(5100):1457-60. Rengarajan J, Szabo SJ, Glimcher LH. (2000) Transcriptional regulation of Th1/Th2 polarization. Immunol Today. 21(10):479-83. Rincon M, Enslen H, Raingeaud J, Recht M, Zapton T, Su MS, Penix LA, Davis RJ, Flavell RA. (1998) Interferon-gamma expression by Th1 effector T cells mediated by the p38 MAP kinase signaling pathway. EMBO J. 17(10):2817-29. Rissoan MC, Soumelis V, Kadowaki N, Grouard G, Briere F, de Waal Malefyt R, Liu YJ. (1999) Reciprocal control of T helper cell and dendritic cell differentiation. Science. 283(5405):1183-6. Robertson KD, Wolffe AP. (2000) DNA methylation in health and disease. Nat Rev Genet. 1(1):11-9. Robinson DS, O'Garra A. (2002) Further checkpoints in Th1 development. Immunity. 16(6):755-8. Robinson D, Shibuya K, Mui A, Zonin F, Murphy E, Sana T, Hartley SB, Menon S, Kastelein R, Bazan F, O'Garra (1997) A. IGIF does not drive Th1 development but synergizes with IL-12 for interferon-gamma production and activates IRAK and NFkappaB. Immunity. 7(4):571-81. Rodriguez-Palmero M, Hara T, Thumbs A, Hunig T. (1999) Triggering of T cell proliferation through CD28 induces GATA-3 and promotes T helper type 2 differentiation in vitro and in vivo. Eur J Immunol. 29(12):3914-24. Rogge L, Barberis-Maino L, Biffi M, Passini N, Presky DH, Gubler U, Sinigaglia F. (1997) Selective expression of an interleukin-12 receptor component by human T helper 1 cells. J Exp Med. 185(5):825-31. Rogge L, D'Ambrosio D, Biffi M, Penna G, Minetti LJ, Presky DH, Adorini L, Sinigaglia F. (1998) The role of Stat4 in species-specific regulation of Th cell development by type I IFNs. J Immunol. 161(12):6567-74. Rogge L, Papi A, Presky DH, Biffi M, Minetti LJ, Miotto D, Agostini C, Semenzato G, Fabbri LM, Sinigaglia F (1999) Antibodies to the IL-12 receptor beta 2 chain mark human Th1 but not Th2 cells in vitro and in vivo. J Immunol. 162(7):3926-32. Romagnani S. (1994) Lymphokine production by human T cells in disease states. Annu Rev Immunol. 12:227-57. Romagnani S (2000) T-cell subsets (Th1 versus Th2). Ann Allergy Asthma Immunol.85(1):9-18. Roncarolo MG, Bacchetta R, Bordignon C, Narula S, Levings MK (2001) Type 1 T regulatory cells. Immunol Rev. 182:68-79. Ryan EJ, Daly LM, Mills KH. (2001) Immunomodulators and delivery systems for vaccination by mucosal routes. Trends Biotechnol. 19(8):293-304.

56

Sad S, Marcotte R, Mosmann TR. (1995) Cytokine-induced differentiation of precursor mouse CD8+ T cells into cytotoxic CD8+ T cells secreting Th1 or Th2 cytokines. Immunity. 2(3):271-9. Sallusto F, Lanzavecchia A, Mackay CR. (1998) Chemokines and chemokine receptors in T-cell priming and Th1/Th2-mediated responses. Immunol Today. 19(12):568-74. Salomon B, Bluestone JA. (1998) LFA-1 interaction with ICAM-1 and ICAM-2 regulates Th2 cytokine production. J Immunol. 161(10):5138-42. Sanders VM, Baker RA, Ramer-Quinn DS, Kasprowicz DJ, Fuchs BA, Street NE (1997) Differential expression of the beta2-adrenergic receptor by Th1 and Th2 clones: implications for cytokine production and B cell help. J Immunol. 158(9):4200-10. Schmitz J, Thiel A, Kuhn R, Rajewsky K, Muller W, Assenmacher M, Radbruch A. (1994) Induction of interleukin 4 (IL-4) expression in T helper (Th) cells is not dependent on IL-4 from non-Th cells. J Exp Med. 179(4):1349-53. Scott P. (1991) IFN-gamma modulates the early development of Th1 and Th2 responses in a murine model of cutaneous leishmaniasis. J Immunol. 147(9):3149-55. Seder RA, Paul WE. (1994) Acquisition of lymphokine-producing phenotype by CD4+ T cells. Annu Rev Immunol. 12:635-73. Seder RA, Gazzinelli R, Sher A, Paul WE. (1993) Interleukin 12 acts directly on CD4+ T cells to enhance priming for interferon gamma production and diminishes interleukin 4 inhibition of such priming. Proc Natl Acad Sci U S A. 90(21):10188-92. Seder RA, Paul WE, Davis MM, Fazekas de St Groth B. (1992) The presence of interleukin 4 during in vitro priming determines the lymphokine-producing potential of CD4+ T cells from T cell receptor transgenic mice. J Exp Med. 176(4):1091-8. Seo N, Tokura Y, Takigawa M, Egawa K (1999) Depletion of IL-10- and TGF-beta-producing regulatory gamma delta T cells by administering a daunomycin-conjugated specific monoclonal antibody in early tumor lesions augments the activity of CTLs and NK cells. J Immunol. 163(1):242-9. Shearer GM. (1997) Th1/Th2 changes in aging. Mech Ageing Dev. 94(1-3):1-5. Sher A, Coffman RL (1992) Regulation of immunity to parasites by T cells and T cell-derived cytokines. Annu Rev Immunol. 10:385-409. Shevach EM. (2000) Regulatory T cells in autoimmmunity. Annu Rev Immunol. 18:423-49. Shimoda K, van Deursen J, Sangster MY, Sarawar SR, Carson RT, Tripp RA, Chu C, Vignali DA, Doherty PC, Grosveld G, Paul WE, Ihle JN. (1996) Lack of IL-4-induced Th2 response and IgE class switching in mice with disrupted Stat6 gene. Nature. 380(6575):630-3. Shimizu T, Streilein JW (1994) Influence of alpha-melanocyte stimulating hormone on induction of contact hypersensitivity and tolerance. J Dermatol Sci. 8(3):187-93. Sierra-Honigmann MR, Murphy PA (1992) T cell receptor-independent immunosuppression induced by dexamethasone in murine T helper cells. J Clin Invest. 89(2):556-60. Singh VK, Mehrotra S, Agarwal SS (1999) The paradigm of Th1 and Th2 cytokines: its relevance to autoimmunity and allergy. Immunol Res. 20(2):147-61. Sinigaglia F, D'Ambrosio D, Panina-Bordignon P, Rogge L (1999) Regulation of the IL-12/IL-12R axis: a critical step in T-helper cell differentiation and effector function. Immunol Rev. 170:65-72. Skeen MJ, Miller MA, Ziegler HK (1996) Interleukin-12 as an adjuvant in the generation of protective immunity to an intracellular pathogen. Ann N Y Acad Sci. 795:416-9.

57

Smeltz RB, Chen J, Hu-Li J, Shevach EM (2001) Regulation of interleukin (IL)-18 receptor alpha chain expression on CD4(+) T cells during T helper (Th)1/Th2 differentiation. Critical downregulatory role of IL-4. J Exp Med. 194(2):143-53 Smith AL, Fazekas de St Groth B. (1999) Antigen-pulsed CD8alpha+ dendritic cells generate an immune response after subcutaneous injection withouthoming to the draining lymph node. J Exp Med. 189(3):593-8. Snapper CM, Mond JJ (1993) Towards a comprehensive view of immunoglobulin class switching. Immunol Today. 14(1):15-7. Snapper CM, Peschel C, Paul WE (1988) IFN-gamma stimulates IgG2a secretion by murine B cells stimulated with bacterial lipopolysaccharide. J Immunol. 140(7):2121-7. Sonoda KH, Faunce DE, Taniguchi M, Exley M, Balk S, Stein-Streilein J (2001) NK T cell-derived IL-10 is essential for the differentiation of antigen-specific T regulatory cells in systemic tolerance. J Immunol. 166(1):42-50. Sparwasser T, Koch ES, Vabulas RM, Heeg K, Lipford GB, Ellwart JW, Wagner H (1998) Bacterial DNA and immunostimulatory CpG oligonucleotides trigger maturation and activation of murine dendritic cells. Eur J Immunol. 28(6):2045-54. Spellberg B, Edwards JE Jr (2001) Type 1/Type 2 immunity in infectious diseases. Clin Infect Dis. 32(1):76-102. Stevens TL, Bossie A, Sanders VM, Fernandez-Botran R, Coffman RL, Mosmann TR, Vitetta ES (1988) Regulation of antibody isotype secretion by subsets of antigen-specific helper T cells. Nature. 334(6179):255-8 Stoll S, Jonuleit H, Schmitt E, Muller G, Yamauchi H, Kurimoto M, Knop J, Enk AH. (1998) Production of functional IL-18 by different subtypes of murine and human dendritic cells (DC): DC-derived IL-18 enhances IL-12-dependent Th1 development. Eur J Immunol. 28(10):3231-9. Suberville S, Bellocq A, Fouqueray B, Philippe C, Lantz O, Perez J, Baud L (1996) Regulation of interleukin-10 production by beta-adrenergic agonists. Eur J Immunol. 26(11):2601-5 Sutherland M, Blaser K, Pene J (1993) Effects of interleukin-4 and interferon-gamma on the secretion of IgG4 from human peripheral blood mononuclear cells. Allergy. 48(7):504-10. Swain SL, Weinberg AD, English M, Huston G. (1990) IL-4 directs the development of Th2-like helper effectors. J Immunol. 145(11):3796-806. Szabo SJ, Dighe AS, Gubler U, Murphy KM. (1997) Regulation of the interleukin (IL)-12R beta 2 subunit expression in developing T helper 1 (Th1) and Th2 cells. J Exp Med. 185(5):817-24. Szabo SJ, Jacobson NG, Dighe AS, Gubler U, Murphy KM.(1995) Developmental commitment to the Th2 lineage by extinction of IL-12 signaling. Immunity. 2(6):665-75. Szabo SJ, Kim ST, Costa GL, Zhang X, Fathman CG, Glimcher LH. (2000) A novel transcription factor, T-bet, directs Th1 lineage commitment. Cell. 100(6):655-69. Szabo SJ, Sullivan BM, Stemmann C, Satoskar AR, Sleckman BP, Glimcher LH (2002) Distinct effects of T-bet in TH1 lineage commitment and IFN-gamma production in CD4 and CD8 T cells. Science. 295(5553):338-42. Szekeres-Bartho J, Wegmann TG (1996) A progesterone-dependent immunomodulatory protein alters the Th1/Th2 balance. J Reprod Immunol. 31(1-2):81-95. Taga K, Mostowski H, Tosato G. (1993) Human interleukin-10 can directly inhibit T-cell growth. Blood. 81(11):2964-71. Takahashi T, Tagami T, Yamazaki S, Uede T, Shimizu J, Sakaguchi N, Mak TW, Sakaguchi S (2000) Immunologic self-tolerance maintained by CD25(+)CD4(+) regulatory T cells constitutively expressing cytotoxic T lymphocyte-associated antigen 4. J Exp Med. 192(2):303-10.

58

Takeda K, Tanaka T, Shi W, Matsumoto M, Minami M, Kashiwamura S, Nakanishi K, Yoshida N, Kishimoto T, Akira S. (1996) Essential role of Stat6 in IL-4 signalling. Nature. 380(6575):627-30. Takeda A, Hamano S, Yamanaka A, Hanada T, Ishibashi T, Mak TW, Yoshimura A, Yoshida H (2003) Cutting edge: role of IL-27/WSX-1 signaling for induction of T-bet through activation of STAT1 during initial Th1 commitment. J Immunol.;170(10):4886-90. Takemoto N, Kamogawa Y, Jun Lee H, Kurata H, Arai KI, O'Garra A, Arai N, Miyatake S. (2000) Cutting edge: chromatin remodeling at the IL-4/IL-13 intergenic regulatory region for Th2-specific cytokine gene cluster. J Immunol. 165(12):6687-91. Taoufik Y, Lantz O, Wallon C, Charles A, Dussaix E, Delfraissy JF. (1997) Human immunodeficiency virus gp120 inhibits interleukin-12 secretion by human monocytes: an indirect interleukin-10-mediated effect. Blood. 89(8):2842-8. Townsend MJ, Fallon PG, Matthews DJ, Jolin HE, McKenzie AN.J. (2000) TS1/ST2-deficient mice demonstrate the importance of T1/ST2 in developing primary T helper cell type 2 responses. J Exp Med. 191(6):1069-76. Trinchieri G. (1993) Interleukin-12 and its role in the generation of TH1 cells. Immunol Today. 14(7):335-8. Trinchieri G (2003) Interleukin-12 and the regulation of innate resistance and adaptive immunity. Nat Rev Immunol. 2003 Feb;3(2):133-46. Trinchieri G, Scott P (1999) Interleukin-12: basic principles and clinical applications. Curr Top Microbiol Immunol. 238:57-78. Usui T, Nishikomori R, Kitani A, Strober W (2003) GATA-3 suppresses Th1 development by downregulation of Stat4 and not through effects on IL-12Rbeta2 chain or T-bet. Immunity. 18(3):415-28. Van der Kleij D, Van Remoortere A, Schuitemaker JH, Kapsenberg ML, Deelder AM, Tielens AG, Hokke CH, Yazdanbakhsh M. (2002) Triggering of innate immune responses by schistosome egg glycolipids and their carbohydrate epitope GalNAc beta 1-4(Fuc alpha 1-2Fuc alpha 1-3)GlcNAc. J Infect Dis. 185(4):531-9. Vieira PL, Kalinski P, Wierenga EA, Kapsenberg ML, de Jong EC (1998) Glucocorticoids inhibit bioactive IL-12p70 production by in vitro-generated human dendritic cells without affecting their T cell stimulatory potential. J Immunol. 161(10):5245-51. Walsh PT, Taylor DK, Turka LA (2004) Tregs and transplantation tolerance. J Clin Invest. 114(10):1398-403. Wenner CA, Guler ML, Macatonia SE, O'Garra A, Murphy KM. (1996) Roles of IFN-gamma and IFN-alpha in IL-12-induced T helper cell-1 development. J Immunol. 156(4):1442-7. Wills-Karp M, Luyimbazi J, Xu X, Schofield B, Neben TY, Karp CL, Donaldson DD. (1998) Interleukin-13: central mediator of allergic asthma. Science. 282(5397):2258-61. Wood KJ, Sakaguchi S (2003) Regulatory T cells in transplantation tolerance. Nat Rev Immunol. 3(3):199-210. Wu CY, Demeure C, Kiniwa M, Gately M, Delespesse G. (1993) IL-12 induces the production of IFN-gamma by neonatal human CD4 T cells. J Immunol. 151(4):1938-49. Wu L, Li CL, Shortman K (1996) Thymic dendritic cell precursors: relationship to the T lymphocyte lineage and phenotype of the dendritic cell progeny. J Exp Med. 184(3):903-11. Xu D, Chan WL, Leung BP, Huang F, Wheeler R, Piedrafita D, Robinson JH, Liew FY. (1998b) Selective expression of a stable cell surface molecule on type 2 but not type 1 helper T cells. J Exp Med. 187(5):787-94. Xu D, Chan WL, Leung BP, Hunter D, Schulz K, Carter RW, McInnes IB, Robinson JH, Liew FY. (1998) Selective expression and functions of interleukin 18 receptor on T helper (Th) type 1 but not Th2 cells. J Exp Med. 188(8):1485-92.

59

Yamamoto S, Yamamoto T, Kataoka T, Kuramoto E, Yano O, Tokunaga T (1992) Unique palindromic sequences in synthetic oligonucleotides are required to induce IFN [correction of INF] and augment IFN-mediated [correction of INF] natural killer activity. J Immunol.148(12):4072-6. Yang J, Murphy TL, Ouyang W, Murphy KM. (1999) Induction of interferon-gamma production in Th1 CD4+ T cells: evidence for two distinct pathways for promoter activation. Eur J Immunol. 29(2):548-55. Yang J, Zhu H, Murphy TL, Ouyang W, Murphy KM. (2001) IL-18-stimulated GADD45 beta required in cytokine-induced, but not TCR-induced, IFN-gamma production. Nat Immunol. 2(2):157-64. Yates A, Callard R, Stark J (2004) Combining cytokine signalling with T-bet and GATA-3 regulation in Th1 and Th2 differentiation: a model for cellular decision-making. J Theor Biol. 231(2):181-96. Yoshida H, Hamano S, Senaldi G, Covey T, Faggioni R, Mu S, Xia M, Wakeham AC, Nishina H, Potter J, Saris CJ, Mak TW. (2001) WSX-1 is required for the initiation of Th1 responses and resistance to L. major infection. Immunity. 15(4):569-78. Yoshimoto T, Takeda K, Tanaka T, Ohkusu K, Kashiwamura S, Okamura H, Akira S, Nakanishi K (1998) IL-12 up-regulates IL-18 receptor expression on T cells, Th1 cells, and B cells: synergism with IL-18 for IFN-gamma production. J Immunol. 161(7):3400-7. Zheng W, Flavell RA. (1997) The transcription factor GATA-3 is necessary and sufficient for Th2 cytokine gene expression in CD4 T cells. Cell. 89(4):587-96. Zingoni A, Soto H, Hedrick JA, Stoppacciaro A, Storlazzi CT, Sinigaglia F, D'Ambrosio D, O'Garra A, Robinson D, Rocchi M, Santoni A, Zlotnik A, Napolitano M. (1998) The chemokine receptor CCR8 is preferentially expressed in Th2 but not Th1 cells. J Immunol. 161(2):547-51. Zuckermann FA, Husmann RJ, Schwartz R, Brandt J, Mateu de Antonio E, Martin S (1998) Interleukin-12 enhances the virus-specific interferon gamma response of pigs to an inactivated pseudorabies virus vaccine. Vet Immunol Immunopathol. 63(1-2):57-67

Aims of the study

60

AIMS OF THE STUDY

Cytokines are the major controlling signals in both acute and chronic inflammation

and in regulating/modulating the innate and acquired immunity. A reliable quantitative

method for measuring cytokine production is important in investigating the relationship

between these cytokines and the immune responses induced by pathogens. The first aim of

this study was therefore to design, optimise and validate techniques for measuring cytokine

gene expression in pigs.

Early vaccination is necessary to protect pigs against postweaning diarrhoea caused by

enterotoxigenic Escherichia coli (ETEC). However, at present no commercial vaccine allows

successful vaccination which is partly due to the presence of maternally derived antibodies.

Since DNA vaccines are suggested to be superior to protein vaccines in young animals with

maternal antibodies, the second aim of the present study was therefore to determined wether

the fimbrial adhesin (FaeG) of F4ac+ ETEC could be used as a plasmid DNA vaccine in pigs.

Moreover, since little is known about porcine cytokine responses following DNA vaccination,

we used our newly developed RT-PCR technique to determine cytokine profiles generated by

this DNA vaccine and to obtain informaton on the possible role of immunogenic CpG motifs

in such a vaccine.

In particular, the following questions were addressed :

- Is there a good correlation between the amount of cytokine mRNA determined by RT-

PCR and the amount of secreted cytokines quantified by ELISA or bioassay?

- Are the newly designed competitive RT-PCR technique using homologous DNA

competitors and the LightCycler RT-PCR assay as accurate for quantifying cytokine

transcripts in pigs?

- Can we use a newly constructed FaeG DNA vaccine (pcDNA1/faeG19) to induce B-

cell and CTL priming in 6-weeks-old pigs in a heterologous prime-boost approach?

- What type of cytokine response can we expect after intramuscular DNA vaccination in

pigs?

Aims of the study

61

- In view of improving the efficacy of DNA vaccines in pigs, is it possible that the

nature and the amount of certain CpG motifs present on plasmid DNA might have an

effect on their immunostimulatory capacity in pigs?

Chapter 4 : Comparative analysis of mRNA and protein detection

62

Chapter 4

COMPARATIVE ANALYSIS OF

PORCINE CYTOKINE PRODUCTION BY

mRNA AND PROTEIN DETECTION1

1 Based on : Verfaillie T, Cox E, To LT, Vanrompay D, Bouchaut H, Buys N, Goddeeris BM (2001) Comparative analysis of porcine cytokine production by mRNA and protein detection. Vet Immunol Immunopathol. 81(1-2):97-112.

Chapter 4 : Comparative analysis of mRNA and protein detection

63

ABSTRACT

To analyse the correlation between cytokine mRNA transcription and

secretion, IL-10 and IFN-γ were quantified by enzyme-linked immunosorbent assay

and IL-2 by bioassay and compared with their mRNA levels, determined by reverse

transcription polymerase chain reaction (RT-PCR). For this purpose, peripheral blood

monomorphonuclear cells (PBMC) were stimulated in vitro with the lectins pokeweed

mitogen (PWM), phytohemagglutinin (PHA) and concanavalin A (ConA)

respectively, and with F4 fimbriae in an antigen-specific assay. Analyses were

performed 4, 8, 16, 24 and 48 hours after stimulation on the stimulated PBMC for

mRNA and on the respective culture supernatants for proteins. RT-PCR products

were quantified by densitometric scanning of the electrophoresis bands and related to

the band intensity of the housekeeping gene, cyclophilin. Low levels of IL-2, IL-4 and

IFN-γ mRNA were detected in unstimulated PBMC. Stimulation with all three

mitogens (PWM, ConA, PHA) led to an increase in mRNA transcription. In contrast,

substantial IL-10 mRNA levels were detected in both unstimulated and stimulated

cells with practically no difference between the three mitogens used. IL-2 mRNA

expression tended to peak after 8-16 hours for all three mitogens. The cells stimulated

with PWM and ConA showed higher levels of gene expression for IFN-γ and lower

for IL-4 then the cells stimulated with PHA, however differences were not statistically

significant. For cells stimulated with F4 fimbriae only the IFN-γ mRNA expression

increased with an early peak at 8 hours post-stimulation. The analysis of the culture

supernatants for secreted cytokines revealed a correlation between the levels of

mRNA transcription and the respective secreted cytokines during the first 24 hours of

stimulation. After 24 hours of stimulation however, a decrease in IFN-γ and IL-2

mRNA levels was accompanied by an increase or a less pronounced decrease in

cytokine concentration ; only the ConA induced IL-2 mRNA and protein

concentration slopes showed similar profiles. In conclusion, similar cytokine

production profiles as defined by mRNA and protein, respectively are obtained only

during the first 24 hours after stimulation of the cell cultures

Keywords : pig, cytokines, mitogens, RT-PCR

Chapter 4 : Comparative analysis of mRNA and protein detection

64

1. INTRODUCTION

Information about the role of cytokines in immunoregulation and modulation

has been largely obtained from the study of mice immunized or infected with a variety

of infectious agents (Urban et al, 1992). These studies have led to the identification of

functionally distinct CD4+ T helper subpopulations (termed Th-1 and Th-2),

producing distinct patterns of cytokines and has provided important insights into the

mechanisms by which polarized immune responses occur in vivo in response to

several pathogens (Mosmann et al, 1986). Indeed, Th-1 cells produce mainly

interleukin-2 (IL-2) and interferon-gamma (IFN-γ). Th-2 cells produce IL-4, IL-5, IL-

6 and IL-10, cytokines with a key role in promoting IgA antibody expression. In this

regard, T cells isolated from mucosal lymphoid tissue are heavily geared towards Th-

2 responses (Xu-Amano et al, 1994). Similar data have also been found in man

(Romagnani, 1991). In this respect, determining cytokine profiles in different animal

species during the course of infection or following oral administration of antigen

would give important information on immunostimulatory and immunosuppressive

mechanisms.

In human and mouse studies, the reverse transcription polymerase chain

reaction (RT-PCR) is used extensively to assay cytokine mRNA transcription. This

technique is characterised by its sensitivity, relative rapid assessment, the small

amount of cells required and the simultaneous analysis of many cytokines.

Furthermore it gives the flexibility of assaying in vitro or in vivo heterogeneous or

homogeneous cell populations. As several of the genes encoding porcine cytokines

have been cloned, RT-PCR can be used for quantifying swine cytokine gene

expression (Dozois et al, 1997).

Utilizing a semi-quantitative RT-PCR technique for the quantification of

cytokine mRNA (IL-2, IFN-γ (Th1-like) and IL-4, IL-10 (Th2-like)) and immuno- or

bioassays for the quantification of secreted cytokines, mitogen- or antigen-induced

production of porcine cytokines in peripheral blood monomorphonuclear cells

(PBMC) was investigated. As the production of a cytokine is highly dependent of the

time after stimulation, we defined the time kinetic profiles of cytokine production

induced by different lectins by immuno- or bioassays (secreted cytokines) and

correlated these with their respective levels of mRNA transcription. The mitogens

Chapter 4 : Comparative analysis of mRNA and protein detection

65

used include the lectins phytohemagglutinin (PHA), concanavalin A (ConA) and

pokeweed mitogen (PWM). In both humans and mice, PHA and ConA are

predominantly T cell mitogens whereas PWM stimulates both T en B lymphocytes.

As opposed to this polyclonal stimulation, antigen-specific stimulation of the PBMC

was also performed using purified fimbriae from F4+ enterotoxigenic E. coli.

2. MATERIALS AND METHODES

2.1. Isolation of PBMC and culture conditions

Blood was taken from healthy conventionally reared, 2- to 4-month old F4

seropositive pigs (Belgian Landrace). Pigs were anaesthetised with Nembutal® (Sanofi

Benelux, Brussels) and 400 ml of fresh blood was aseptically collected directly from

the heart into tubes containing Alsever’s solution (50% vol/vol)(Gibco BRL, Life

technologies, Merelbeke, Belgium) whereafter the pigs were euthanised. PBMC were

isolated by density gradient centrifugation using Lymphoprep® (NYCOMED pharma

AS, Life Technologies, Merelbeke, Belgium). The PBMC from each animal were

suspended at a concentration of 5x106 cells/ml in leukocyte medium (RPMI-1640

(Gibco), fetal bovine serum (FBS)(10%)(Gibco), sodium pyruvate (1 mM)(Gibco), L-

glutamine (2 mM)(Gibco), kanamycin (100 µg/ml)(Gibco), gentamycin (50

µg/ml)(Gibco) and 2-mercapto-ethanol (5.10-5M)). Subsequently, the wells of 24-well

tissue culture plates were filled with 2 ml of the cell suspension, supplemented with or

without mitogen or purified F4 fimbriae. The mitogens used were PWM (Sigma,

Bornem, Belgium), ConA (Sigma) and PHA (Sigma) each at a final concentration of

5 µg/ml. F4 fimbriae were purified as described elsewhere (Van den Broeck et al,

1999) and used at a concentration of 2.5 µg/ml. Cultures were maintained at 37°C in

a humidified atmosphere of 5% CO2. Cells and supernatants were collected 4, 8, 16,

24 and 48 hours after stimulation.

2.2. RNA extraction

Harvested cells were washed in ice cold PBS and the RNA extraction was

performed using the RNAgents® Total RNA Isolation System following the

Chapter 4 : Comparative analysis of mRNA and protein detection

66

manufacturer’s manual (Promega, Leiden, the Netherlands). The extracted RNA was

resuspended in 100 µl of ultra-pure water containing 0.02% (w/vol) diethyl

pyrocarbonate (Sigma, Bornem, Belgium). Total RNA was quantified by using a

spectrophotometer at 260 nm and purity was assessed by determining the O.D. ratio

260/280 nm. All samples had ratios above 1.7.

2.3. Reverse transcription of porcine mRNA into cDNA

Reverse transcription and PCR were performed in a GENIUS (Techne,

Cambridge) thermocycler using 0.2 ml thin-walled tubes (Novolab, Geraardsbergen,

Belgium). Reverse transcription of RNA into cDNA was performed in a 20 µl total

volume containing: (1) 1 µg of sample RNA ; (2) 20 pmol of anti-sense primer ; (3)

0.5 mM deoxynucleotide triphosphate (dNTP) mix of the four dNTPs (Roche

Diagnostics, Brussel, Belgium) ; (4) 1 x reverse transcriptase buffer (50 mM Tris-

HCl, pH 8.3, 50 mM KCl, 10 mM MgCl2, 0.5 mM spermidine, 10 mM DTT

)(Promega, Leiden, the Netherlands) ; (5) 2.5 U AMV reverse transcriptase (Promega)

and (6) 10 U of RNAsin® ribonuclease inhibitor (Promega). Briefly, template RNA

and anti-sense primers were incubated at 80°C for 3 min and then placed on ice for 3

minutes. Subsequently, all other components were added and the samples were

incubated at 42°C for 45 minutes. The enzymes were deactivated by heating at 95°C

for 5 min and the RT-mix was then quickly chilled on ice.

2.4. Oligonucleotide primers

The oligonucleotide primers used for the detection of cDNA specific for

porcine interleukin(IL)-2, IL-4, IL-10, interferon-γ were designed from the published

nucleic acid sequences available from GenBank/EMBL databases (Table 1).

Cyclophilin, a constitutively expressed 'housekeeping' gene, was used as a control for

the uniformity of the reverse transcription reaction and as a reference for

quantification of cytokine mRNA (Dozois et al,1997).

Chapter 4 : Comparative analysis of mRNA and protein detection

67

Table 1 : Oligonucleotide primers to amplify porcine cytokine- and cyclophilin- cDNA (S = sense primer, AS = anti-sense primer). Gene specificity oligonucleotide sequences (5’-3’)

Gene sequence

Accession number

IL-2

(S)GGCAAACGGTGCACCTACTTCAAG (AS)GCACTCCCTCCAGAGCTTTGAG

X56750

IL-4

(S)GTCTCACATCGTCAGTGC (AS)TCATGCACAGAACAGGTC

X68330

IL-10

(S)CCATGCCCAGCTCAGCACTG (AS)CCCATCACTCTCTGCCTTCGG

L20001

IFN-γ

(S)TGTACCTAATGGTGGACCTC (AS)TCTCTGGCCTTGGAACATAG

X53085

Cyclophilin

(S)TAACCCCACCGTCTTCTT (AS)TGCCATCCAACCACTCAG

F14571

2.5. PCR amplification of porcine cytokine cDNA and primer specificity

PCR was performed as previously described (Wynn et al, 1993) with slight

modifications. Briefly, the PCR mixtures for amplification of cDNA were performed

in a 100 µl total volume containing (1) 0.25 mM dNTP mix (Boehringher Mannheim)

; (2) 1x PCR buffer (10 mM Tris-HCl, pH 9.0 ; 50 mM KCl ; 0.1 % Triton X-

100)(Promega) ; (3) 0.75 mM (IL-2, IFN-γ, cyclophilin) or 1.5 mM (IL-4, IL-10)

MgCl2 ; (4) 40 pmol of sense and anti-sense primers ; (5) 2.5 U Tag DNA polymerase

(Promega) and (6) 20 µl of the reverse transcribed sample containing template cDNA.

After heating the samples at 95°C for 2 min as a hot start, the temperature cycling

consisted of denaturation at 95°C for 30 s, annealing for 60 s and extension at 72°C

for 45 s with a final extension at 72°C for 7 minutes. Optimal annealing temperatures

and number of cycles had to be determined for each of the cytokines (see results). An

aliquot of each PCR reaction sample was migrated in 2% TAE agarose gels. Gels

were stained with ethidium bromide and photographed using an ImageMaster VDS

(Amersham Pharmacia Biotech, Uppsala, Sweden). The PCR products were

sequenced to confirm the specificity of the oligonucleotide primers .

Chapter 4 : Comparative analysis of mRNA and protein detection

68

2.6. Densitometry of PCR products

To quantify the level of each of the PCR products, the gels were scanned using an

ImageMaster VDS (Amersham Pharmacia Biotech) and the density of bands was

determined using the ImageMaster 1D prime software (Amersham Pharmacia

Biotech). To compare the relative mRNA expression levels from each of the samples,

the values are presented as the ratio of the band intensities of the cytokine RT-PCR

product over the corresponding cyclophilin RT-PCR product.

2.7. Competitive ELISA for porcine IFN-γ

A competitive ELISA, developed in the Laboratory for Physiology and

Immunology, KULeuven (Vanderpooten and Goddeeris) was used to detect porcine

IFN-γ. Briefly, the wells of a microtitre plate were coated overnight at 37°C with

recombinant porcine IFN-γ (rIFN−γ)(1 µg/ml, 50 µl /well)(Vandenbroeck et al, 1991)

in TBS coating solution (50 mM Tris/HCl, 154 mM NaCl, pH 8.5). Then free binding

sites were blocked for at least 30 minutes at room temperature with TBS containing

5% glycine. Meanwhile test samples (culture supernatant) or rIFN-γ which was used

as a standard (diluted in assaybuffer : 0.5% BSA and 0.05% Tween® 20 in TBS, pH

7.5) were preincubated for 15 min at room temperature in a separate plate, 1:1 diluted

with monoclonal antibodies (B12/6)(Kontsek P. et al, 1997)(MAb) against porcine

IFN-γ. After washing the coated plate four times with PBS-Tween® 20 (0.05 %), 100

µl/well of this mixture was added to the plate and incubated for 1-1.5 h at 37°C. After

washing, 100 µl POD-anti-mouse IgG conjugate (1/2000 diluted in

assaybuffer)(Prosan, Merelbeke, Belgium) was added to each well and incubated for 1

hour at 37°C. Finally, 100 µl substrate-chromogen solution (0.1 M citric acid, 0.2 M

Na2HPO4 buffer, pH 4.3 containing 0.013 % 3,3’,5,5’tetramethylbenzidine (TMB)

and 0.0044 % H2O2) was brought into the wells. The colour reaction was stopped after

10 minutes with 50 µl of 2 M sulphuric acid per well. The absorbances were measured

at 450 nm and the values for each standard were plotted against the concentration to

produce a standard curve. The concentration of the target samples can be extrapolated

from this curve.

Chapter 4 : Comparative analysis of mRNA and protein detection

69

2.8. Measurement of the IL-2 activity

Interleukin-2 activity was measured in a bioassay using a murine IL-2

dependent CTLL-2 cell line. These cells were used 3 to 4 days after stimulation with

recombinant human IL-2 (rhIL-2)(Genzyme). One hundred µl of washed cells at a

concentration of 5.104 cells/ml were transferred into the wells of a 96 well plate.

Subsequently, 100 µl sample supernatant or standard (rhIL-2) was added to the wells

in duplicate and after 24 hours at 37°C and 5% CO2 , 1 µCi 3H-thymidine was added.

After a further incubation of 4 hours, cells were harvested onto glassfiber filters and

the amount of incorporated 3H-thymidine was measured in a β-scintillation counter

(Beckman, Fullerton, California). Values for each standard (counts per minute) were

plotted against the logarithm of the units rhIL-2 added to produce a standard curve.

The amount of target in the samples can be extrapolated from this standard curve. One

unit of IL-2 bio-activity is the amount required to support half maximum proliferation

of CTLL-2 cells and approximates one Biological Response Modifiers Program

(BRMP) unit established as a standard by the National Institute of Health (NIH).

2.9. Measurement of IL-10 in supernatant

The quantity of IL-10 in the supernatant was measured using a commercially

available ELISA kit specific for porcine IL-10 (Biosource, Nivelles, Belgium).

Briefly, sample supernatant (100 µl) was brought into a 96-well plate coated with a

MAb against porcine IL-10. Then, a horse-radish peroxidase (HRP) labeled-anti-

porcine IL-10 conjugate (100 µl) was added and incubated for 3 h at room

temperature on a horizontal shaker at 700 rpm. After washing, 200 µl substrate-

chromogen solution (TMB) was added to each well and incubated at room

temperature while continuous shaking. After 30 minutes, the reaction was stopped

with 50 µl of 2 M H2SO4 per well and the absorbances were read at 450 nm. Values

for each standard were plotted against the concentration to produce a standard curve.

The concentrations of target in the samples can be extrapolated from this curve.

Chapter 4 : Comparative analysis of mRNA and protein detection

70

2.10. Statistical analysis

The results are presented as mean + SEM. The relationship between the results

obtained by RT-PCR or bio-/immunassay over time was tested for statistical

significance using a “mixed effect ANOVA model” (General Linear Model,

Univariate). Hereby the following formula was used :

Yijk = µ + Pi + Mj + (PM)ij + Tk + (MT)jk

(P = pig, i = 1,…,3 ; M = method, j = 1,2 ; T = time, k = 1,…,5).

The interaction (MT)jk is statistically significant if P < 0.05 which indicates that

significant differences are observed between both methods.

Differences in cytokine/cyclophilin ratios between the 3 mitogens used were

tested for statistical significance using General Linear Model (Repeated Measures

Analysis of variance). The significance level was set at 5%.

3. RESULTS

3.1. RT-PCR amplification of porcine cytokine mRNA transcripts and primer

specificity

Preliminary studies were performed to optimize RT-PCR conditions for

amplification of the cytokine mRNAs and cyclophilin mRNA. Optimal annealing

temperatures and number of cycles for each of the cytokines are represented in table

2.

Table 2 : Expected PCR fragment size and number of PCR cycles used for amplification of the porcine cytokine- and cyclophilin-cDNA.

Gene specificity Annealing temperature (C°) of

primer set

cDNA PCR product (bp)

number of PCR cycles

IL-2 50 217 30 IL-4 55 359 38 IL-10 60 295 33 IFN-γ 50 357 33

Cyclophilin 50 366 30

Chapter 4 : Comparative analysis of mRNA and protein detection

71

It was first verified if the chosen primer pairs specifically amplified the desired

cytokine and cyclophilin cDNA sequences by testing them for PCR amplification. As

shown in Figure 1, each of the primer sets amplified a single sharp band of the

expected size and non-specific contaminants were not visualized after electrophoresis

and ethidium bromide staining of the agarose gel. The specificity of the bands was

further confirmed by sequence analysis.

600

500

400

300

200

100

Cyclo IL-2 IL-4 IL-10 IFN-γ Μ

600

500

400

300

200

100

Cyclo IL-2 IL-4 IL-10 IFN-γ Μ

600

500

400

300

200

100

Cyclo IL-2 IL-4 IL-10 IFN-γ ΜCyclo IL-2 IL-4 IL-10 IFN-γ Μ

Figure 1 : Specificity of oligonucleotide primers for RT-PCR amplification of porcine cytokine- and cyclophilin-cDNA. Total RNA was extracted from PWM-stimulated PBMC, reverse transcribed and amplified by PCR. PCR products were migrated in a 2 % TAE-agarose gel and stained with ethidium bromide. For reference, corresponding bp sizes of a 100 bp DNA ladder are shown on the right (M).

To verify that the amplification conditions for each of the primer sets were non

saturated and could be used for semi-quantitative analysis of PCR products, two-fold

dilutions of sample cDNA were amplified using each of the specific primer sets. The

density of the bands was scanned and a regression curve was made. For cyclophilin

and IL-2 (Fig.2), the band intensity of the PCR products decreased with each dilution

thereby showing that the detection was in the linear range of amplification. Similar

results were obtained for the other cytokines (data not shown).

Chapter 4 : Comparative analysis of mRNA and protein detection

72

1 1/2 1/4 1/8 1/16

Cyclophilin

IL-2

1 1/2 1/4 1/8 1/16

Cyclophilin

IL-2

Figure 2 : Analysis of cyclophilin (top) and IL-2 (bottom) dilution series by RT-PCR. Serial two-fold dilutions of total RNA from PWM-stimulated PBMC were amplified and migrated in 2% TAE-agarose gel. Dilution titers are indicated within the figure. Regression curve for cyclophilin (r2 = 0,998) and IL-2 (r2 = 0,959) after measuring the density of the bands.

Chapter 4 : Comparative analysis of mRNA and protein detection

73

Figure 3 : Kinetics of Th1-like (IL-2, IFN-γ) and Th2-like (IL-4, IL-10) cytokine mRNA expression in PBMC following in vitro stimulation with pokeweed mitogen (♦) -, concanavalin A (■)- or phytohemagglutinin (▲)-stimulation or no stimulation ( × ). The results are the mean of 3 pigs + SEM. They are presented as the ratio of the cytokine RT-PCR band intensity over the respective cyclophilin RT-PCR band intensity.

IL-2

0

0,2

0,4

0,6

0,8

1

1,2

0 8 16 24 32 40 48

IL-4

0

0,2

0,4

0,6

0,8

1

1,2

0 8 16 24 32 40 48

IL-10

0

0,2

0,4

0,6

0,8

1

1,2

0 8 16 24 32 40 48

IFN-gamma

0

0,2

0,4

0,6

0,8

1

1,2

0 8 16 24 32 40 48

Time post-stimulation (h)

Rat

io c

ytok

ine/

cycl

ophi

lin

Chapter 4 : Comparative analysis of mRNA and protein detection

74

Figure 4 : Kinetics of Th1-like (IL-2, IFN-γ) and Th2-like (IL-4, IL-10) cytokine mRNA expression in PBMC following in vitro stimulation with F4 fimbriae (⎯Ο ) or no stimulation (---×). The results are the mean of 3 pigs + SEM. They are presented as the ratio of the cytokine RT-PCR band intensity over the respective cyclophilin RT-PCR band intensity.

Time post-stimulation (h)

Rat

io c

ytok

ine/

cycl

ophi

lin

IL-2

0

0,2

0,4

0,6

0,8

1

1,2

0 8 16 24 32 40 48

IFN-gamma

0

0,2

0,4

0,6

0,8

1

1,2

0 8 16 24 32 40 48

IL-10

0

0,2

0,4

0,6

0,8

1

1,2

0 8 16 24 32 40 48

IL-4

0

0,2

0,4

0,6

0,8

1

1,2

0 8 16 24 32 40 48

Chapter 4 : Comparative analysis of mRNA and protein detection

75

3.2. Kinetics of porcine cytokine gene expression

Unstimulated, mitogen- (PWM, ConA and PHA) and F4 fimbriae-stimulated

PBMC from 3 F4 seropositive pigs were cultured during 4 to 48 hours and the

kinetics of the cytokine mRNA expression were determined. Figure 3 and 4 illustrate

the relative expression (versus cyclophilin) of the 4 different cytokines over time in

unstimulated and mitogen- or F4 fimbriae-stimulated PBMC. Values obtained for

each of the cytokine-specific PCR reactions were normalized against the cyclophilin

bands to compensate for the variation between samples. Already 4 hours post-

stimulation with PWM, ConA and PHA an increase of mRNA expression for IL-2,

IL-4 and IFN-γ could be observed as compared to their expressions in unstimulated

cells (Fig.3). These 3 cytokines showed an early peak at 8 to 16 hours post-mitogen-

stimulation for all three mitogens. Stimulation with F4 fimbriae (Fig.4) shows only a

weak increase in IFN-γ mRNA expression with a peak at 8 hours post-stimulation. In

contrast, substantial mRNA levels of IL-10 were detected in stimulated as well as

unstimulated cells without significant differences (Fig. 5). All three mitogens gave a

good IL-2 stimulation that lasted for 48 hours post-stimulation. The cells stimulated

with PWM and ConA demonstrated higher levels of gene expression for IFN-γ and

lower for IL-4 then the cells stimulated with PHA, however differences were not

statistically significant.

3.3. Kinetics of cytokine secretion

In order to examine whether cytokine mRNA expression was associated with

the secretion of the respective proteins, the cell culture supernatant was collected at

the same timepoints that mRNA was determined. Although measurement of IL-10 by

ELISA seemed to correlate with measurement by RT-PCR, statistical analysis did not

confirm (Fig. 5). For IL-2 and IFN-γ, the kinetic profiles of the curves show a similar

tendency as the mRNA profiles (Fig.6). For both IL-2 and IFN-γ the same early peak

was seen around 16 hours post stimulation. However, the distribution pattern for IL-2

shows a clearly higher peak of secreted IL-2 following stimulation with ConA than

with PWM or PHA. after stimulation.

Chapter 4 : Comparative analysis of mRNA and protein detection

76

Figu

re 5

: K

inet

ics o

f IL-

10 m

RN

A e

xpre

ssio

n (−

) in

com

paris

on w

ith se

cret

ed IL

-10

(…) i

n PB

MC

follo

win

g in

vitr

o st

imul

atio

n w

ith P

WM

, Con

A, P

HA

, F4

or n

o st

imul

atio

n. T

he re

sults

are

the

mea

n of

3 p

igs +

SEM

.

Chapter 4 : Comparative analysis of mRNA and protein detection

77

Figu

re 6

: K

inet

ics

of IF

N-γ

and

IL-2

mR

NA

exp

ress

ion

(⎯) i

n co

mpa

rison

with

sec

rete

d IF

N-γ

and

IL-2

( …

). T

he re

sults

(m

ean

of 3

pig

s +

SEM

) ar

e ex

pres

sed

as th

e ne

t am

ount

(va

lues

obt

aine

d af

ter

stim

ulat

ion

– va

lues

obt

aine

d fr

om n

on s

timul

ated

cel

ls)

of I

L-2

or I

FN-γ

due

to s

timul

atio

n w

ith P

WM

, Con

A, P

HA

or F

4.

Chapter 4 : Comparative analysis of mRNA and protein detection

78

IFN-γ shows similar profiles of secretion for the three lectins with a peak

between 8 and 16 hours after stimulation followed by a drop 24 hours This drop in

IFN-γ, however, was not to base levels for PWM as it was for ConA and to a lesser

degree for PHA. Statistically, similarity was observed for IL-2 between the RT-PCR

and bioassay results in contrast to IFN-γ, where significant differences were present

(P<0,05).

For the cells stimulated with F4 fimbriae the results of the immuno- and bio-

assays are comparable to those of the RT-PCR technique with the difference that the

small peak seen for IFN-γ mRNA at 8 hours seems to be absent in the protein

measurement (Fig.6).

4. DISCUSSION

This study assessed the cytokine profiles of PBMC induced by 3 different

mitogens at the mRNA level as well as at the protein level. For all three mitogens,

stimulation increased the IL-2, IL-4 and IFN-γ mRNA expression compared to the

mRNA expression in unstimulated cells. Conversely, for IL-10 substantial levels were

detected in both stimulated and unstimulated cells. The latter is in agreement with

data in bovine (Covert and Splitter, 1995) and porcine (Dozois et al, 1997) cells

stimulated with certain mitogens.

The differences in cytokine levels for a given mitogen could be due to the

activation of different cell subsets since the spectrum of target cells is somewhat

different for each mitogen. In humans and mice, PHA and ConA are predominantly T

cell mitogens whereas PWM stimulates both B- and T-cells. In pigs, the target

lymphocyte populations have not yet been identified but species differences have

been reported. Besides differences in the spectrum of target cells, differences in the

activation mechanism used could account for differences in cytokine levels. Although

the exact mechanisms of mitogenicity are unclear, several studies support the concept

that the CD3/TCR complex is involved in the transmission of the activation signals

(Weiss et al, 1987 ; Kanellopoulos et al, 1985). However, CD3 blocking studies

showed that PHA and high doses of PWM may also trigger T cells to proliferate via

an alternative pathway that does not involve participation of the CD3/TCR complex

Chapter 4 : Comparative analysis of mRNA and protein detection

79

(Gerosa et al, 1986 ; Ceuppens et al, 1986), possibly by a CD2-mediated pathway

using IL-1 and IL-6 as accessory signals (Lorre et al., 1990).

Since the method used to isolate the PBMC can not exclude other cell types

besides T cells and because IL-10 is not only produced by T cells but also by

macrophages and CD5+ B cells (Mosmann, 1994), IL-10 should be considered here as

a “Th2-like” cytokine rather than as a marker of the Th2 lymphocyte subtype.

The data on IFN-γ and to a lower extend on IL-2, showed a good correlation between

the mRNA expression and secreted proteins during the first 24 hours of stimulation.

Thereafter, an increase in secreted cytokines was observed as opposed to a status quo

or decline in the mRNA expression indicating a lower consumption of the cytokines

produced. Indeed, it could be that there is a saturation of the receptor binding sites or

a lower expression of the cytokine receptors resulting in an accumulation of secreted

cytokines in the culture supernatants and thus higher levels detected.

Although the RT-PCR assay, developed in this study, is a fast, sensitive and

specific method to assay cytokine profiles during an immune response there are some

limitations. Firstly, this RT-PCR only allows for the relative quantification of

cytokine mRNA levels and not the absolute quantification nor does it allow a

quantitative comparison between the mRNA of different cytokines. Therefore future

efforts are directed towards the development of a quantitative-competitive RT-PCR

(qc RT-PCR) using internal standards and “on-line” PCR which allow accurate real

time quantification. Secondly, relative mRNA levels determined by RT-PCR do not

necessarily reflect the relative amounts of protein produced. Although a controversy

exists as to whether the induction of cytokine production is mediated at the

transcription level, Brorson et al (1991) have shown that most cytokines are

transcriptionally regulated, expression correlating directly with protein levels.

Sometimes the differences observed could be explained by the test system used. For

the commonly used protein assays such as bioassays, ELISA and RIA the net amount

of a secreted cytokine is measured after consumption and degradation has taken

place in the in vitro culture. In general, released cytokines interact with their target

cells, resulting in short lifetimes of the circulating proteins. Moreover, when using

bioassays the measurement of the biological activity of the secreted cytokines may

not be sufficiently specific and could be influenced by the presence of other factors.

It is known that the CTLL-2 cell line used in this present study to measure IL-2

activity is also responsive to murine and human IL-4 (Vella and Pearce, 1992),

Chapter 4 : Comparative analysis of mRNA and protein detection

80

although at least 10-times less (Mosmann et al., 1987). In pigs, levels of secreted IL-

4 from PBMC is quite low (Murthaugh et al., 1987) and in a study by Iwata et al.

(1993) on swine IL-2, where the influence of IL-4 was investigated on the

proliferative response of the CTLL-2 cells, the response was considered to be

attributed to the swine IL-2 activity. Our results showed IL-2 concentrations that did

not exceed 10 units and the kinetics of IL-2 in the bioassay was comparable to the

kinetics of the IL-2 mRNA expression so that the role of IL-4 in the detected

proliferation is expected to be minor or absent.

A study by Burns et al (1997) on human IL-4 expression and protein

production in stimulated PBMC utilizing competitive PCR, flow cytometry and

ELISA, showed that by using only one of these methods misleading information can

be obtained.

In conclusion, a good correlation between the cytokine mRNA expression and

the secreted cytokines can be obtained if the time after stimulation is restricted within

the first 24 hours.

ACKNOWLEDGEMENTS This work was supported by the Research Fund of the University of Gent and

by the Flemisch Institute for the Promotion of Scientific-Technological Research in

the Industry.

Chapter 5 : Competitive RT-PCR vs LightCycler RT-PCR

81

Chapter 5

LIGHTCYCLER RT-PCR AND COMPETITIVE RT-PCR ARE AS ACCURATE FOR QUANTIFYING

CYTOKINE TRANSCRIPTS IN PIGS1

1 Based on : Verfaillie T, Cox E, Goddeeris BM LightCycler RT-PCR and competitive RT-PCR are as accurate for quantifying cytokine transcripts in pigs. Submitted.

Chapter 5 : Competitive RT-PCR vs LightCycler RT-PCR

82

ABSTRACT

A reliable quantitative method for measuring gene product expression is

important in investigating the relationship between cytokines and the immune

responses induced by pathogens. To this end, competitive RT-PCR using homologous

DNA competitors was established and compared to the real-time detection of PCR

product in the LightCycler system using SYBR green I. Both techniques were tested

for their ability to quantify the transcription of porcine IFN-γ (Th1-like), IL-10 (Th2-

like) and TGF-β (Th3-like) in concanavalinA-stimulated peripheral blood

monomorphonuclear cells (PBMC). Comparison of the quantities of IFN-γ, IL-10 and

TGF-β mRNA expression, measured using either competitive or real-time RT-PCR,

showed a significant similarity. Inter-assay variability remained below 16% for both

assays but a higher sensitivity (10 vs 100-1000 copies per reaction) and an increased

dynamic range (8 vs 4 log units) were demonstrated for the real-time RT-PCR.

Moreover, competitive RT-PCR is labour intensive and time-consuming thereby

limiting the number of samples that can be analysed at a given time. This makes real-

time RT-PCR the preferable technique for the analysis of cytokine mRNA expression

in pigs.

Keywords : Cytokines, Pig, Competitive RT-PCR, Real-time RT-PCR

1. INTRODUCTION

Cytokines are the major controlling signals in both acute and chronic

inflammation and in regulating/modulating the innate and acquired immunity. A

number of methods are available for measuring cytokine mRNA expression including

Northern blot, RNAse protection assays, in situ hybridisation and reverse

transcription-polymerase chain reaction (RT-PCR). Of these, RT-PCR is the only

method that provides sufficient sensitivity and specificity to measure low level

cytokine mRNA expression especially since the number of cells or amounts of tissue

are usually limited. In pigs, conventional end-point RT-PCR has already been

successfully used for the detection of mRNA as evidence of cytokine gene expression

(Dozois et al., 1997 ; Verfaillie et al., 2001 ; Yancy et al., 2001 ; Choi et al., 2002).

Chapter 5 : Competitive RT-PCR vs LightCycler RT-PCR

83

However, quantification of mRNA levels or detection of changes in mRNA levels can

be problematic in conventional endpoint PCR assays since it is difficult to avoid data

acquisition during the saturation phase of the reaction. Moreover, only a relative

quantification is possible using non-competitive techniques such as comparison with a

reporter gene product or an “invariant” mRNA like β-actin or cyclophilin. To

circumvent this problem, quantification of transcripts can be achieved either by

competitive RT-PCR followed by gel analysis or by real-time RT-PCR monitoring of

product formation (Orlando et al., 1998 ; Giulietti et al., 2001). Competitive RT-PCR

has been widely used for cytokine mRNA analysis (Fisher et al., 2000 ; Reddy et al.,

2000 ; Oswald et al., 2001 ; Solano et al., 2001 ; Heraud et al., 2002) and relies on a

competition assay in which exogenous RNA or DNA (competitor) is coamplified with

the target molecule in the same reaction tube using only one pair of primers. This

reduces the impact of experimental variations because the amplification of the two

templates is equally affected during PCR (Wang et al., 1989 ; Gilliland et al., 1990).

However, the success of a quantitative competitive RT-PCR assay relies on

developing an internal competitor that amplifies with the same efficiency as the target

molecules but is also distinguishable from the target sequence by a difference in size

or sequence. With the introduction of a new procedure based on fluorescence-kinetic

RT-PCR, quantification of the PCR product in “real-time” became possible (Higuchi

et al., 1993 ; Wickert et al., 2002 ; Johnsen et al., 2002 ; Pfaffl et al., 2002). PCR

product accumulation is then measured at the early PCR cycles when the

amplification is still in its exponential phase making it possible to perform

quantification by comparison with external standards. This system uses double-

stranded DNA binding fluorescent dyes such as SYBR green I or fluorogenic probes

and the amount of fluorescence detected is proportional to the amount of accumulated

PCR product.

In this study, we compared competitive RT-PCR (RT-qcPCR) and LightCycler

RT-PCR (RT-lcPCR) for their value in studying cytokine mRNA expression in pigs.

Both techniques were validated by analysing quantitatively the ConA-induced

cytokine gene expression in porcine peripheral blood monomorphonuclear cells

(PBMC).

Chapter 5 : Competitive RT-PCR vs LightCycler RT-PCR

84

2. MATERIALS AND METHODS 2.1. Preparation and extraction of total RNA from mitogen-stimulated PBMC

Blood was collected from the jugular vein of a pig into tubes containing

Alsever’s solution (50% v/v)(Gibco BRL, Life Technologies, Merelbeke, Belgium).

PBMC were isolated by density gradient centrifugation using lymfoprep® (Nycomed

Pharma AS, Life Technologies, Merelbeke, Belgium) and suspended at a

concentration of 4 x 106 cells/ml leukocyte medium (RPMI-1640 (Gibco BRL), 10%

fetal bovine serum (FBS)(Gibco BRL), 1 mM sodium pyruvate (Gibco BRL), 2 mM

L-glutamine (Gibco BRL), 100 µg/ml kanamycin (Gibco BRL), 50 µg/ml gentamycin

(Gibco BRL) and 5x10-5 M 2-mercapto-ethanol) supplemented with the mitogen

concanavaline A (Sigma, Bornem, Belgium) at a final concentration of 1 µg/ml.

Cultures were maintained at 37°C in a humidified atmosphere of 5% CO2 for 24

hours. Thereafter, harvested cells were washed in ice-cooled PBS and the RNA

extraction was performed using the RNAgents® Total RNA Isolation System

following the manufacturer’s manual (Promega, Leiden, The Netherlands). The

extracted RNA was resuspended in 50 µl of ultra-pure water containing 0.02%

(w/vol) diethyl pyrocarbonate (DEPC)(Sigma). Total RNA was quantified by using a

spectrophotometer at 260 nm and purity was assessed by determining the O.D. ratio

260/280 nm. All samples had ratios above 1.7.

2.2. cDNA Synthesis

Three microgram total RNA was pre-incubated with 1 µl random hexamers

(12.5 µM final concentration)(Perkin Elmer, Branchburg, USA) during 10 min at

70°C. After chilling on ice, 5 mM MgCl2, 1 x PCR buffer (10 mM Tris-HCl (pH 8.3),

50 mM KCl), 1 mM dNTP mix (Roche, Mannheim, Germany) and 200 units of

Superscript II RNase H- reverse transcriptase (Gibco BRL) were added. The reaction

mix was incubated at room temperature for 10 min followed by 10 min at 42°C.

Finally, samples were heated at 95°C for 5 min to denature the reverse transcriptase.

Cyclophilin was used as constitutively expressed ‘housekeeping’ gene to evaluate the

quality of the cDNA (Verfaillie et al., 2001).

Chapter 5 : Competitive RT-PCR vs LightCycler RT-PCR

85

2.3. Oligonucleotide primers

The oligonucleotide primers (Table 1) used for the detection of cDNA specific

for porcine IFN-γ (Th1-like), IL-10 (Th2-like) and TGF-β (Th3-like) were designed

from the published nucleic acid sequences available from the Genbank/EMBL

databases. The primers SM and ASM (Table 1) were chosen in de middle of the target

sequence and differed from the target sequence by only one single basepair. These

primers were used to introduce a new restriction site by overlap-extension PCR (OE-

PCR).

Table 1 : Oligonucleotide primers used to generate the competitors (SM and ASM) and to amplify the various porcine cytokines by competitive and real-time PCR (S and AS). Cytokine

Oligonucleotide

primers Size bp

Restriction site

Genbank Accession no.

TGF-β

S 5’GACCCGCAGAGAGGCTATAG3’ AS 5’GAGCCAGGACCTTGCTGTAC3’ SM 5’GCTCCCGGGACCGCCGAG3’ ASM 5’CTCGGCGGTCCCGGGAGC3

401

CCCGGC

to CCC/GGG

SmaI

X12373

IFN-γ

S 5’TGTACCTAATGGTGGACCTC3’ AS 5’TCTCTGGCCTTGGAACATAG3’ SM 5’CATGTTTCAGAGGATCCTAAA3’ ASM 5’TTTAGGATCCTCTGAAACATG3’

410

GGTTCC

to G/GATCC

BamH I

X53085

IL-10

S 5’CCATGCCCAGCTCAGCACTG3’ AS 5’CCCATCACTCTCTGCCTTCGG3’ SM 5’GAGTTTCTTTAAAACGCCGGAC3’ ASM 5’GGTCCTTCGTTTTAAAGAAAC3’

295

TTTCAA

to TTT/AAA

Dra I

L20001

2.4. Quantification of cytokine mRNA with competitive PCR

2.4.1. Construction of the competitors

For the construction of the competitors, site-directed mutagenesis based on

OE-PCR was used (Fig. 1). Therefore, the cloned cytokine cDNAs were subjected to

2 PCR reactions using mismatched primers.

Chapter 5 : Competitive RT-PCR vs LightCycler RT-PCR

86

Figure 1 : (A) Construction of the competitors by site-directed mutagenesis based on overlap-extension PCR. A new restriction site was introduced by using mismatch primers (sm and asm). (B) The different steps for the construction of the TGF-b competitor are visualised on a 2% agarose gel (lane 1 : PCR product of the cloned cytokine ; lanes 2-3 : PCR product with the primer pairs (S and asm) and (sm and AS) ; lane 4 : competitor PCR product after OE-PCR ; lane 5 : RE digest with SmaI of the TGF-β competitor ; M : 100 bp DNA ladder. S : sense primer, AS : antisense primer.

1 2 3 4 5 M

PCR with primers (s,asm) and (sm,as)

Reaction 1 Reaction 2

= cloned cytokine = cloned cytokine

(A)

asm

s

as

sm

Mix, denaturate and anneal

Primer extension

PCR with primers (s,as)

(B)

Chapter 5 : Competitive RT-PCR vs LightCycler RT-PCR

87

Briefly, 2 PCR reactions were carried out in a 50 µl volume containing 1x

PCR mix (20 mM Tris-HCl, pH 8.3 ; 50 mM KCl ; 0.1% Tween 20 ; 2 mM MgCl2 ;

200 µM of each dNTP), 30 pmol of each of the two primers (S + ASM or SM +

AS)(Table 1), 0.1 units of Supertaq (SphaeroQ, Leiden, The Netherlands) and 1 ng of

the cloned cytokine. The amplification was performed for 35 cycli in a Genius

Thermocycler (Techne, Cambridge). After heating the samples at 95 °C for 2 min as a

hot start, the temperature cycling consisted of denaturation at 95°C for 30 s, annealing

at 60 °C (IFN-γ, IL-10) or 55 °C (TGF-β) for 60 s and extension at 72 °C for 45 s,

with a final extension at 72 °C for 7 min. The resulting DNA fragments from reaction

1 and 2 were then mixed, denaturated and subjected to overlap extension followed by

PCR using only the primers S and AS. These primers were not added to the PCR

reaction mix until after the first 3 cycli. The resulting cDNA fragments contained a

mutated sequence (new restriction site) which can be digested with the corresponding

restriction enzyme (Table 1) and were subcloned in a pGEM-T vector (Promega,

Leiden, The Netherlands) following the manufacturer’s manual. The sequences of the

inserted fragments were confirmed by DNA sequencing using the cycle sequencing

kit (Perkin Elmer) and an ABI prison 377 sequencer. Competitor amplicons were

generated by PCR as described above followed by a purification of the PCR products

using Quantum prep PCR kleen Spin Columns (Bio-Rad Laboratories, Nazareth Eke,

Belgium). The concentration was determined using a spectrophotometer and aliquots

of 108 copies/µl were stored at –20°C.

2.4.2. Competitive PCR conditions

Quantitative competitive PCR was used to quantify mRNA levels for TGF-β,

IFN-γ and IL-10. Briefly, Serial dilutions of DNA competitor were co-amplified with

a constant amount of target cDNA. Amplification was carried out in 50 µl volumes

containing 1 x PCR buffer (10 mM Tris-HCl, pH 9.0; 50 mM KCl; 0.1 % Triton X-

100)(Promega, Leiden, The Netherlands), 0.25 mM dNTP mix (Roche Diagnostics,

Brussels, Belgium), 0.5 (IL-10, IFN-γ) or 1 mM (TGF-β) MgCl2, 20 pmol sense and

antisense primers and 2.5 U Taq polymerase (Promega). After heating the samples at

95°C for 2 min, the temperature cycling (30 cycli) consisted of denaturation at 95°C

for 30 s, annealing at 56°C (TGF-β), 62°C (IFN-γ) or 60°C (IL-10) for 60 s and

Chapter 5 : Competitive RT-PCR vs LightCycler RT-PCR

88

extension at 72°C for 45 s with a final extension at 72°C for 7 min. Because the target

cDNA and its competitor share the same sequence, the same primer pair and have

similar sizes, the differences in the efficiencies of their amplification is expected to be

minimal. After amplification, 8 µl of the PCR products were digested with the

corresponding restriction enzymes (IL-10 : Dra I, IFN-γ : BamH I and TGF-β : Sma I)

in the presence of 1 x buffer at 30 °C (Sma I) or 37 °C (Dra I, BamH I) for 2 h. The

digested products were separated by electrophoresis on a 2% agarose gel and stained

with ethidium bromide. Subsequently the gels were scanned using an ImageMaster

VDS (Amersham Pharmacia Biotech) and the density of the bands was determined

using the ImageMaster 1D prime software (Amersham Pharmacia Biotech). The ratios

of the target to the competitor were calculated and the log of the ratios were plotted on

the Y-axis while the log of the initial amounts of competitor DNA added to the PCR

reaction were plotted on the X-axis. At the competitor equivalence point (log ratio =

0) the initial concentration of target cDNA corresponds to the initial concentration of

competitor DNA added (Gilliland et al., 1990).

2.5. Quantification of cytokine mRNA with LightCycler PCR

2.5.1. Preparation of the standards

As external standards purified PCR products of reverse transcribed total RNA

from ConA stimulated PBMC were used. The amplicons were purified using

Quantum prep PCR kleen Spin Columns (Bio-Rad Laboratories, Nazareth Eke,

Belgium). The concentration was determined using a spectrophotometer and aliquots

of 5.107 copies/µl were stored at –20°C.

2.5.2. Real-time PCR

Real-time PCR was carried out with the LightCycler® and the LightCycler-

faststart DNA Master SYBR Green I kit (Roche, Mannheim, Germany). The DNA

binding Dye SYBR Green I was used for the detection of the PCR products. The

reaction mixture consisted of a mastermix containing Taq polymerase, dNTP mixture

and SYBR Green I, 3 mM MgCl2, 0.3 µM of each primer and 2 µl of template cDNA

in a total volume of 20 µl. After heating the samples at 95°C for 10 min, the

Chapter 5 : Competitive RT-PCR vs LightCycler RT-PCR

89

temperature cycling (35-40 cycli) consisted of denaturation at 94°C for 15 s,

annealing at 56°C (TGF-β), 62°C (IFN-γ) or 60°C (IL-10) for 5 s, extension at 72°C

for 12 s (IL-10) , 14 s (IFN-γ) or 16 s (TGF-β). Fluorescence acquisition was

measured at 86°C (TGF-β), 85°C (IL-10) or 79°C (IFN-γ) in single mode. Melting

curve analysis was done at 65 to 98°C with continuous fluorescence acquisition. As

an additional control of specificity, PCR products were subjected to agarose gel

electrophoresis, if necessary. Sequence specific standard curves were generated using

10-fold dilutions (108-101 copies/µl) of the specific DNA standards. The number of

copies of each sample transcript was determined with the aid of the LightCycler

software.

2.6. Statistical analysis

Statistical analysis was performed using the software package SPSS version

9.0. The data were tested for parametric distribution with a Kolmogorov-Smirnov test

and the homogeneity of variance was tested with a Levene’s test. Statistical

comparison of both assays was made by an independent samples student’s T-test

(two-tailed). Differences between the assays were considered significant at P < 0.05.

3. RESULTS

Since stimulation of porcine PBMC with the polyclonal T-cell activator ConA

allows the detection of various cytokines, competitive RT-PCR and LightCycler RT-

PCR assays were evaluated by analysing the IFN-γ (Th1-like), IL-10 (Th2-like) and

TGF-β (Th3-like) gene expression in porcine PBMC stimulated in vitro for 24 hr with

ConA (Verfaillie T. et al., 2001). Limits and accuracies of both assays are compared

to achieve precise, reliable and reproducible results in unknown samples.

3.1. Quantification of porcine cytokine expression by competitive RT-PCR

The synthetic quantified DNA molecules (competitors) for IFN-γ, IL-10 and

TGF-β necessary in competitive RT-PCR were constructed by site-directed

mutagenesis based on overlap-extension PCR (OE-PCR)(Fig.1). Using mismatch

primers, a new restriction site was introduced which resulted in homologous

Chapter 5 : Competitive RT-PCR vs LightCycler RT-PCR

90

competitors differing in only 1 base from the target DNA (Table 1). After PCR

amplification of both competitor and target, products are subjected to a restriction

enzyme digest that specifically cuts the competitor in half so competitor and target

can be visualised separately after gelelectrophoresis. An example of a competitive

RT-PCR gel for IFN-γ, IL-10 and TGF-β is shown in figure 2A.

Figure 2 : Quantification of porcine IFN-γ, IL-10 and TGF-β mRNA levels in ConA stimulated porcine PBMC by competitive RT-PCR. (A) Representative gels showing detection of target cytokine and competitor. For PCR, target cDNA and 10-fold dilutions of competitor were added together in concentrations ranging from 106 to 103 copies. PCR products were digested with Sma I (TGF-b), Dra I (IL-10) or BamH I (IFN-g) to be able to distinguish target from competitor DNA and resolved on 2% agarose gels stained with ethidiumbromide. Band intensities were quantified by densitometry. (B) Ratios of the target to competitor band intensities were plotted against the amount of competitor in each reaction. The absolute amount of cytokine cDNA in each sample was calculated from the equivalence point where intensities of target and competitor bands were equal.

IFN-γ

y = -0,2161x + 0,9968R2 = 0,9552

-1

-0,5

0

0,5

1

3 4 5 6

Log(

staa

l/com

p)

IL-10

y = -0,9027x + 3,4985R2 = 0,9758

-1,5-1

-0,50

0,51

1,5

3 4 5 6

Log(

staa

l/com

p)

TGF-β

y = -0,5417x + 2,7392R2 = 0,9891

-1,5

-1

-0,5

0

0,5

1

1,5

3 4 5 6

Log (competitor)

Log(

staa

l/com

p)

106 105 104 103

106 105 104 103

106 105 104 103

(A) (B)

Chapter 5 : Competitive RT-PCR vs LightCycler RT-PCR

91

Constant amounts of the sample (30 pg total RNA) and 10-fold dilutions of

competitor (106-103 copies) were co-amplified with one set of specific primers. As the

concentration of the competitor was known, the point of equivalence in band

intensities determined the concentration of the amplified sample cDNA (Fig. 2B). To

ensure the reproducibility of the measurements made with this method, samples were

determined in triplicate. The calculated values for IFN-γ, IL-10 and TGF-β were

1.15x103 ± 1.83x102, 3.05x102 ± 4.30x101 and 3.07x103 ± 3.44x102 copies per pg

total RNA (mean ± standard deviation) respectively (Fig. 3).

IFN-γ IL-10 TGF-β competitive real-time competitive real-time competitive real-time

Mean 1,15E+03 1,18E+03 3,05E+02 3,73E+02 3,07E+03 3,01E+03

SD 1,83E+02 1,98E+02 4,30E+01 4,87E+01 3,44E+02 1,02E+02 CV (%) 15,9 16,7 14,1 13,1 11,2 3,4

Figure 3 : Comparison of the results of the quantification of porcine IFN-γ, IL-10 and TGF-β by competitive (black box) and real-time RT-PCR (gray box) expressed as number of copies per pg total RNA. Both assays were run in triplicate and results are presented as mean + SD. (Mean, standard deviation (SD), and coefficient of variation (CV))

These replicate values demonstrate that the assay is reproducible, with

coefficients of variation of 15.9% for IFN-γ, 14.1% for IL-10 and 11.2% for TGF-β.

The use of large dilutions of competitor (10-fold) allows for a greater dynamic range

of the assay, although some accuracy may be sacrificed (Zimmerman and Mannhalter,

1996).

10

100

1000

10000

IFN-g IL-10 TGF-b

#cop

ies/

pg to

t RN

A

Chapter 5 : Competitive RT-PCR vs LightCycler RT-PCR

92

3.2. Quantification of porcine cytokine expression by real-time RT-PCR

A quantitative assay for porcine IFN-γ, IL-10 and TGF-β was also developed

using the LightCycler system in which modified standards are not necessary since the

standard is amplified separately. Consequently, their synthesis is less time-consuming

and can be achieved within 1 day. Figure 4 shows the amplification reaction in real-

time using the non-specific DNA binding dye SYBR green I and purified PCR

products as external standards (108 to 101 copies).

-1.00. (C-D-E) Melting curve analysis.The plots of the negative derivative (-dF/dT) of the melting curves versus the temperature is presented. The lines indicate the melting T° of the specific PCR products amplified from the standards and samples (83°C for IFN-γ, 89°C for IL-10 and 92°C for TGF-β).The melting peak of the negative control for TGF-β (arrow) indicates an unspecific PCR product with small size such as primer dimers. Fluorescence acquisition is set at 79°C for IFN-γ, 85°C for IL-10 and 86°C for TGF-β so that fluorescence from possible the primer dimer formation is not detected.

IL-10

IFN-γ

TGF-β

A

B

C

D

E Figure 4 : Validation of real-time PCR using purified PCR products as template. (A) Amplification plot of IL-10 demonstrating the detection limit and dynamic range of real-time PCR. Tenfold serial dilutions of purified PCR product (108-101 copies) were amplified for 45 cycles. The dynamic range of the assay is at least 8 log units. (B) The standard curve derived from the amplification plot is shown in Fig 4A. The regression line was obtained using the LightCycler software and amounts of target calculated. The r values for each of the lines was

Chapter 5 : Competitive RT-PCR vs LightCycler RT-PCR

93

Calibration curves and copy numbers of unknown samples are determined by

the LightCycler software. The standards were useful to estimate the sensitivity of the

reaction. Up to 10 copies of target per reaction could be detected with a dynamic

range of at least 8 log units. Using SYBR green I, particular attention has to be paid to

avoid the detection of aspecific products such as primer dimers. This was done by

melting curve analysis of the PCR products where the temperature for fluorescence

acquisition was adjusted to avoid detection of the primer dimers (Fig. 4C-E). As for

the competitive RT-PCR, samples were determined in triplicate to assess inter-assay

variability.

The calculated values for IFN-γ, IL-10 and TGF-β were 1.18x103 ± 1.98x102,

3.73x102 ± 4.87x101 and 3.01x103 ± 1.02x102 copies per pg total RNA (mean ±

standard deviation) respectively with coefficients of variation of 16.7% for IFN-γ,

13.1% for IL-10 and 3.4% for TGF-β (Fig. 3). When triplicate PCRs were performed

in a single run to assess within-assay variability, coefficients of variation were never

higher than 5 % which is clearly lower than the variation seen between different runs

(data not shown).

4. DISCUSSION

In this study we have designed, optimised and validated two quantitative RT-

PCR assays for measuring IFN-γ, IL-10 and TGF-β gene expression in pigs. Similar

results were obtained by either competitive or real-time RT-PCR with good

reproducibility and low test variability (<16%). However, in terms of sensitivity and

dynamic range, LightCycler RT-PCR seemed superior with a detection limit of 10

copies per reaction (vs 100-1000 in RT-qcPCR) and a dynamic range of 8 log units

(vs 4 log units in RT-qcPCR). Sensitivity of the RT-qcPCR is mainly limited by the

ability to stain the products with ethidiumbromide in the agarose gel.

Nevertheless, both methods are useful for the quantification of cytokine

mRNA transcripts but some differences in practicability should be mentioned. The

need to analyse serial dilutions in RT-qcPCR considerably limits the number of

samples which can be processed on a given day. The whole procedure takes at least 8

hr, including post-PCR manipulations such as agarose gels and evaluation of the

results. So replicate measurements of a single sample are not often performed,

Chapter 5 : Competitive RT-PCR vs LightCycler RT-PCR

94

potentially leading to errors in quantification. In contrast, 23 samples (plus 8 standard

amplicon dilutions and 1 control) can be analysed in the LightCycler in one run and a

40 cycle PCR with subsequent melting curve analysis can be completed in

approximately 45 minutes. However, real-time PCR requires the use of a specialised,

expensive real-time PCR machine that may not be accessible to all researchers.

Secondly, the evaluation of the results from competitive RT-PCR depends on the

accurate quantification of the band intensities. This quantification is hampered by

variabilities caused by the individual interpreter. In contrast, LightCycler results are

calculated directly by the integrated software. RT-lcPCR also does not require the

design of an internal competitor and block cycler protocols can be easily adapted for

real-time PCR using DNA binding dyes for the detection of the amplified products

(Dumoulin et al., 2000). The developed LightCycler assay is already successfully

used in our lab to compare cytokine expression levels in immunisation studies (Van

der Stede et al., 2002). However, for comparing cytokine mRNA expression levels in

different samples, cyclophilin, a constitutively expressed “housekeeping” gene is used

to normalise the results since a correction for variations in both RNA quality and

efficiency of the reverse transcription reaction is required (Verfaillie T. et al., 2001).

To ensure the credibility of the results, choosing an ideal housekeeping gene is very

important (Thellin O. et al., 1999 ; Steele B.K. et al., 2002).

In conclusion, RT-lcPCR is as accurate as RT-qcPCR to quantitate cytokine

gene expression in swine. However, real-time PCR has major advantages over

competitive PCR including its sensitivity and the possibility of rapid, accurate and

simultaneous quantification of multiple samples.

ACKNOWLEDGEMENTS This work was supported by the Research Fund of the University of Ghent.

Chapter 6 : Priming of piglets by immunisation with FaeG DNA

94

CHAPTER 6

PRIMING OF PIGLETS AGAINST F4 FIMBRIAE BY

IMMUNIZATION WITH FAEG DNA.1

1 Adapted from : Verfaillie T, Melkebeek V, Snoek V, Douterlungne S, Verdonck F, Vanrompay D, Goddeeris B, Cox E (2004) Priming of piglets against enterotoxigenic E. coli F4 fimbriae by immunisation with FAEG DNA. Vaccine. 22(13-14):1640-7.

Chapter 6 : Priming of piglets by immunisation with FaeG DNA

95

ABSTRACT

Early vaccination is necessary to protect pigs against postweaning diarrhoea

caused by enterotoxigenic Escherichia coli (ETEC). However, at present no

commercial vaccine allows successful vaccination. This is partly due to the presence

of maternally derived antibodies. Since DNA vaccines are suggested to be superior to

protein vaccines in young animals with maternal antibodies, we determined wether

the fimbrial adhesin (FaeG) of F4ac+ ETEC could be used as a plasmid DNA vaccine

to prime piglets in a heterologous prime-boost approach. Hereto, pcDNA1/faeG19

was constructed and expression of rFaeG in Cos-7 cells was demonstrated. Thereafter,

pigs were immunised (days 0, 21 and 42) intramuscularly by injection or

intradermally by gene gun and humoral and cellular immune responses were

analyzed. Even though responses were low, results demonstrated that intramuscular

injection was superior to gene gun delivery for priming the humoral immune response

since higher antibody titres were raised, whereas gene gun delivery better induced a

cellular response, evaluated by a lymphocyte proliferation assay. Nevertheless,

following only one intramuscular immunization, pigs demonstrated a bias towards a

Th1-type cytokine response as evidenced by the predominance of IFN-γ mRNA and

diminished IL-4 mRNA in peripheral blood monomorphonuclear cells after in vitro

antigen-specific restimulation. Effective priming of the humoral immune response

was evidenced by high IgG titres one week after a protein boost with purified F4. The

low responses to the pcDNA1/faeG19 DNA vaccination suggest that delivery of the

DNA and/or the expression of the faeG gene should be improved.

Keywords : pigs, enterotoxigenic E. coli, FaeG, DNA vaccination

6.1. INTRODUCTION

Infection with F4+enterotoxigenic Escherichia coli (ETEC) is an important

cause of diarrhoea, weight loss, growth retardation and death in neonatal and newly

weaned pigs and is responsible for great economic losses (Jones and Rutter, 1972).

ETEC adhere to the small intestinal villi and produce enterotoxins which act locally

on the enterocytes. This colonization of the small intestine is mediated by fimbriae

Chapter 6 : Priming of piglets by immunisation with FaeG DNA

96

(pili) such as F4 and F18. Of F4 (K88) 3 serological variants have been identified

namely F4ab, F4ac and F4ad (Ørskov et al., 1964 ; Guinée and Jansen, 1979). Among

these, F4ac appears to be the most prevalent (Westerman et al., 1988). The fimbriae

are mainly composed of several hundreds identical 27.5 kDa protein subunits, called

FaeG, that are linked by electrostatic and hydrophobic forces and are encoded by an

887 bp gene located on a large non-conjugative plasmid (Mol and Oudega, 1996).

Neonatal protection against F4+ ETEC infections can be obtained by

vaccination of the sows hereby providing lactogenic immunity to the offspring. These

passively acquired antibodies will protect piglets during the suckling period (Nagy

and Fekete, 1999). To be protected against postweaning diarrhoea due to an F4+

ETEC infection, pigs need an active immunity. Hereto, they should be vaccinated

during the suckling period. Most suckling pigs, however, have colostral and milk

antibodies against the F4 fimbriae which will interfere with systemic and mucosal

vaccination respectively, thereby hampering the use of classical protein vaccines.

Several attempts have been made using parenteral or oral vaccines without success

(Moon and Bunn, 1993 ; Isaacson, 1994 ; Bozic et al., 2002). Only oral vaccination

after weaning with purified F4 fimbriae showed to be successful (Van den Broeck et

al., 1999b) whereas attempts to vaccinate suckling piglets with fimbrial solutions

before weaning was without success (Van der Stede et al., 2003 ; Bertschinger et al.,

1979 ; Francis and Willgohs, 1991).

A more recent approach in vaccinology is the so-called genetic immunization

by which DNA constructs encoding a specific immunogen are delivered into the host.

Since immunogens are synthesized de novo within the DNA transfected cells, antigen

can be presented by both MHC class I and II molecules, resulting in stimulation of

both humoral and cellular immune responses (Tang et al., 1992 ; Yankaucka et al.,

1993 ; Ulmer et al., 1993). The most widely used strategies for the application of

DNA vaccine vectors are intramuscular needle injection and particle bombardment

using a gene gun. Importantly, it was shown that the method of antigen delivery can

influence the cytokine profile of the immune response with intramuscular injection

favoring Th1-type responses whereas gene gun immunization preferentially

promoting Th2-type responses (Manickan et al., 1995 ; Weiss et al., 2000 ; Feltquate

et al., 1997). Both methods also strongly differ in the efficiency of DNA delivery. In

general, IM needle injection requires 100- to 1000-fold more DNA than gene gun

Chapter 6 : Priming of piglets by immunisation with FaeG DNA

97

immunization to generate an equivalent antibody response (Pertmer et al., 1995 ;

Weiss et al., 2000).

Several studies in animal models have shown that DNA vaccines, in contrast

to conventional vaccines, can succesfully prime immune responses in the presence of

maternal antibodies pointing out its potential for use in neonates (Hassett et al., 1997 ;

Manickan et al., 1997 ; Van Drunen Littel-van den Hurk et al., 1999). As a

vaccination strategy against post-weaning diarrheoa caused by F4+ ETEC, priming of

the immune system of suckling piglets by a DNA vaccine combined with a protein

boost after weaning could be an interesting approach.

The aim of the present study was to examine the potential of a newly

constructed FaeG DNA vaccine (pcDNA1/faeG19) to induce B-cell and CTL priming

in 6-weeks-old pigs in a DNA prime-protein boost model. Moreover, since little is

known about porcine cytokine responses following DNA vaccination, we used a

newly developed real-time RT-PCR technique to determine cytokine profiles

generated by this DNA vaccine.

6.2. MATERIALS AND METHODS

6.2.1. Bacterial strains and growth conditions

The E. coli strain GIS 26, serotype O149:K91:F4ac, LT+STa+STb+ was used to

obtain DNA as template for the synthesis of FaeG. Growth of the strain was

performed in tryptone soya broth (OXOID, Drongen, Belgium). E. coli MC1061/P3

was used to replicate the carrying vector pcDNA1 (Invitrogen, Leek, The

Netherlands) and for transformation with pcDNA1/faeG19, the vector carrying faeG.

This strain was grown in Luria broth or Luria agar with ampicillin (100 µg/ml).

6.2.2. Experimental animals

Eighteen conventional pigs were weaned at the age of 4 weeks and were

subsequently housed in isolation units were they obtained food and water ad libitum.

All animals were negative for serum antibodies against F4 as determined by ELISA.

Chapter 6 : Priming of piglets by immunisation with FaeG DNA

98

6.2.3. Plasmid construction

The faeG gene of the E. coli strain GIS 26, serotype O149:K91:F4ac,

LT+STa+STb+ was amplified by PCR using primers that flanked both ends of the faeG

gene open reading frame and provided Hind III and BamH I restriction sites for

subsequent cloning (Fig. 1). Genomic DNA from E. coli strain GIS 26, obtained by

alkalic lysis was used as a template. The PCR reaction was carried out in a 50 µl

volume containing 5 ng genomic DNA, 1 x PCR buffer (10 mM Tris-HCl, pH 9.0 ; 50

mM KCl ; 0.1% Triton X-100)(Promega, Leiden, The Netherlands), 0.25 mM dNTP

mix (Roche Diagnostics, Brussels, Belgium), 1 mM MgCl2, 20 pmol sense and

antisense primers (S : 5’ TGA AGC TTG CCT GGA TGA CTG G 3’ (Hind III) ; AS :

5’ AAT GGA TCC GCA GCT CAT CAC G 3’ (BamH I)(Turnes et al., 1999)) and

2.5 u Taq polymerase (Promega, Leiden, The Netherlands). A DNA thermal cycler

PTC100 (Biozym, The Netherlands) was used for heating the samples at 94°C for 3

min whereafter 30 cycli consisting of melting at 94°C for 1 min, annealing at 50 °C

for 1 min and extension at 72°C for 2 min were run with a final extension at 72°C for

5 min. After PCR, samples were migrated in a 1.5% agarose gel, stained with

ethidiumbromide and fotographed using an imagemaster VDS (Amersham Pharmacia

Biotech). Amplification products of the appropriate size were obtained (828 bp)

which were subjected to restriction enzyme digestion with Hae III and Hinf I for

further confirmation of the faeG sequence. The modified faeG gene was cloned into

the mammalian expression plasmid pcDNA1 by insertion of the amplified faeG gene

into the Hind III and BamH I site of pcDNA1. This plasmid was used to transform

competent E. coli MC1061/P3 by heat shock.

Clones were selected on medium containing ampicillin (100 µg/ml) and grown

in microtiterplates. To verify the presence of the gene, PCR clone analysis was

performed using T7 and SP6 primers which flanked the cloning site and by restriction

enzyme analysis using Hae III and Hinf I. Briefly, 5 µl of each clone was subjected to

PCR in a 50 ml volume containing 50 mM KCl, 20 mM Tris-HCl (pH 8.3), 2 mM

MgCl2, 0,1% Tween 20, 0,2 mM of each dNTP, 20 pmol of sense and antisense

primer and 0.1 unit of Supertaq polymerase (SphaeroQ, Leiden, The Netherlands).

After heating the samples at 95°C for 3 min, the temperature cycling (30 cycli)

consisted of denaturation at 94°C for 30 s, annealing at 50 °C for 1 min and extension

Chapter 6 : Priming of piglets by immunisation with FaeG DNA

99

at 72°C for 2 min. Several of the resulting clones were shown to contain a plasmid

with faeG.

Figure 1 : Construction of pcDNA1/faeG19 in pcDNA1.The gene was cloned in the Hind III and BamH I restriction sites of the multiple cloning site, immediately downstream of the CMV promotor.

Following sequence analysis using the Dye-Terminator Cycle Sequencing kit

of Perkin Elmer, one plasmid designated pcDNA1/faeG19 was selected for

subsequent analysis. Large-scale purification of pcDNA1 and pcDNA1/faeG19 was

conducted by the Qiagen Endofree plasmid mega kit (Qiagen GmbH, Germany).

After determining the concentrations at A260nm, the plasmids were stored at –20°C.

6.2.4. Coating of DNA to gold particles for delivery via gene gun

Plasmid DNA (pcDNA1/faeG19) was precipitated onto gold particles (1,6 µm

diameter) in the presence of 0.05 M spermidine and 1 M CaCl2 at a final

concentration of 10 µg DNA per mg gold (Bio-Rad, Nazareth Eke, Belgium). The

gold beads were washed 3 times with 100 % ethanol, suspended in a

polyvinylpyrrolidone-ethanol solution and used to coat the interior of tubes with the

tubing prep station (Bio-Rad). After adhesion of the particles to the tube, the tube was

Chapter 6 : Priming of piglets by immunisation with FaeG DNA

100

cut so that each shot with the Helios gene gun (Bio-Rad) consisted of 5 µg plasmid

DNA and 0,5 mg of gold.

6.2.5. In vitro expression of rFaeG by mammalian cells

The ability of the DNA construct to express rFaeG in COS-7 cells was

investigated as described by Vanrompay et al. (1998). COS-7 cells were cultured in

Dulbecco’s Minimal Essential Medium (DMEM)-glutamax (Life Technologies,

Merelbeke, Belgium) supplemented with 1% gentamycin and 10% Fetal calf serum

(FCS)(Seromed). Transfection with plasmid DNA was performed using DEAE

dextran as described by Tregaskes and Young (1997) whereafter transfected cells

were cultured for 24, 48, 72 and 96 hours on cover slips in flat-bottomed Chlamydia

Trac Bottles (International Medical, Brussels, Belgium) at 37°C in 5% CO2.

Subsequently, an indirect immunofluorescence staining (IIF) was performed. All

dilutions were made in PBS (pH 7.3). The cell monolayers were fixed in methanol at

–20°C for 10 min whereafter the monolayers were washed for 1 h with PBS

supplemented with 5% FCS to prevent non-specific binding. A F4-specific mouse

monoclonal antibody (IMM01)(Van der Stede et al., unpublished data) or a F4-

specific polyclonal rabbit antiserum was added to the cells and incubated for 45 min.

After washing the cells 4 times with PBS, cells were incubated with a sheep anti-

mouse Ig labelled with fluorescein isothiocyanate (FITC)(Sigma, Bornem, Belgium)

or a goat anti-rabbit Ig labelled with FITC (Sigma, Bornem, Belgium) for 1 hour.

Incubations occurred in a moist chamber at 37 °C. Subsequently, the monolayers were

washed twice for 5 min with PBS and for 30 s with distilled water and were then air

dried. The monolayers were mounted with a glycerine solution containing DABCO

and examined using a fluorescence or confocal laser scanning microscope (CLSM).

The rFaeG expression in pcDNA1/faeG19 transfected COS-7 cells was also

examined using a F4-specific ELISA on lysed cells. Wells of maxisorb plates were

coated at 37°C for 2 h with the F4-specific monoclonal antibody IMM 01 at a

concentration of 1 µg/ml in PBS. After overnight blocking at 4°C with 0,2% Tween®

80 in PBS, plates were incubated for 1 h at 37°C with the cell lysate of COS-7

transfected cells serially diluted in PBS with 0.2% Tween® 20 and 3% BSA (ICN

Biomedicals). After washing the plates 3 times, serum, positive for F4-specific

Chapter 6 : Priming of piglets by immunisation with FaeG DNA

101

antibodies, was added (1/6000) for 1 h at 37°C. The plates were washed and rabbit

anti-swine IgG polyclonal antibodies conjugated with horseradish peroxidase

(HRP)(Prosan, Dako) were added, 1/1000 diluted in PBS with 0.2% Tween® 20, 3%

BSA and 4% mouse ascites and incubated for 1 h at 37°C. Finally, ABTS (Roche

Diagnostics, Brussels, Belgium), containing H2O2, was added and after 45 min

incubation the optical density was measured at 405 nm.

6.2.6. Immunization protocol

At the age of 6 weeks, 10 pigs were divided into 3 groups. The first group

(n=4) was immunized IM in the neck (musculus splenius) with 600 µg

pcDNA1/faeG19. A second group (n=4) was immunized using a gene gun (Bio-Rad),

which delivered 10 µg pcDNA1/faeG19 to the shaved skin (neck) of the pigs using

400 psi of pressure. The third group (n=2) served as a control and received IM 600 µg

pcDNA1. For intramuscular administration, DNA was diluted in saline (0.9% NaCl).

Three and six weeks after the first immunization all animals received identical booster

immunizations. Nine weeks post primary immunization (PPI) all animals were IM

boosted with 100 µg of purified F4 fimbriae in 0.9% saline suspended in incomplete

Freund’s adjuvant. To determine the serum-antibody response, blood was taken from

the jugular vein at weekly intervals until the animals were boosted with the F4

fimbriae. From then on, blood was collected every 3-4 days for another 3 weeks.

Harvested sera were inactivated at 56 °C for 30 min and subsequently treated with

kaolin (Sigma, Bornem, Belgium) as described [10] to decrease the background

reading in ELISA. At days 45 and 74 PPI blood was collected on an equal volume of

Alsever’s solution for isolation of peripheral blood monomorphonuclear cells

(PBMC) which were used for proliferation assays.

In a second experiment, 8 pigs (6 weeks old) were divided into 2 groups. The

first group (n=4) was immunized IM in the neck with 600 µg pcDNA1/faeG19

whereas the second group (n=4) served as a control and received IM 600 µg pcDNA1.

Three weeks post immunization, blood was collected on an equal volume of Alsever’s

solution for isolation of peripheral blood monomorphonuclear cells (PBMC). PBMC

were restimulated in vitro with purified F4 fimbriae (final concentration of 15 µg/ml)

or medium. After 16 hrs, total RNA was extracted as described by Verfaillie T et al.

Chapter 6 : Priming of piglets by immunisation with FaeG DNA

102

(2001) and cytokine gene expression was examined by real-time RT-PCR. At the

same time isolated PBMC were used for proliferation assays.

6.2.7. Lymphocyte proliferation test

PBMC were isolated by density gradient centrifugation using lymphoprep

(Nycomed, Pharma AS, Life Technologies, Merelbeke, Belgium) as described (Van

den Broeck et al., 1999) and suspended at a concentration of 4x106 cells/ml in

leukocyte medium (RPMI-1640 (Gibco BRL, Life Technologies, Merelbeke,

Belgium), fetal bovine serum (FBS)(5%)(Gibco BRL), sodium pyruvate (100

mM)(Gibco BRL), non-essential aminoacids (100 mM)(Gibco BRL), L-glutamine

(200 mM)(Gibco BRL), kanamycin (100 µg/ml)(Gibco BRL), penicillin (100

IU/ml)(Gibco BRL), streptomycin (100 µg/ml)(Gibco BRL) and 2-mercapto-ethanol

(5.10-5M)(Gibco BRL)). The lymphocyte proliferation was performed by adding

purified F4 fimbriae (final concentration of 20 or 10 µg/ml), Concanavalin A (ConA)

(final concentration of 10 µg/ml) or medium to microwells containing 4.105 cells.

ConA was used to evaluate the proliferative capacity of the cells. Each stimulation

was done in triplicate. After 3 and 4 days at 37°C in 5% CO2, cells were pulse-

labelled with 3H-thymidine (1 µCi/well)(Amersham ICN, Bucks, UK) and 18 h later,

cells were harvested onto glass fiber filters. The radioactivity incorporated into the

DNA was measured with a β-scintillation counter (Perkin-Elmer, Life Science,

Brussels, Belgium) and was expressed as a stimulation index (SI : mean counts per

minute in the presence of antigen divided by the mean counts per minute in the

absence of antigen).

6.2.8 Real-time RT-PCR

Reverse transcription was performed by pre-incubating 3 µg of total RNA

with 1 µl of random hexamers (12.5 µM final concentration)(Perkin Elmer,

Branchburg, USA) during 10 min at 70°C. After chilling on ice, 5 mM MgCl2, 1 x

PCR buffer (10 mM Tris-HCl (pH 8.3), 50 mM KCl), 1 mM dNTP mix (Roche,

Mannheim, Germany), 20 U of Rnasin® Ribonuclease inhibitor (Promega) and 200

units of Superscript II Rnase H- reverse transcriptase (Gibco BRL) were added. The

Chapter 6 : Priming of piglets by immunisation with FaeG DNA

103

reaction mix was incubated at room temperature for 10 min followed by 10 min at

42°C. Finally, samples were heated at 95°C for 5 min to denature the reverse

transcriptase.

The oligonucleotide primers used for the detection of the porcine cytokines

IL-1α, IL-2, IL-4, IL-6, IL-10, IFN-γ, TGF-β, TNF-α and of cyclophilin cDNA were

designed from the published nucleic acid sequences available from GenBank/EMBL

databases (Table 1). Cyclophilin was used as constitutively expressed 'housekeeping

control gene’ to determine the uniformity of the reverse transcription reactions and as

a reference for quantification of cytokine mRNA (Dozois et al., 1997).

Table 1 :Oligonucleotide primers and fragment length of PCR products for different porcine cytokines cytokine Primers (5’-3’) Length

PCR fragment

Genbank accession number

IL-1α

(S) TGCCAGCTATGAGCCACTTCC (AS) TGACGGGTCTCGAATGATGCT

336

X52731

IL-2

(S) GATTTACAGTTGCTTTTGAAG (AS) GTTGAGTAGATGCTTTGACA

338

X56750

IL-4

(S) TACCAGCAACTTCGTCCA (AS) ATCGTCTTTAGCCTTTCCAA

311

F68330

IL-6

(S) ATGAGAATCACCACCGGTCTTG (AS) TGCCCCAGCTACATTATCCGA

310

M86722

IL-10

(S) CCATGCCCAGCTCAGCACTG (AS) CCCATCACTCTCTGCCTTCGG

295

L20001

IFN-γ

(S) ATGTACCTAATGGTGGACCTC (AS) CTCTCTGGCCTTGGAACATAG

360

X53085

TGF-β

(S) GACCCGCAGAGAGGCTATAG (AS) GAGCCAGGACCTTGCTGTAC

399

Y00111

TNF-α

(S) CAAGGACTCAGATCATCGTCTCA (AS) CATACCCACTCTGCCATTGGA

100

X54859

Cyclophilin

(S) TAACCCCACCGTCTTCTT (AS) TGCCATCCAACCACTCAG

368

F14571

(S) : sense ; (AS) : antisense

Real-time PCR was carried out with the LightCycler® and the LightCycler-

faststart DNA Master SYBR Green I kit (Roche, Mannheim, Germany). The reaction

mixture consisted of a mastermix containing Taq polymerase, dNTP mixture and

SYBR Green I, 3 (IL-1α, IL-4, IL-6, IL-10, IFN-γ, TNF-α, TGF-β) or 4 (IL-2,

Cyclophilin) mM MgCl2, 0.3 µM of each primer and 2 µl of template cDNA in a total

Chapter 6 : Priming of piglets by immunisation with FaeG DNA

104

volume of 20 µl. After heating the samples at 95°C for 10 min, the temperature

cycling (35-40 cycli) consisted of denaturation at 94°C for 15 s, annealing at 53°C

(cyclophilin), 56°C (TGF-β), 60°C (IL-2, IL-6, IL-10), 62°C (IFN−γ) 67°C (TNF-α)

or 68 (IL-1α) for 5 s and extension at 72°C for 7-16 s depending on the length of the

product (~ 1s/25bp). Fluorescence acquisition was measured at 77°C (IL-2), 79°C

(IFN-γ), 81°C (IL-1α), 82°C (IL-6, cyclophilin), 85°C (IL-10) or 86°C (IL-4, TGF-

β, TNF-α) in single mode. Melting curve analysis was done at 65 to 98°C with

continuous fluorescence acquisition. As an additional control of specificity, PCR

products were subjected to agarose gel electrophoresis, if necessary. Quantification

occurred using external standards of cytokine cDNA. The number of copies of each

sample transcript was determined with the aid of the LightCycler software and

relative amounts of cytokine-expression were plotted as a ratio (copy number of target

cytokine/copy number of housekeeping gene*1000).

6.2.9. Titration of F4-specific serum antibodies

F4-specific IgM, IgA and IgG titres were determined in an indirect ELISA as

described by Van den Broeck et al. (1999). Briefly, the wells of maxisorb plates

(NUNC®, Maxisorb Immuno Plates, Gibco BRL) were coated at 37°C for 2 h with the

F4-specific monoclonal antibody (IMM 01) at a concentration of 1 µg/ml suspended

in PBS. After overnight blocking at 4°C with 0.2% Tween® 80 ( Merck Eurolab,

Leuven, Belgium) in PBS, plates were incubated for 1 h at 37°C with the F4 antigen

at a concentration of 25 µg/ml diluted in PBS, pH 7.4 with 0.2% Tween® 20 and 3%

BSA (dilution buffer)(ICN Biomedicals). Subsequently, sera were added in series of

twofold dilutions in ELISA dilution buffer, starting at a dilution of 1/10, for 1 h at 37

°C and then incubated with biotinylated-swine–specific IgM, IgG and IgA mAb for 1

h at 37 °C followed by 1 h incubation at 37 °C with peroxidase-conjugated

streptavidin. In between the steps plates were washed three times with PBS + 0.2%

(v/v) Tween® 20. Finally, ABTS (Roche Diagnostics, Brussels, Belgium), containing

H2O2, was added and after 30 min incubation the optical density was measured at 405

nm.

The antibody titres were determined as the inverse of the highest dilution that

still had an OD405 higher than the cut-off value. The cut-off value was determined by

Chapter 6 : Priming of piglets by immunisation with FaeG DNA

105

calculation of the mean OD450 plus three times the standard deviation of the optical

densities of the 1/10 diluted samples measured at day 0.

6.2.10. Statistical analysis

Differences in log2 antibody serum titres between the groups were tested for

statistical significance using General Linear Model (Repeated Measures Analysis of

Variance) and LSD post hoc multiple comparisons. P< 0.05 was considered as

statistically significant.

For the quantification of the cytokines by real-time RT-PCR, a correction was

made for the variations between the different samples by using cyclophilin as a

housekeeping gene and results are presented as a ratio. The ratio’s of the individual

pigs were grouped and the differences in the mean between the stimulated and control

groups were tested for statistical significance with a paired-sample t-test. Statistical

significance was assessed at a P value of < 0.05.

6.3. RESULTS

6.3.1. Construction of pcDNA1/faeG19

The faeG gene, obtained by PCR amplification from E. coli strain GIS 26,

serotype O149/K91/F4ac, LT+STa+STb+ genomic DNA was cloned into the

eukaryotic expression vector pcDNA1. Several MC1061/P3 clones were shown to

contain a plasmid with faeG and following sequencing, one plasmid pcDNA1/faeG19

was selected (Fig. 1).

6.3.2. Expression of rFaeG in transfected COS-7 cells

To examine if expression of rFaeG occurred in COS-7 cells in a native

conformation, pcDNA1/faeG19 transfected COS-7 cells were stained by IIF using

monoclonal antibody IMM 01 that can block binding of F4 to the villus brush border

and a F4-specific polyclonal rabbit antiserum (Fig. 2). Using the polyclonal

antiserum, rFaeG could be demonstrated in the cytoplasm of the COS-7 cells at 48, 72

Chapter 6 : Priming of piglets by immunisation with FaeG DNA

106

and 96 h post transfection (PT). At 96 hours most cells were positive but expression

was moderate. The monoclonal antibody IMM 01 could only detect rFaeG 96 h PT.

0

0,2

0,4

0,6

0,8

1

20 40 80 160 320 640 1280 2560dilution

OD

40

5 n

m

To have an idea of amounts of rFaeG produced, expression was also examined

using a F4-specific ELISA on lysed COS-7 cells (Fig. 3). Here, rFaeG could be

detected from 72 h PT and amounts increased at 96 h PT.

6.3.3. Immune responses after DNA immunization

6.3.3.1. Humoral antibody response

The DNA vaccine pcDNA1/faeG19 was administered to 6-week-old pigs on

days 0, 21 and 42 by either IM injection (600 µg/pig) or intradermally using a gene

gun (10 µg/pig). Figure 4 shows the F4-specific antibody response in the IM and gene

gun group. Following IM vaccination, 3 successive inoculations with 3 week intervals

were necessary to generate significant antibody responses in all 4 pigs (P = 0,018).

A B Figure 2: Confocal laser scanning microscopic examination of COS-7 cells transfected with pcDNA1/ faeG19. At 96 hours PT, fixed cells were stained by indirect immunofluorescence with a F4-specific monoclonal antibody IMM 01 (A) or a F4-specific polyclonal rabbit antiserum (B).

OD

405

nm

Figure 3 : The production of rFaeG measured by a F4-speci-fic ELISA on lysed cells, 72 h PT. (---) untransfected COS-7 cells ; (▬) pcDNA1/faeG19 transfected COS-7 cells.

Chapter 6 : Priming of piglets by immunisation with FaeG DNA

107

Only one pig showed antibody titres after 2 immunizations. No antibodies were

detected in the control pcDNA1 vaccinated pigs and the 4 gene gun vaccinated pigs.

All pigs received booster immunizations with purified F4 (100 µg/pig) at day 63 post-

primary immunization (PPI) to determine if a priming of the humoral immune system

had occurred in the gene gun vaccinated animals. A secondary type of response with a

statistically significant increase in serum antibody titres (4 to 5-fold) was observed 7

days after the protein boost in the IM (P = 0,003) as well as in the gene gun (P =

0,038) group even though low to no antibody responses were obtained following the 3

successive gene gun immunizations. Antibody titres in the control pcDNA1 group

increased more slowly and to a lesser extend.

Figure 4 : Kinetics of the F4-specific serum antibody response following intramuscular (IM) or intradermal (gene gun) immunization of pigs with pcDNA1/faeG19(▬) or pcDNA1 (---). Pigs were immunized 3 times (days 0, 21 and

IM

3

5

7

9

11

13

15

0 7 14 21 28 35 42 49 55 63 67 70 74 77 81

Log2

(titr

e)

gene gun

3

5

7

9

11

13

15

0 7 14 21 28 35 42 49 55 63 67 70 74 77 81

days post-primary immunisation

Log2

(titr

e)

Chapter 6 : Priming of piglets by immunisation with FaeG DNA

108

42) and all pigs received a booster immunization with purified F4 at day 63 PPI. Black arrows indicate immunizations.

The isotypes of the induced F4-specific antibodies were also determined.

Figure 5 shows the isotype profile of the IM and gene gun group in comparison with

the control group 2 weeks after the third DNA immunization (day 55 PPI) and 1 week

after the booster immunization with purified F4 (day 70 PPI). These results

demonstrate that the serological responses for the IM vaccinated group seen at day 55

PPI were mainly due to IgG antibodies whereas IgM antibody titres were low and IgA

antibodies could not be detected. For the gene gun group, no differences were

observed in comparison with the control group for all 3 isotypes.

3

6

9

12

15

55 70 55 70 55 70

IgM IgG IgAdays post-primary immunisation

Log2

(titre

)

controlsIMgene gun

Figure 5 : Comparison of F4-specific IgM, IgG and IgA titres in serum 2 weeks post-tertiary intramuscular (n=4) or intradermal (gene gun, n=4) delivery of pcDNA1/faeG19 or intramuscular injection of pcDNA1(n=2)(day 55 PPI) and 1 week after the boost with purified F4 (day 70 PPI). Antibody titres are plotted as mean Log2 titers + SEM.

After the intramuscular protein boost (day 70 PPI), IgG levels rapidly

increased to high IgG titres in the pcDNA1/faeG19 primed animals. Antibody levels

in the control group clearly remained lower. These findings indicate that priming of

memory had occurred in the gene gun group where no F4-specific antibodies could be

Chapter 6 : Priming of piglets by immunisation with FaeG DNA

109

detected after 3 DNA immunizations since these antibodies rapidly increased and

reached higher titers than in both controls.

6.3.3.2. Antigen-specific lymphocyte proliferation

To assess the induction of a cellular immune response, PBMC were isolated

from all pigs, 3 days after the third immunization (day 45 PPI) and 11 days after the

protein boost (day 74 PPI). Cells were re-stimulated in vitro with purified F4

whereafter antigen-specific lymphocyte proliferation was measured (Fig. 6). Although

the pigs from the gene gun group practically did not respond with measurable

antibody levels 45 days PPI, 3 out of 4 pigs did demonstrate a clear cellular immune

response.

0

2

4

6

8

10

45 74days post-primary immunisation

SI

controlIMgene gun

Figure 6 : Antigen-specific proliferation of PBMC 3 days post-tertiary immunization (day 45 PPI) and 11 days after the boost with purified F4 (day 74 PPI). Results are presented as means of the SI + SEM (n=4 for the pcDNA1/faeG19 IM and gene gun immunized groups and n=2 for the control pcDNA1 group).

Moreover, the antigen-specific proliferation in this group was better than in the

IM group where only 1 pig showed a high SI. These differences between the gene gun

and IM group however diminished after the booster immunization were both groups

showed equal proliferative responses although considerable individual variation was

observed.

Chapter 6 : Priming of piglets by immunisation with FaeG DNA

110

6.3.3.3. Cytokine expression profiles in PBMC from pigs immunized with plasmid

DNA

To assay cytokine expression profiles generated in pcDNA1/faeG19 primed

pigs, PBMC were isolated 3 weeks after IM immunisation with pcDNA1/faeG19 and

in vitro restimulated with purified F4 protein for 16 h. Pigs vaccinated with pcDNA1

served as control animals. A real-time RT-PCR technique was used for the accurate

quantification of IL-6, TNF-α, IL-1α (pro-inflammatory cytokines), IL-2, IFN-γ

(Th1-like cytokines), IL-4, IL-10 (Th2-like cytokines) and TGF-β (Th3-like

cytokine).

As demonstrated in Figure 7, PBMC from pcDNA1/faeG19 primed pigs

exhibited significantly increased IFN-γ expression upon restimulation with purified

F4 in all 4 pigs. This induction was F4-specific since this did not occur in PBMC

from any of the pigs IM immunized with the control plasmid pcDNA1 (data not

shown).

IFN-γ

020406080100120

unstim F4 stim.ratio

IFN

-g/c

yclo

*100

000 IL-4

0

2

4

6

8

unstim F4 stim.ratio

IL-4

/cyc

lo*1

0000

0

TGF-β

04080120160200

unstim F4 stim.ratio

TG

F-/c

yclo

*100

0000

Figure 7 : Cytokine expression in porcine PBMC following DNA vaccination. PBMC from pcDNA1/faeG19 (n=4) primed pigs were isolated 3 weeks after IM immunization and restimulated in vitro with 15 µg/ml purified F4 protein for 16 h. Total RNA was extracted and assayed using real-time RT-PCR. The relative amount of cytokine expression was plotted as a ratio (=copy number of target cytokine/copy number of housekeeping gene*100000). Values are given of the individual pigs.

Chapter 6 : Priming of piglets by immunisation with FaeG DNA

111

In contrast to the elevated levels of IFN-γ expression, the opposite was

observed for IL-4 (Th-2-like cytokine) and TGF-β (Th3-like cytokine) which both

showed suppression after in vitro restimulation. For IL-4 however, this was only the

case in 3 out of 4 pigs. The high IFN-γ/IL-4 ratio observed clearly reflects a Th1 type

of response indicating that in pigs IM DNA vaccination with pcDNA1/faeG19 favors

Th1-like immune responses.

No significant differences could be observed for the other cytokines (TNF-α,

IL-6, IL-1α, IL-2 and IL-10) tested.

6.4. DISCUSSION

In the present study, a heterologous prime/boost vaccination strategy using the

eukaryotic expression vector pcDNA1/faeG19, encoding the FaeG of E. coli strain

GIS 26, serotype O149/K91/F4ac, LT+STa+STb+ and purified F4 fimbriae, was

evaluated. Although immune responses were low, IM needle injection was superior to

the intradermal gene gun immunization with respect to priming of the humoral

immune responses : higher antibody levels and earlier antibody responses were

observed after protein boosting whereas the opposite was true for the cellular immune

responses. The weak antibody responses we observed after 3 successive

immunizations with pcDNA1/faeG19 have also been reported for other DNA vaccines

administered to large out-bred animals such as sheep (Chaplin et al., 1999), cattle

(Schrijver et al., 1997) and pigs (Somasundaram et al., 1999). Nevertheless, the

pcDNA1/faeG19 vaccine was shown to efficiently prime the immune system as

judged by the rapid increase in IgG antibody titres (4 to 5-fold) one week following

the protein boost with purified F4. These results are comparable to other studies

where the immune response to a primary DNA vaccine was significantly enhanced by

boosting with an immunogenic protein (Rothel et al., 1997 ; Tanghe et al., 2001 ;

Barnett et al., 1997 ; Wang et al., 2004), bacterium (Feng et al., 2001 ; Vordermaier

et al., 2003) or a virally vectored antigen (Hanke et al., 1998 ; Dégano et al., 2000 ;

Schneider et al., 1998 ; Tapia et al., 2003). A rapid anamnestic response upon

exposure with the pathogen might be critical in the swift elimination of disease before

the host is overwhelmed by the infection.

Chapter 6 : Priming of piglets by immunisation with FaeG DNA

112

Since information on the porcine cytokine profiles elicited in DNA-vaccinated

pigs is scarce, we also sought to evaluate in pigs the cytokine responses elicited after

IM immunization with pcDNA1/faeG19. It is well established that injection of DNA

by the IM route has been associated with a predominant Th1-type response (Pertmer

et al., 1995 ; Feltquate et al., 1997 ; Weiss et al., 2002 ; Raz et al., 1996; Torres et al.,

1997 ; Zhu et al., 2004). The exact mechanism of driving Th1/Th2 type responses has

not well been known, but it is often suggested that CpG motifs from bacterial plasmid

might be responsible for driving immune responses toward Th1 (Sato et al., 1996 ;

Jakob et al., 1998 ; Chu et al., 1997). Our results showed that IM priming of pigs with

pcDNA1/faeG19 also leads to the generation of PBMC, containing F4-specific

memory cells, which are characterized by a Th1-like cytokine pattern (high IFN-γ/

Low IL-4 expression) upon in vitro restimulation. TGF-β, an immunosuppressive

cytokine inhibiting the proliferation and cytokine production by effector T cells

(Gorelik and Favell, 2002), showed a diminished expression after restimulation of

PBMC from pcDNA1/faeG19 primed pigs. A suppressive effect on TGF-β expression

could positively contribute to the Th1 cytokine response observed.

The reasons for the low immunogenicity of DNA vaccines in larger animals

are unclear. Studies in mice and sheep have shown that the timing, magnitude and

longevity of the antibody response can be enhanced by targeting the DNA to APCs

(Chaplin et al., 1999). Encouraging results in large animals were also obtained by

adsorption of DNA onto cationic poly(lactide-coglycolide)(PLG) microparticles

which resulted in increased humoral and cellular immune responses by facilitating

non-specific targeting (O’Hagan et al., 2001 ; Singh et al., 2002). Furthermore,

intramuscular co-injection of plasmids encoding GM-CSF enhanced the immune

response in mice (Haddad et al., 2000) as well as in pigs (Somasundaram et al., 1999)

and sheep (Scheerlinck et al., 2001) probably by increasing the number of APCs

trafficking through the site of vaccination.

A number of mechanisms can also be applied to enhance the expression of the

prokaryotic antigen in an eukaryotic host. Preliminary in vitro results on the

introduction of a Kozak consensus sequence in our pcDNA1/faeG19 vector through

substitution of the T in position –3 by an A or G, showed increased levels of rFaeG

expression in ELISA and IF studies. Moreover, protein expression can be improved

when the native bacterial codons inserted into the eukaryotic expression plasmid are

Chapter 6 : Priming of piglets by immunisation with FaeG DNA

113

substituted with the eukaryotic optimal codons (Narum et al., 2001; Uchijima et al.,

1998 ; Deml et al., 2001). The codon adaptation index (CAI) for the faeG gene in pigs

was calculated as described elsewhere (Sharp and Li, 1987). With a CAI of 0.542,

designing a codon-optimised faeG gene might enhance the expression and

immunogenicity of the faeG DNA vaccine.

The usefulness of purified DNA as a vaccine approach against bacteria which

replicate extracellularly has been questioned because a DNA vectored antigen is

synthesised and processed intracellular (Saikh et al., 1998). However, in the case of

CFA/I fimbriae of ETEC, antibody responses could significantly be improved with

plasmid vectors promoting the secretion of the encoded antigens (Alves et al., 2001 ;

Boyle et al., 1997). Moreover, protective antibody responses against ETEC, as well as

other enteric non-invasive pathogens, mainly require activation of local IgA

production. This is however not the case in our study using DNA plasmids where IgA

antibodies could not be detected even after the protein boost. To surmount this

shortcoming, attempts to deliver DNA to mucosal surfaces have relied with success

on live Salmonella and Shigella vaccine vectors (Darji et al., 1997 ; Sizemore et al.,

1995), intranasal administration of DNA-lipid complexes (Okada et al., 1997) or

targeting of DNA vaccines towards M-cells using protein σ1-polylysine-DNA

complexes (Wu et al., 2001).

In summary, although vaccination of pigs with DNA encoding FaeG

efficiently primed the immune system, elicited responses were no better than

responses previously reported for DNA vaccination in large animals. Further

investigation into the delivery parameters and improvement of the expression of the

faeG gene in pigs may enhance the efficacy of the DNA vaccine.

ACKNOWLEDGEMENTS

This work was supported by the Research Fund of the University of Ghent.

We thank Thierry van den Berg from the Veterinary and Agrochemical Research

Centre (CODA) for the use of and technical assistance with the Helios gene gun.

Chapter 7 : Immunostimulatory capacity of DNA vaccine vectors in porcine PBMC

114

Chapter 7

IMMUNOSTIMULATORY CAPACITY OF DNA VACCINE

VECTORS IN PORCINE PBMC : A SPECIFIC ROLE

FOR CpG-MOTIFS?1

1 Based on : Verfaillie T, Cox E, Goddeeris B, (2005) Immunostimulatory capacity of DNA vaccine vectors in porcine PBMC : a specific role for CpG-motifs? Vet. Immunokl. Immunopathol. 103 : 141-151.

Chapter 7 : Immunostimulatory capacity of DNA vaccine vectors in porcine PBMC

115

ABSTRACT

With the development of DNA vaccines in pigs, the possibility was investigated

that the nature and the amount of certain CpG motifs present on plasmid DNA might

have an effect on their immunostimulatory capacity. A panel of three CpG-

oligodeoxynucleotides (ODN) and three eukaryotic expression vectors currently used in

experimental DNA vaccines in pigs (pcDNA1, pcDNA3.1 and pCI) were screened for

their immunostimulatory activity on porcine PBMC by evaluating in vitro the

lymphocyte proliferative responses and cytokine profiles (IL-1α, IL-2, IL-4, IL-6, IL-

10, IFN-γ, TGF-β, TNF-α). The vectors were choosen so that they differed in number

and nature of certain CpG-motifs present on their backbone. CpG-ODN A

(5’ATCGAT3’) and to a lesser extend CpG-ODN C (5’AACGTT3’) significantly

enhanced the proliferation of porcine PBMC in contrast to CpG-ODN B

(5’GACGTT3’) where no effect was observed. Furthermore, CpG-ODN A significantly

induced IL-6 and TNF-α together with elevated levels of IFN-γ and IL-2 mRNA

expression even though considerable heterogeneity was observed in the response of

individual pigs. Comparison of the 3 vectors showed significantly increased

proliferative responses for both pcDNA3.1 and pCI combined with a significant

increase in IL-6 mRNA levels for pCI. For pcDNA1, proliferation was absent together

with significantly decreased levels of IL-6 and IFN-γ. CpG-ODN and plasmids both

suppressed the TGF-β and IL-1α mRNA expression. Taken together, these data

confirm the identity of an optimal immunostimulating CpG-motif in pigs (5’-

ggTGCATCGATGCAG-3’) and demonstrates that the choice of the vector or the

insertion of immunostimulatory motifs can be important in the future design of DNA

vaccines pigs, although further research is necessary to explore the possible link

between certain CpG-motifs and the immunogenicity of DNA vaccines.

Keywords : CpG-ODN, plasmids, pig, cytokines, immunostimulation

1. INTRODUCTION

Bacterial DNA has a much higher frequency of CpG dinucleotides than mammalian

DNA. Furthermore, bacterial CpG dinucleotides are often unmethylated (Krieg et al.,

Chapter 7 : Immunostimulatory capacity of DNA vaccine vectors in porcine PBMC

116

1995). It is thought that these two features in combination with specific flanking bases

constitute a CpG motif that is recognised as a danger signal by the innate immune

system of mammals. The recognition of CpG motifs by the innate immune system is

species-specific (Kannellos et al., 1997 ; Bauer S. et al., 2001) and requires

engagement of the Toll-like receptor 9 (TLR-9), which activates intracellular signalling

pathways (Hemmi et al., 2000). The diverse immunostimulating effects of CpG DNA,

or synthetic oligodeoxynucleotides (ODN) containing these motifs are becoming well

esthablished in mice and humans. They can enhance B cell survival, influence dendritic

cell differentiation and induce cytokine secretion by B cells, monocytes, natural killer

(NK) cells and dendritic cells (Ballas et al., 1996 ; Krieg et al., 1995 ; Davis et al.,

1998 ; Hartmann et al., 1999). Overall, CpG DNA induces a Th1-like pattern of

cytokine production accompanied with Th-1 type-dominated immune responses (Chu et

al., 1997 ; Roman et al., 1997 ; Jakob et al., 1998 ; Lipford et al., 1997). Today

evidence is accumulating from both in vitro and in vivo studies that CpG-ODN can also

activate the immune system in a variety of domestic species including cattle, sheep,

pigs, horses, dogs, cats and chickens (Mutwiri et al., 2003 ; Brown et al., 1998 ;

Kamstrup et al., 2001 ; Rankin et al., 2001 ; Rankin et al., 2002 ; Zhang et al., 2001 ;

Pontarollo et al., 2002 ; Wernette et al., 2002, Van der Stede et al., 2002 ; Alcon et al.,

2003). The identification of this immunostimulatory capacity of bacterial DNA has also

given new insight into the mode of action of some adjuvant components including

bacterial plasmids used in DNA vaccination (Tighe et al., 1998 ; McCluskie et al.,

2000). In mice, there is evidence that the presence of CpG motifs within the plasmid

construct used in DNA vaccines can contribute significantly to the immune response

(Sato et al., 1996). Moreover, the insertion of an optimal number of immunostimulatory

CpG motifs can even enhance these responses (Krieg et al., 1998 ; Ma et al., 2002 ;

Kojima et al., 2002). In this context, the choice of the vector used in a DNA vaccine

could be an important factor to consider.

The current development of DNA vaccines for use in veterinary medicine and

the species-specificity of the CpG-motifs stress the importance to determine the

immunostimulatory capacity of bacterial DNA in various species. The aim of the

present study was therefore to determine whether the nature and the amount of certain

CpG motifs present on plasmid DNA have an effect on their immunostimulatory

capacity in pigs. The lymphocyte proliferative responses and the cytokine-inducing

capacity of 3 different eukaryotic expression vectors (pcDNA1, pcDNA3.1 and pCI),

Chapter 7 : Immunostimulatory capacity of DNA vaccine vectors in porcine PBMC

117

currently used in experimental DNA vaccines in pigs, and of several synthetic CpG-

ODN sequences were evaluated and compared.

2. MATERIAL AND METHODS 2.1. Oligodeoxynucleotides

All ODN (Table 1) were diluted in TE buffer (10mM Tris, pH 7, and 1mM

EDTA) at a concentration of 1 mg/ml and stored at –20°C. For in vitro proliferation

assays, the CpG-ODN were diluted to optimal concentrations in leukocyte medium

(RPMI-1640 supplemented with penicillin (100 IU/ml), streptomycin (100 µg/ml),

kanamycin (100 µg/ml), L-glutamin (200 mM), sodium pyruvate (100mM), non-

essential aminoacids (100mM), β-mercaptoethanol (5.10-5 M) and 5% (vol/vol) FCS.

Table 1 : CpG-ODN and eukaryotic expression vectors used for in vitro stimulation of porcine PBMC

CpG-ODN

Vectors

Motif

pcDNA1

pcDNA3.1

pCI

A : ggTGCATCGATGCAGggggg

---

---

1X

B: ggGCTAGACGTTAGCGTggggg [BM : ggGCTAGAZGTTAGZGTggggg] [BREV : ggGCTAGAGCTTAGGCTggggg]

---

2X

1X

C : ggTGCAACGTTGCAGggggg

1X

2X

2X

Phosphodiester nucleotides are shown in upper cases and phosphorothioate nucleotides are shown in lower cases (g-stretch). The methylated [BM] and reverse [BREV] form of motif B serve as controls. Z = 5-methylcytosine.

The CpG-ODN used were synthetised with a chimeric phosphodiester/-

phosphorothioate ODN since it has been shown in several studies that PTO

modification is necessary to ensure activity by increasing the resistance towards

Chapter 7 : Immunostimulatory capacity of DNA vaccine vectors in porcine PBMC

118

nuclease digestion (Klinman et al., 1996 ; Krieg et al., 1995). Secondly, CpG-ODN had

additional G-stretches at both ends which are reported to be immuno-enhancing by

helping non-specific uptake of the ODN by APC (Pisetsky and Reich, 1998 ; Wloch et

al., 1998 ; Dalpke et al., 2002).

2.2. Eukaryotic expression vectors

The plasmids pcDNA3.1 (Invitrogen, Leek, The Netherlands) and pCI

(Promega, Leiden, The Netherlands) were propagated in E. coli DH5α. The plasmid

pcDNA1 (Invitrogen, Leek, The Netherlands) was propagated in E. coli MC1061/P3.

Strains were grown in Luria Broth or Luria Agar supplemented with ampicillin

100µg/ml. All plasmids (Table 1) were purified using the Endofree Plasmid Maxi or

Mega kit (Qiagen, Germany).

2.3. Preparation of cells and cell culture

Blood from four weaned 8-12 weeks old outbred pigs (Belgian Landrace) was

sampled from the jugular vein on Alsever’s solution (50% vol/vol). Peripheral blood

monomorphonuclear cells (PBMC) were isolated by density gradient centrifugation

using Lymphoprep (Invitrogen, Merelbeke, Belgium) as described previously (Van den

Broeck et al., 1999). After lysis of the erythrocytes in ammoniumchloride (0.8%

[wt/vol]), the PBMC were washed 3 times and subsequently resuspended at the

concentration of 4.106 cells/ml in leukocyte medium.

2.4. Lymphocyte proliferation assays

PBMC were brought into wells of flat-bottem-microtiter plates (Greiner Bio One)

at 4 x 105 cells/well in 200 µl leukocyte medium containing 20 or 10 µg/ml of an ODN,

50 µg/ml of a vector or 10 µg/ml concanavalin A (ConA). Each condition was tested in

triplicate on cells of four different pigs. The cells were incubated for 3 days at 38°C in a

humidified atmosphere of 5% CO2 after which one µCi of 3H-thymidine (Amersham

ICN, Bucks, UK) was added for 18 h. Then, the cells were harvested onto glass fiber

filtermats (Perkin Elmer, Life Science, Oosterhout, Netherlands) and radioactive DNA

was measured in a β-scintillation counter (Perkin Elmer). Stimulation indices (SI) were

Chapter 7 : Immunostimulatory capacity of DNA vaccine vectors in porcine PBMC

119

calculated as the ratio of the mean cpm of the stimulated PBMC (triplicates of cultures

of cells with addition of ODN) over the mean cpm of the media control (neither ODN

nor ConA). PBMC were stimulated with 10 µg/ml ConA as a positive control.

2.5. RNA extraction and real-time RT-PCR

RNA was extracted from the ODN- and plasmid-stimulated PBMC at 12 and 24

hours post-stimulation (PS) using the acid guanidinium-isothiocyanate phenol-

chloroform-based method (RNAgents®, Promega, Leiden, The Netherlands) as

described by Verfaillie et al.(2001).

Reverse transcription was performed by pre-incubating 3 µg of total RNA with

1 µl of random hexamers (12.5 µM final concentration)(Perkin Elmer, Branchburg,

USA) during 10 min at 70°C. After chilling on ice, 5 mM MgCl2, 1 x PCR buffer (10

mM Tris-HCl (pH 8.3), 50 mM KCl), 1 mM dNTP mix (Roche, Mannheim, Germany),

20 U of Rnasin® Ribonuclease inhibitor (Promega) and 200 units of Superscript II

Rnase H- reverse transcriptase (Gibco BRL) were added. The reaction mix was

incubated at room temperature for 10 min followed by 10 min at 42°C. Finally, samples

were heated at 95°C for 5 min to denature the reverse transcriptase.

The oligonucleotide primers used for the detection of the porcine cytokines IL-

1α, IL-2, IL-4, IL-6, IL-10, IFN-γ, TGF-β, TNF-α and of cyclophilin cDNA were

designed from the published nucleic acid sequences available from GenBank/EMBL

databases (Table 2). Cyclophilin was used as constitutively expressed 'housekeeping

control gene’ to determine the uniformity of the reverse transcription reactions and as a

reference for quantification of cytokine mRNA (Dozois et al., 1997).

Chapter 7 : Immunostimulatory capacity of DNA vaccine vectors in porcine PBMC

120

Table 2 :Oligonucleotide primers and fragment length of PCR products for different porcine cytokines

cytokine Primers (5’-3’) Length PCR

fragment

Genbank accession number

IL-1α

(S) TGCCAGCTATGAGCCACTTCC

(AS) TGACGGGTCTCGAATGATGCT

336

X52731

IL-2

(S) GATTTACAGTTGCTTTTGAAG (AS) GTTGAGTAGATGCTTTGACA

338

X56750

IL-4

(S) TACCAGCAACTTCGTCCA

(AS) ATCGTCTTTAGCCTTTCCAA

311

F68330

IL-6

(S) ATGAGAATCACCACCGGTCTTG (AS) TGCCCCAGCTACATTATCCGA

310

M86722

IL-10

(S) CCATGCCCAGCTCAGCACTG

(AS) CCCATCACTCTCTGCCTTCGG

295

L20001

IFN-γ

(S) ATGTACCTAATGGTGGACCTC

(AS) CTCTCTGGCCTTGGAACATAG

360

X53085

TGF-β

(S) GACCCGCAGAGAGGCTATAG (AS) GAGCCAGGACCTTGCTGTAC

399

Y00111

TNF-α

(S)

CAAGGACTCAGATCATCGTCTCA (AS) CATACCCACTCTGCCATTGGA

100

X54859

Cyclophilin

(S) TAACCCCACCGTCTTCTT

(AS) TGCCATCCAACCACTCAG

368

F14571

(S) : sense ; (AS) : antisense

Real-time PCR was carried out with the LightCycler® and the LightCycler-

faststart DNA Master SYBR Green I kit (Roche, Mannheim, Germany). The reaction

mixture consisted of a mastermix containing Taq polymerase, dNTP mixture and

Chapter 7 : Immunostimulatory capacity of DNA vaccine vectors in porcine PBMC

121

SYBR Green I, 3 (IL-1α, IL-4, IL-6, IL-10, IFN-γ, TNF-α, TGF-β) or 4 (IL-2,

Cyclophilin) mM MgCl2, 0.3 µM of each primer and 2 µl of template cDNA in a total

volume of 20 µl. After heating the samples at 95°C for 10 min, the temperature cycling

(35-40 cycli) consisted of denaturation at 94°C for 15 s, annealing at 53°C

(cyclophilin), 56°C (TGF-β), 60°C (IL-2, IL-6, IL-10), 62°C (IFN−γ) 67°C (TNF-α) or

68 (IL-1α) for 5 s and extension at 72°C for 7-16 s depending on the length of the

product (~ 1s/25bp). Fluorescence acquisition was measured at 77°C (IL-2), 79°C

(IFN-γ), 81°C (IL-1α), 82°C (IL-6, cyclophilin), 85°C (IL-10) or 86°C (IL-4, TGF-

β, TNF-α) in single mode. Melting curve analysis was done at 65 to 98°C with

continuous fluorescence acquisition. As an additional control of specificity, PCR

products were subjected to agarose gel electrophoresis, if necessary. Quantification

occurred using external standards of cytokine cDNA. The number of copies of each

sample transcript was determined with the aid of the LightCycler software and relative

amounts of cytokine-expression were plotted as a ratio (copy number of target

cytokine/copy number of housekeeping gene*1000).

2.6. Statistical analysis

The data from the lymphocyte proliferation assays were analysed using the

statistical software program SPSS. A one-way ANOVA was used to estimate the effect

of ODN on proliferation. SI values were log10 transformed and used as the dependent

variable. The Bonferroni adjustment for multiple comparisons was applied to evaluate

the significant differences among the ODN-sequences. P < 0.05 was considered as

statistically significant.

For the quantification of the cytokines by real-time RT-PCR, a correction was

made for the variations between the different samples by using cyclophilin as a

housekeeping gene and results are presented as a ratio. The ratio’s of the individual pigs

were grouped and the differences in the mean between the stimulated and control

groups were tested for statistical significance with a paired-sample t-test. Because the

results are not normally distributed, the data were log-transformed before statistical

evaluation. Statistical significance was assessed at a P value of < 0.05.

Chapter 7 : Immunostimulatory capacity of DNA vaccine vectors in porcine PBMC

122

3. RESULTS

The presence of the different CpG-ODN in the eukaryotic expression vectors is

presented in Table 1. The motif ATCGAT (CpG-ODN A) was tested since Kamstrup et

al. (2001) demonstrated in vitro that it was highly immunostimulatory for porcine

PBMC. The GACGTT motif (CpG-ODN B) was in vitro shown to be

immunostimulatory in mice (Krieg et al., 1995) and in vivo in pigs (Van der Stede et

al., 2002). The third CpG-ODN C tested is the AACGTT motif. It is present twice in

the ampicillin resistence gene which frequently can be found on eukaryotic expression

vectors. The reversed and methylated forms of CpG-ODN B (BREV and BM) were used

as controls since they should be less immunostimulatory. The vectors tested in the

present study are chosen for their differences in the amount and nature of these CpG-

ODN. pcDNA1 possesses only motif C (1 copy within the M13 ori). The vectors

pcDNA3.1 and pCI each contain 4 motifs of which 2 motifs C, situated in the

ampicillin resistence gene. pCDNA3.1 also possesses 2 motifs B (1 between the poly A

site and the f1 ori and the second within the neomycin resistence gene) but no motif A,

whereas pCI possesses 1 motif A (between the poly A site and the f1 ori) and 1 motif B

(within the f1 ori).

3.1. Lymphocyte proliferative responses of porcine PBMC induced by plasmid

DNA and CpG-ODN

Lymphocyte proliferation assays with the CpG-ODN revealed that CpG-ODN A

was by far the most effective in inducing proliferation (Fig. 1). Spontaneous

proliferation (cpm of control medium cultures) varied between 136 and 1984 cpm. The

cpm after addition of ConA varied between 20669 and 190610 cpm. The mean SI for

CpG-ODN A was significantly higher (P < 0.01) than those induced by the control

ODNs (BREV and BM). This effect was observed using either 20 or 10 µg/ml of CpG-

ODN, although more pronounced with the higher dose. CpG-ODN C could only induce

moderate proliferative responses at a dose of 20 µg/ml with SI that were significantly

higher (P < 0.05) than those of the control ODN. CpG-ODN B was unable to induce

proliferation. The methylated or reversed form of the CpG-ODN B did not induce any

proliferation and had SI between 0.5 and 2 (data not shown).

Chapter 7 : Immunostimulatory capacity of DNA vaccine vectors in porcine PBMC

123

Figure 1 : Lymphocyte proliferative responses of porcine PBMC cultured with CpG-ODN A, B or C (20 µg/ml (black bars) and 10 µg/ml (gray bars)) or pcDNA1, pcDNA3.1 or pCI plasmids (50 µg/ml). Cells were cultured in triplicate at 4.105 cells per well for 72 hours, labelled with 3H-thymidine and incubated for an additional 18 hours. The stimulation index (SI) was calculated by dividing the mean cpm of the stimulated wells by the mean cpm of unstimulated wells for each animal. Data are presented as the means + SEM (CpG-ODN (n = 4) ; plasmids (n = 3)). Significant differences between CpG-ODN A, B or C vs the control CpG-ODN BM and BREV and between pcDNA3.1 or pCI vs pcDNA1 are indicated with ** (P < 0.01) or * (P < 0.05).

Proliferative responses of porcine PBMC induced by plasmid DNA displayed

also differences (Fig. 1). Both pcDNA3.1 and pCI showed a significant increase in cell

proliferation (P < 0.05) with SI of 5.14 and 4.38 respectively compared to pcDNA1

that was unable to induce proliferation (SI = 1.06).

3.2. Induction of cytokines in cultures of porcine PBMC by CpG-ODN

PBMC cultures were analysed for their cytokine expression profile by real-time

RT-PCR (IL-6, TNF-α, IL-1α (pro-inflammatory cytokines), IL-2, IFN-γ (Th1-like

cytokines), IL-4, IL-10 (Th2-like cytokines) and TGF-β (Th3-like cytokine), 12 and 24

hours after stimulation with CpG-ODN. Overall, the relative amount of cytokine

mRNA expression showed a high variation among the animals. Porcine PBMCs

responded to CpG-ODN A with the induction of IL-6, TNF-α, IL-2 and IFN-γ mRNA

expression (Fig. 2). However, only the differences for IL-6 and TNF-α were

statistically significant 12 hrs PS (P < 0.05). Stimulation of the PBMCs with either

CpG-ODN B, BM, BREV or C did not result in the induction of cytokines (data not

shown). In contrast to the elevated levels of the above mentioned cytokines, TGF-β and

IL-1α mRNA expression seemed to be suppressed for all three CpG-ODN at 12 as well

as 24 hrs PS although results were not statistically significant due to the high variation

CpG-ODN

0

20

40

60

80

A B C

SIPlasmid DNA

0

2

4

6

8

pcDNA3,1 pCI pcDNA1

SI

**

** *

* *

Chapter 7 : Immunostimulatory capacity of DNA vaccine vectors in porcine PBMC

124

between individual piglets (Fig. 3). For IL-4 and IL-10 (Th-2 like cytokines), no

influence of the CpG-ODN could be observed.

IL-6

0

25

50

75

12 h PS 24 h PS

IL-6

/cyc

loph

ilin*1

000

*TNF-a

0

25

50

75

100

12 h PS 24 h PS

TNF-

a/cy

clop

hilin

*100

0

IL-2

0

10

20

30

12 h PS 24 h PS

IL-2

/cyc

loph

ilin*1

000

IFN-g

0

10

20

30

12 h PS 24 h PS

IFN-

g/cy

clop

hilin

*100

0

Figure 2 : Cytokine mRNA expression (IL-6, TNF-α, IL-2 and IFN-γ) by porcine PBMC stimulated for 12 and 24 hours with 10 µg/ml CpG-ODN A (gray bars) or medium (black bars). The relative amount of cytokine expression was plotted as a ratio (=copy number of target cytokine/copy number of housekeeping gene*1000) + SEM. Significant differences (P < 0.05) between the CpG-ODN A-stimulated and the unstimulated PBMCs are indicated with *.

TGF-B

0

500

1000

1500

2000

2500

12 hrs PS 24 hrs PS

TGF-

b/cy

clop

hilin

*100

0

IL-1

0

20

40

60

12 hrs PS 24 hrs PS

IL-1

/cyc

loph

ilin*1

000

Figure 3 : TGF-β and IL-1α mRNA expression by porcine PBMC stimulated for 12 and 24 hours with 10 µg/ml CpG-ODN A (dotted bars), CpG-ODN B (vertically striped bars), CpG-ODN C (horizontally striped bars) or medium (black bars). Results are presented as described in Figure 2.

*

Chapter 7 : Immunostimulatory capacity of DNA vaccine vectors in porcine PBMC

125

3.3. Induction of cytokines in cultures of porcine PBMC by different eukaryotic

expression vectors

Results show that pCI was able to induce significantly higher levels of IL-6

mRNA, 24 hours PS whereas pcDNA1 and pcDNA3.1 did not (Fig. 4). On the contrary,

pcDNA1 reduced significantly the mRNA levels of IL-6, 24 hours PS (P < 0,05). With

respect to TGF-β and IL-1α, again suppression was observed for all three vectors with

statistical significancy for pCI (TGF-β and IL-1α) and pcDNA1 (TGF-β). No effect of

the vectors was detectable for IL-2, TNF-α and IL-10 whereas IL-4 could not be

detected at all.

IL-6

0

10

20

30

40

12 hrs PS 24 hrs PS

IL-6

/cyc

loph

ilin*1

000

TGF-b

0

700

1400

2100

2800

3500

12 hrs PS 24 hrs PS

TGF-

b/cy

clop

hilin

*100

0

IFN-g

0

10

20

30

40

12 hrs PS 24 hrs PS

IFN-

g/cy

clop

hilin

*100

0

IL-1

0

10

20

30

12 hrs PS 24 hrs PS

IL-1

/cyc

loph

ilin*1

000

Figure 4 : Cytokine mRNA expression by porcine PBMC stimulated for 12 and 24 hours with 50 µg/ml pcDNA1 (dotted bars), pcDNA3.1 (vertically striped bars), pCI (horizontally striped bars) or medium (black bars). Results are presented as described in Figure 2. Significant differences (P < 0.05) between the plasmid DNA-stimulated and the unstimulated PBMCs are indicated with *.

4. DISCUSSION

Although DNA vaccines work extremely well in mice, they have not been found

to be very effective in large outbred animals (Somasundaram et al., 1999 ; Schrijver et

*

*

*

*

*

*

*

Chapter 7 : Immunostimulatory capacity of DNA vaccine vectors in porcine PBMC

126

al., 1997 ; Chaplin et al., 1999). As such, considerable efforts are being made to

improve DNA vaccines through rational design. In mice, there is evidence that the

presence of CpG motifs within the backbone of DNA vaccine vectors contributes

significantly to the immune response (Sato et al., 1996 ; Cardoso et al., 1998 ; Fu et al.,

1998 ; Raz and Spielberg, 1999). If such CpG motifs are methylated, immune responses

are significantly reduced (Leclerc et al., 1997). Conversely, insertion of an optimal

number of immunostimulatory CpG motifs can enhance immune responses (Krieg et

al., 1998 ; Ma et al., 2002 ; Kojima et al., 2002). In contrast, studies conducted by

Encke et al. (2003) comparing plasmid backbones with ampicillin (pcDNA3) and

kanamycin (pAp), which have different numbers of CpG motifs, did not demonstrate

any difference with respect to the strenght of the humoral immune responses.

Little is known about the in vitro and in vivo effect of specific

immunostimulatory CpG motifs in DNA vaccines for species other than mice. Recent

studies in cattle indicated that increasing the number of the 5’GTCGTT3’ motif in the

plasmid backbone can induce a dose-dependent enhancement of antigen-specific

cellular immune responses (Pontarollo et al., 2002). In pigs, pcDNA3 can induce

production of IFN-α and low levels of IL-6 when added to cultures of porcine cells

(Magnusson et al., 2001 ; Johansson et al., 2002). In order to identify a good

immunostimulatory vector for our DNA vaccin against enterotoxigenic E. coli

(Verfaillie T. et al., 2004), we evaluated in vitro the immunostimulating properties of

this vector compared to pcDNA3.1 and pCI, other vectors frequently used in DNA

vaccines.

First, immunostimulating capacities of 3 different CpG motifs present in these

vectors were determined. The CpG-ODN identified as the most immunostimulatory for

pig PBMCs in this study was CpG-ODN A containing the palindromic hexamer

5’ATCGAT3’. This confirms a previously reported study by Kamstrup et al.(2001) in

which this CpG-ODN was found optimal for inducing proliferation and the secretion of

IL-6, IL-12 and TNF-α in porcine PBMCs. Although results by Kamstrup et al. were

obtained 6 hr PS we still found significantly increased IL-6 and TNF-α levels 12 hr PS.

Effects diminished or disappeared completely 24 hrs PS. Consistent with the increased

IL-12 production demonstrated by Kamstrup et al., we detected also increased levels of

IFN-γ and IL-2 mRNA (Th1-like cytokines) as observed in other mammalian species

such as mice, humans and cattle (Hartmann et al., 2000 ; Klinmann et al., 1996 ;

Chapter 7 : Immunostimulatory capacity of DNA vaccine vectors in porcine PBMC

127

Yamamoto et al., 1994 ; Zhang et al., 2001). The mouse-specific motif B had no

immunostimulating effect on porcine PBMCs in vitro as opposed to the in vivo findings

of Van der Stede et al. (2002, 2003) in pigs, when used as an adjuvant in IM

immunisation experiments. Caution is thus recommended for extrapolation of in vitro

results. The third motif 5’AACGTT3’ which is also stimulatory in mice had

comparable effects in pigs as described earlier in cattle with moderate proliferative

responses but no apparent induction of cytokines (Brown et al., 1998).

As far as the vectors are concerned, our results clearly showed that pcDNA1 had

no immunostimulating activity on both proliferation as well as on cytokine-induction

when compared to pcDNA3.1 and pCI. The vector pCDNA1 contains only one of the

above studied CpG-motifs, namely motif C, in contrast with pcDNA3.1 abd pCI

containing two and tree different CpG-motifs, respectively. However, the results of this

study cannot directly correlate the effects of the plasmids with the presence or absence

of certain CpG-ODN alone. In addition, another motif (5’GTCGTT3’) described by

Rankin et al. (2001), that also seems to be immunostimulatory in pigs, was found on all

three vectors (pcDNA3.1 (4X), pCI (3X) and pcDNA1 (2X)). This motif was not

evaluated in the present study but since it is present on all three vectors, it most likely

does not account for the differences observed. Sequences known as “neutralising”

motifs can counteract stimulatory CpG motifs and can also be found in DNA vaccine

vectors. The immunogenicity of a DNA vector may therefore depend on the balance

between stimulatory and neutralising motifs and if so, their efficacy might be improved

through the removal of neutralising motifs and addition of species-specific stimulatory

CpG motifs (Davis, 2000 ; Zhao et al., 2000 ; Ma et al., 2002). Neutralising motifs as

described in mice (direct repeats of CpG dinucleotides and/or CpG’s preceded by a C

and/or followed by a G (Krieg et al., 1998)) can also not explain the low

immunogenicity of pcDNA1 in vitro since equal amounts can be found on both

pcDNA1 and pCI with pcDNA3.1 even containing 20 % more. However, since the

immunostimulating capacity of CpG-motifs is species-specific and studies on

neutralising motifs are mostly done in mice, other neutralising sequences could

therefore play a role in pigs.

When we compare the proliferative responses of CpG-ODN and vectors, CpG-

ODN showed a higher stimulative capacity. This could be due to the fact that, although

the concentration of plasmid DNA added to the PBMC is higher (50 versus 20/10

µg/ml), the actual number of copies is much lower due to the higer molecular weight of

Chapter 7 : Immunostimulatory capacity of DNA vaccine vectors in porcine PBMC

128

the plasmids. Secondly, different structures (linear, modified CpG-ODN versus circular

plasmid DNA) may result in differences in stability and uptake in the cell cultures.

Although cellular uptake mechanisms of plasmid DNA (pDNA) in cells is poorly

understood, several studies showed that pDNA is efficiently taken up via a scavenger

receptor-like mechanism and in a specific manner (Takagi et al., 1998 ; Takakura etal.,

1999 ; Yasuda et al., 2004). Thereafter, pDNA is transported to the endosomal

compartment for recognition by TLR-9 and activation of the cells by the same

mechanism as that reported for CpG-ODN (Yi et al., 1998 ; Ahmad-Nejad et al., 2002).

Comparing the cytokine production of CpG-ODN and vectors, we could

speculate that since only CpG-ODN A (containing 5’ATCGAT3’) was able to induce

cytokine expression, this motif also is responsible for the IL-6 production by pCI, the

only vector possessing such motif. In contrast to our results, Magnusson et al. (2001)

observed weak IL-6 production by pcDNA3 in pig PBMC 18 hours PS using the same

amount of plasmid DNA. Interesting is that both CpG-ODN as well as the vectors all

showed suppressive effects on the production of TGF-β and IL-1α. One of the most

potent activities of TGF-β on lymphocytes is its anti-proliferative effect, together with

the fact that TGF-β inhibits the effects and/or the production of several cytokines

including IFN-γ, TNF-α and IL-2. So, a suppressive effect on TGF-β expression could

possible contribute to the immunostimulating activity of CpG-motifs. It should be

remarked that the suppression of IL-1, however is less advantageous, due to decreased

pro-inflammatory responses. Stimulation with the motif 5’GTCGTT3’ in cattle also

showed low to absent IL-1 levels (Zhang et al., 2001).

In conclusion, different eukaryotic expression vectors can exert different

biological activities in pigs. To enable the design of good immunogenic DNA vaccines,

it could be important to further identify in various species the immuno-stimulating

and/or -neutralising sequences present on DNA vaccine vectors.

129

References Abbas AK, Murphy KM, Sher A. (1996) Functional diversity of helper T lymphocytes. Nature. 383(6603):787-93. Afkarian M, Sedy JR, Yang J, Jacobson NG, Cereb N, Yang SY, Murphy TL, Murphy KM. (2002) T-bet is a STAT1-induced regulator of IL-12R expression in naive CD4+ T cells. Nat Immunol. 3(6):549-57. Agarwal S, Avni O, Rao A. (2000) Cell-type-restricted binding of the transcription factor NFAT to a distal IL-4 enhancer in vivo. Immunity. 12(6):643-52. Agarwal S, Rao A. (1998) Modulation of chromatin structure regulates cytokine gene expression during T cell differentiation. Immunity. 9(6):765-75. Ahmad-Nejad P, Hacker H, Rutz M, Bauer S, Vabulas RM, Wagner H (2002) Bacterial CpG-DNA and lipopolysaccharides activate Toll-like receptors at distinct cellular compartments. Eur J Immunol. 32(7):1958-68. Akiba H, Miyahira Y, Atsuta M, Takeda K, Nohara C, Futagawa T, Matsuda H, Aoki T, Yagita H, Okumura K. (2000) Critical contribution of OX40 ligand to T helper cell type 2 differentiation in experimental leishmaniasis. J Exp Med. 191(2):375-80. Albright JW, Zuniga-Pflucker JC, Albright JF. (1995) Transcriptional control of IL-2 and IL-4 in T cells of young and old mice. Cell Immunol. 164(2):170-5. Alcami A. (2003) Viral mimicry of cytokines, chemokines and their receptors. Nat Rev Immunol. 3(1):36-50. Alcon VL, Foldvari M, Snider M, Willson P, Gomis S, Hecker R, Babiuk LA, Baca-Estrada ME (2003) Induction of protective immunity in pigs after immunisation with CpG Oligodeoxinucleotides formulated in a lipid-based delivery system (BiphasixTM). Vaccine 21, 1811-1814. Alves AMB, Lasaro MO, Almeida DF, Ferreira LCS (2001) DNA immunisation against the CFA/I fimbriae of enterotoxigenic Escherichia coli (ETEC). Vaccine 19 : 788-795. An LL, Rodriguez F, Harkins S, Zhang J, Whitton JL (2000) Quantitative and qualitative analyses of the immune responses induced by a multivalent minigene DNA vaccine. Vaccine. 18(20):2132-41. Annunziato F, Galli G, Cosmi L, Romagnani P, Manetti R, Maggi E, Romagnani S. (1998) Molecules associated with human Th1 or Th2 cells. Eur Cytokine Netw. 1998 Sep;9(3 Suppl):12-6. Assenmacher M, Lohning M, Scheffold A, Manz RA, Schmitz J, Radbruch A. (1998) Sequential production of IL-2, IFN-gamma and IL-10 by individual staphylococcal enterotoxin B-activated T helper lymphocytes. Eur J Immunol. 28(5):1534-43. Assenmacher M, Schmitz J, Radbruch A. (1994) Flow cytometric determination of cytokines in activated murine T helper lymphocytes: expression of interleukin-10 in interferon-gamma and in interleukin-4-expressing cells. Eur J Immunol. 24(5):1097-101. Babiuk LA, van Drunen Littel-van den Hurk, Babiuk SL (1999) Immunization of animals: from DNA to the dinner plate. Vet Immunol Immunopathol. 72(1-2):189-202. Babiuk S, Baca-Estrada ME, Foldvari M, Storms M, Rabussay D, Widera G, Babiuk LA (2002) Electroporation improves the efficacy of DNA vaccines in large animals. Vaccine. 20(27-28):3399-3408. Bach JF (2003) Regulatory T cells under scrutiny. Nat Rev Immunol. Mar;3(3):189-98. Bach EA, Szabo SJ, Dighe AS, Ashkenazi A, Aguet M, Murphy KM, Schreiber RD. (1995) Ligand-induced autoregulation of IFN-gamma receptor beta chain expression in T helper cell subsets. Science. 270(5239):1215-8. Baggiolini M (1998) Chemokines and leukocyte traffic. Nature. 392(6676):565-8.

130

Ballas ZK, Rasmussen WL, Krieg AM (1996) Induction of NK activity in murine and human cells by CpG motifs in oligodeoxynucleotides and bacterial DNA. J. Immunol. 157 (5) 1840-1845. Banchereau J, Briere F, Caux C, Davoust J, Lebecque S, Liu YJ, Pulendran B, Palucka K (2000) Immunobiology of dendritic cells. Annu Rev Immunol. 18:767-811. Barbulescu K, Becker C, Schlaak JF, Schmitt E, Meyer zum Buschenfelde KH, Neurath MF (1998) IL-12 and IL-18 differentially regulate the transcriptional activity of the human IFN-gamma promoter in primary CD4+ T lymphocytes. J Immunol. 160(8):3642-7. Barner M, Mohrs M, Brombacher F, Kopf M. (1998) Differences between IL-4R alpha-deficient and IL-4-deficient mice reveal a role for IL-13 in the regulation of Th2 responses. Curr Biol. 8(11):669-72. Barnes PF, Chatterjee D, Abrams JS, Lu S, Wang E, Yamamura M, Brennan PJ, Modlin RL. (1992) Cytokine production induced by Mycobacterium tuberculosis lipoarabinomannan. Relationship to chemical structure. J Immunol. 149(2):541-7. Barnett SW, Rajasekar S, Legg H, Doe B, Fuller DH, Haynes JR, Walker CM, Steimer KS (1997) Vaccination with HIV-1 gp120 DNA induces immune responses that are boosted by a recombinant gp120 protein subunit. Vaccine 15 (8) : 869-873. Barry ME, Pinto-Gonzalez D, Orson FM, McKenzie GJ, Petry GR, Barry MA (1999) Role of endogenous endonucleases and tissue site in transfection and CpG-mediated immune activation after naked DNA injection. Hum Gene Ther. 10(15):2461-80. Bauer S, Kirschning CJ, Häcker H, Redecke V, Hausmann S, Akira S, Wagner H, Lipford GB (2001) Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG motif recognition. PNAS 98 (16), 9237-9242. Belkaid Y, Piccirillo CA, Mendez S, Shevach EM, Sacks DL (2002) CD4+CD25+ regulatory T cells control Leishmania major persistence and immunity. Nature. 420(6915):502-7. Belladonna ML, Renauld JC, Bianchi R, Vacca C, Fallarino F, Orabona C, Fioretti MC, Grohmann U, Puccetti P. (2002) IL-23 and IL-12 have overlapping, but distinct, effects on murine dendritic cells. J Immunol. 168(11):5448-54. Bennett WA, Lagoo-Deenadayalan S, Whitworth NS, Brackin MN, Hale E, Cowan BD (1997) Expression and production of interleukin-10 by human trophoblast: relationship to pregnancy immunotolerance. Early Pregnancy. 3(3):190-8. Bertschinger HU, Tucker H, Pfirter HP (1979) Control of Escherichia coli in weaned pigs by use of oral immunisation combined with a diet low in nutrients. Fortschr. Veterinärmed. 29 : 73-81. Bird JJ, Brown DR, Mullen AC, Moskowitz NH, Mahowald MA, Sider JR, Gajewski TF, Wang CR, Reiner SL. (1998) Helper T cell differentiation is controlled by the cell cycle. Immunity. 9(2):229-37. Bird AP, Wolffe AP. (1999) Methylation-induced repression--belts, braces, and chromatin. Cell. 99(5):451-4. Bluestone JA and Abbas AK (2003) Natural versus adaptive regulatory T cells. Nat Rev Immunol. 3(3):253-7. Bonecchi R, Bianchi G, Bordignon PP, D'Ambrosio D, Lang R, Borsatti A, Sozzani S, Allavena P, Gray PA, Mantovani A, Sinigaglia F. (1998) Differential expression of chemokine receptors and chemotactic responsiveness of type 1 T helper cells (Th1s) and Th2s. J Exp Med. 187(1):129-34. Borges E, Tietz W, Steegmaier M, Moll T, Hallmann R, Hamann A, Vestweber D. (1997) P-selectin glycoprotein ligand-1 (PSGL-1) on T helper 1 but not on T helper 2 cells binds to P-selectin and supports migration into inflamed skin. J Exp Med. 185(3):573-8.

131

Boumpas DT, Paliogianni F, Anastassiou ED, Balow JE (1991) Glucocorticosteroid action on the immune system: molecular and cellular aspects. Clin Exp Rheumatol. 9(4):413-23 Boutorine AS, Kostina EV (1993) Reversible covalent attachment of cholesterol to oligodeoxyribonucleotides for studies of the mechanisms of their penetration into eucaryotic cells. Biochimie. 75(1-2):35-41. Boyle JS, Koniaras C, Lew AM (1997) Influence of cellular location of expressed antigen on the efficacy of DNA vaccination : cytotoxic T Lymphocyte and antibody responses are suboptimal when antigen is cytoplasmatic after intramuscular DNA immunisation. Int. Immunol. 9 (12) : 1897-1906. Bozic F, Lackovic G, Stokes CR, Valpotic I (2002) Recruitment of intestinal CD45RA+ and CD45RC+ cells induced by a candidate oral vaccine agains porcine post-weaning colibacillosis. Vet. Immunol. Immunopathol. 86 (3-4) : 137-146. Bretscher PA, Wei G, Menon JN, Bielefeldt-Ohmann H. (1992) Establishment of stable, cell-mediated immunity that makes "susceptible" mice resistant to Leishmania major. Science. 257(5069):539-42. Brightbill HD, Libraty DH, Krutzik SR, Yang RB, Belisle JT, Bleharski JR, Maitland M, Norgard MV, Plevy SE, Smale ST, Brennan PJ, Bloom BR, Godowski PJ, Modlin RL. (1999) Host defense mechanisms triggered by microbial lipoproteins through toll-like receptors. Science. 285(5428):732-6. Brinkmann V, Geiger T, Alkan S, Heusser CH. (1993) Interferon alpha increases the frequency of interferon gamma-producing human CD4+ T cells. J Exp Med. 178(5):1655-63. Brorson KA, Beverly B, Kang SM, Lenardo M, Schwartz RH (1991) Transcriptional regulation of cytokine genes in nontransformed T cells. Apparent constitutive signals in run-on assays can be caused by repeat sequences. J. Immunol. 147 (10) : 3601-9. Brown WC, Estes DM, Chantler SE, Kegerreis KA, Suarez CE (1998) DNA and a CpG oligonucleotide derived from babesia bovis are mitogenic for bovine B cells. Infect. Immun. 66 (11), 5423-5432. Brown JA, Titus RG, Nabavi N, Glimcher LH. (1996) Blockade of CD86 ameliorates Leishmania major infection by down-regulating the Th2 response. J Infect Dis. 174(6):1303-8. Burns F, Bressler-Hill V, Gunter E, Shuman B, Stollar N, Cabradilla C, Reagan K (1997) Measurement of IL-4 expression and production in PBMC’s utilizing competitive PCR, Flow Cytometry and ELISA methodology. Application note of Biosource International. Camoglio L, Juffermans NP, Peppelenbosch M, te Velde AA, ten Kate FJ, van Deventer SJ, Kopf M (2002) Contrasting roles of IL-12p40 and IL-12p35 in the development of hapten-induced colitis Eur J Immunol. 32(1):261-9. Cardell S, Hoiden I, Moller G. (1993) Manipulation of the superantigen-induced lymphokine response. Selective induction of interleukin-10 or interferon-gamma synthesis in small resting CD4+ T cells. Eur J Immunol. 23(2):523-9. Cardell S, Sander B. (1990) Interleukin 2, 4 and 5 are sequentially produced in mitogen-stimulated murine spleen cell cultures. Eur J Immunol. 20(2):389-95. Carding SR, West J, Woods A, Bottomly K. (1989) Differential activation of cytokine genes in normal CD4-bearing T cells is stimulus dependent. Eur J Immunol. 19(2):231-8. Cardoso AI, Sixt N, Vallier A, Fayolle J, Buckland R, Wild TF (1998) Measles virus DNA vaccination: antibody isotype is determined by the method of immunization and by the nature of both the antigen and the coimmunized antigen. J. Virol. 72(3), 2516-2518. Cavani A, Nasorri F, Prezzi C, Sebastiani S, Albanesi C, Girolomoni G. (2000) Human CD4+ T lymphocytes with remarkable regulatory functions on dendritic cells and nickel-specific Th1 immune responses. J Invest Dermatol. 114(2):295-302.

132

Ceuppens JL, Meurs L, Baroja ML, Van Wauwe JP (1986) Effect of T3 modulation on pokeweed mitogen-induced T cell activation : evidence for an alternative pathway of T cell activation. J. Immunol. 136(9) : 3346-50. Chaouat G, Assal Meliani A, Martal J, Raghupathy R, Elliot J, Mosmann T, Wegmann TG (1995) IL-10 prevents naturally occurring fetal loss in the CBA x DBA/2 mating combination, and local defect in IL-10 production in this abortion-prone combination is corrected by in vivo injection of IFN-tau. J Immunol. 154(9):4261-8. Chaplin PJ, De Rose R, Boyle JS, McWaters P, Kelly J, Tennent JM, Lew AM, Scheerlinck JP (1999) Targeting improves the efficacy of a DNA vaccine against Corynebacterium pseudotuberculosis in sheep. Infect. Immun. 67 (12) : 6434-38. Chapman BS, Thayer RM, Vincent KA, Haigwood NL (1991) Effect of intron A from human cytomegalovirus (Towne) immediate-early gene on heterologous expression in mammalian cells. Nucleic Acids Res.19(14):3979-86. Choi IS, Shin NR, Shin SJ, Lee DY, Cho YW, Yoo HS (2002) Time course study of cytokine mRNA expression in LPS-stimulated porcine alveolar macrophages. J. Vet. Sci. 3 (2) : 97-102. Chu RS, Targoni OS, Krieg AM, Lehmann PV, Harding CV (1997) CpG oligodeoxynucleotides act as adjuvants that switch on T helper 1 (Th1) immunity. J. Exp. Med. 186 (10), 1623-31. Chua AO, Chizzonite R, Desai BB, Truitt TP, Nunes P, Minetti LJ, Warrier RR, Presky DH, Levine JF, Gately MK, et al. (1994) Expression cloning of a human IL-12 receptor component. A new member of the cytokine receptor superfamily with strong homology to gp130. J Immunol. 153(1):128-36 Chua AO, Wilkinson VL, Presky DH, Gubler U (1995) Cloning and characterization of a mouse IL-12 receptor-beta component. J Immunol. 155(9):4286-94. Cella M, Jarrossay D, faccetti F (1999) Plasmacytoid monocytes migrate to inflamed lymph nodes and produce large amounts of type I interferon. Nat. Med. 5, 919-923. Chen Q, Ghilardi N, Wang H, Baker T, Xie MH, Gurney A, Grewal IS, de Sauvage FJ. (2000) Development of Th1-type immune responses requires the type I cytokine receptor TCCR. Nature 407(6806):916-20. Chen Y, Kuchroo VK, Inobe J, Hafler DA, Weiner HL. (1994) Regulatory T cell clones induced by oral tolerance: suppression of autoimmune encephalomyelitis. Science. 265(5176):1237-40. Cho SS, Bacon CM, Sudarshan C, Rees RC, Finbloom D, Pine R, O'Shea JJ. (1996) Activation of STAT4 by IL-12 and IFN-alpha: evidence for the involvement of ligand-induced tyrosine and serine phosphorylation. J Immunol. 157(11):4781-9. Cleveland MG, Gorham JD, Murphy TL, Tuomanen E, Murphy KM (1996) Lipoteichoic acid preparations of gram-positive bacteria induce interleukin-12 through a CD14-dependent pathway. Infect Immun. 64(6):1906-12 Cohn L, Tepper JS, Bottomly K. (1998) IL-4-independent induction of airway hyperresponsiveness by Th2, but not Th1, cells. J Immunol. 161(8):3813-6. Constant SL, Bottomly K. (1997) Induction of Th1 and Th2 CD4+ T cell responses: the alternative approaches. Annu Rev Immunol. 297-322. Coqueret O, Lagente V, Frere CP, Braquet P, Mencia-Huerta JM (1994) Regulation of IgE production by beta 2-adrenoceptor agonists. Ann N Y Acad Sci. 725:44-9. Cottrez F, Groux H. (2001) Regulation of TGF-beta response during T cell activation is modulated by IL-10. J Immunol. 167(2):773-8.

133

Covert J and Splitter G (1995) Detection of cytokine transcriptional profiles from bovine peripheral blood monomorphonuclear cells and CD4+ lymphocytes by reverse transcriptase polymerase chain reaction. Vet. Immunol. Immunopathol. 49 : 39-50. Cowdery JS, Boerth NJ, Norian LA, Myung PS, Koretzky GA (1999) Differential regulation of the IL-12 p40 promoter and of p40 secretion by CpG DNA and lipopolysaccharide.J Immunol. 162(11):6770-5. Coyle AJ, Lloyd C, Tian J, Nguyen T, Erikkson C, Wang L, Ottoson P, Persson P, Delaney T, Lehar S, Lin S, Poisson L, Meisel C, Kamradt T, Bjerke T, Levinson D, Gutierrez-Ramos JC. (1999) Crucial role of the interleukin 1 receptor family member T1/ST2 in T helper cell type 2-mediated lung mucosal immune responses. J Exp Med. 190(7):895-902. Cozzo C, Larkin J 3rd, Caton AJ (2003) Cutting edge: self-peptides drive the peripheral expansion of CD4+CD25+ regulatory T cells. J Immunol. 171(11):5678-82 Crawley A, Raymond C, Wilkie BN (2003) Control of immunoglobulin isotype production by porcine B-cells cultured with cytokines. Vet Immunol Immunopathol.;91(2):141-54. Crawley A, Wilkie BN (2003) Porcine Ig isotypes: function and molecular characteristics. Vaccine. 21(21-22):2911-22. Croft M, Carter L, Swain SL, Dutton RW. (1994) Generation of polarized antigen-specific CD8 effector populations: reciprocal action of interleukin (IL)-4 and IL-12 in promoting type 2 versus type 1 cytokine profiles. J Exp Med. 180(5):1715-28. Croft M, Swain SL. (1995) Recently activated naive CD4 T cells can help resting B cells, and can produce sufficient autocrine IL-4 to drive differentiation to secretion of T helper 2-type cytokines. J Immunol. 154(9):4269-82. Dalpke AH, Zimmermann S, Albrecht I, Heeg K (2002) Phosphodiester CpG oligonucleotides as adjuvants: polyguanosine runs enhance cellular uptake and improve immunostimulative activity of phosphodiester CpG oligonucleotides in vitro and in vivo. Immunology 106(1), 102-112. D'Ambrosio D, Iellem A, Bonecchi R, Mazzeo D, Sozzani S, Mantovani A, Sinigaglia F. (1998) Selective up-regulation of chemokine receptors CCR4 and CCR8 upon activation of polarized human type 2 Th cells. Immunol. 161(10):5111-5. Darji A, Guzman CA, Gerstel B, Wachholz P, Timmis KN, Wehland J, Chakraborty T, Weiss S (1997) Oral somatic transgene vaccination using attenuated S. typhimurium. Cell 91 : 765-75. Davis MM, Chien YH, Gascoigne NR, Hedrick SM. (1984) A murine T cell receptor gene complex: isolation, structure and rearrangement. Immunol Rev. 81:235-58. Davis HL, 2000. CpG motifs for optimization of DNA vaccines. Dev. Biol. 104, 165-169. Davis HL, Weeratna R, Waldschmidt TJ, Tygrett L, Schorr J, Krieg AM, Weeranta R (1998) CpG DNA is a potent enhancer of specific immunity in mice immunized with recombinant hepatitis B surface antigen. J. Immunol. 160 (2), 870-876. Das J, Chen CH, Yang L, Cohn L, Ray P, Ray A. (2001) A critical role for NF-kappa B in GATA3 expression and TH2 differentiation in allergic airway inflammation. Nat Immunol. 2(1):45-50. Daynes RA, Araneo BA, Dowell TA, Huang K, Dudley D (1990) Regulation of murine lymphokine production in vivo. III. The lymphoid tissue microenvironment exerts regulatory influences over T helper cell function. J Exp Med. 171(4):979-96. Decken K, Kohler G, Palmer-Lehmann K, Wunderlin A, Mattner F, Magram J, Gately MK, Alber G (1998) Interleukin-12 is essential for a protective Th1 response in mice infected with Cryptococcus neoformans. Infect Immun. 66(10):4994-5000

134

Dégano P, Schneider J, Hannan CM, Gilbert SC, Hill AVS (2000) Gene gun intradermal DNA immunisation followed by boosting with modified vaccinia virus Ankara : enhanced CD8+ T cell immunogenicity and protective efficacy in the influenza and malaria models. Vaccine 18 : 623-632. de Jong EC, Smits HH, Kapsenberg ML (2005) Dendritic cell-mediated T cell polarization. Springer Semin Immunopathol. 26(3):289-307. Demeure CE, Wu CY, Shu U, Schneider PV, Heusser C, Yssel H, Delespesse G (1994) In vitro maturation of human neonatal CD4 T lymphocytes. II. Cytokines present at priming modulate the development of lymphokine production. J Immunol. 152(10):4775-82. Deml L, Bojak A, Steck S, Graf M, Wild J, Schirmbeck R, Wolf H, Wagner R (2001) Multiple effects of codon usage optimisation on expression and immunogenicity of DNA candidate vaccines encoding the human immunodeficiency virus type 1 gag protein. J. Virol. 75 (22) : 10991-11001. de Waal Malefyt R, Figdor CG, de Vries JE (1993) Effects of interleukin 4 on monocyte functions: comparison to interleukin 13. Res Immunol. 144(8):629-33. Diehl S, Anguita J, Hoffmeyer A, Zapton T, Ihle JN, Fikrig E, Rincon M. (2000) Inhibition of Th1 differentiation by IL-6 is mediated by SOCS1. Immunity. 13(6):805-15. Diehl S, Rincon M. (2002) The two faces of IL-6 on Th1/Th2 differentiation. Mol Immunol. 39(9):531-6. Doetze A, Satoguina J, Burchard G, Rau T, Loliger C, Fleischer B, Hoerauf A. (2000) Antigen-specific cellular hyporesponsiveness in a chronic human helminth infection is mediated by T(h)3/T(r)1-type cytokines IL-10 and transforming growth factor-beta but not by a T(h)1 to T(h)2 shift. Int Immunol. 12(5):623-30. Dong C, Flavell RA (2001) Th1 and Th2 cells. Curr Opin Hematol. 8(1):47-51. d'Ostiani CF, Del Sero G, Bacci A, Montagnoli C, Spreca A, Mencacci A, Ricciardi-Castagnoli P, Romani L. (2000) Dendritic cells discriminate between yeasts and hyphae of the fungus Candida albicans. Implications for initiation of T helper cell immunity in vitro and in vivo. J Exp Med. 191(10):1661-74. Dozois CM, Oswald E, Gautier N, Serthelon J-P, Fairbrother JM, Oswald IP (1997) A reverse transcription - polymerase chain reaction method to analyze porcine cytokine gene expression. Vet. Immunol. immunopathol. 58 : 287-300. Drew DR, Boyle JS, Lew AM, Lightowlers MW, Chaplin PJ, Strugnell RA (2001) The comparative efficacy of CTLA-4 and L-selectin targeted DNA vaccines in mice and sheep. Vaccine. 19(31):4417-28. Dumoulin FL, Nischalke HD, Leifeld L, von dem Bussche A, Rockstroh JK, Sauerbruch T, Spengler U (2000) Semi-quantification of human C-C chemokine mRNAs with reverse transcription/real-time PCR using multi-specific standards. J. Immunol. Methods 241, 109-119. Dunham SP (2002) The application of nucleic acid vaccines in veterinary medicine. Res Vet Sci. 73(1):9-16. Elenkov IJ, Papanicolaou DA, Wilder RL, Chrousos GP (1996) Modulatory effects of glucocorticoids and catecholamines on human interleukin-12 and interleukin-10 production: clinical implications. Proc Assoc Am Physicians. 108(5):374-81. Emoto M, Emoto Y, Buchwalow IB, Kaufmann SH (1999) Induction of IFN-gamma-producing CD4+ natural killer T cells by Mycobacterium bovis bacillus Calmette Guerin. Eur J Immunol. 29(2):650-9. Emson CL, Bell SE, Jones A, Wisden W, McKenzie AN. (1998) Interleukin (IL)-4-independent induction of immunoglobulin (Ig)E, and perturbation of T cell development in transgenic mice expressing IL-13. J Exp Med. 188(2):399-404. Encke J, Putlitz J, Stremmel W, Wands JR (2003) CpG immuno-stimulatory motifs enhance humoral immune responses against hepatitis C virus core protein after DNA-based immunization. Arch. Virol. 148(3), 435-448.

135

Erard F, Wild MT, Garcia-Sanz JA, Le Gros G. (1993) Switch of CD8 T cells to noncytolytic CD8-CD4- cells that make TH2 cytokines and help B cells. Science. 260(5115):1802-5. Evavold BD, Williams SG, Hsu BL, Buus S, Allen PM. (1992) Complete dissection of the Hb(64-76) determinant using T helper 1, T helper 2 clones, and T cell hybridomas. J Immunol. 148(2):347-53. Fabris N, Piantanelli L, Muzzioli M (1977) Differential effect of pregnancy or gestagens on humoral and cell-mediated immunity. Clin Exp Immunol. 28(2):306-14. Farrar JD, Asnagli H, Murphy KM (2002) T helper subset development: roles of instruction, selection, and transcription. J Clin Invest. 109(4):431-5. Farrar JD, Smith JD, Murphy TL, Murphy KM. (2000) Recruitment of Stat4 to the human interferon-alpha/beta receptor requires activated Stat2. J Biol Chem. 275(4):2693-7. Feng CG, Palendira U, Demangel C, Spratt JM, Mali AS, Britton WJ (2001) Priming by DNA immunisation augments protective efficacy of Mycobacterium bovis Bacille Calmette-Guerin against tuberculosis. Infect. Immun. 69 (6) : 4174-76. Firestein GS, Roeder WD, Laxer JA, Townsend KS, Weaver CT, Hom JT, Linton J, Torbett BE, Glasebrook AL. (1989) A new murine CD4+ T cell subset with an unrestricted cytokine profile. J Immunol. 143(2):518-25. Flesch IE, Hess JH, Huang S, Aguet M, Rothe J, Bluethmann H, Kaufmann SH (1995) Early interleukin 12 production by macrophages in response to mycobacterial infection depends on interferon gamma and tumor necrosis factor alpha. J Exp Med. 181(5):1615-21. Fisher T, Büttner M, Rziha H-J (2000) T helper 1-type cytokine transcription in peripheral blood mononuclear cells of pseudorabies virus (Suid herpesvirus 1)-primed swine indicates efficient immunization. Immunology 101 : 378-387. Fontenot JD, Gavin MA, Rudensky AY (2003) Foxp3 programs the development and function of CD4+CD25+ regulatory T cells. Nat Immunol. 4(4):330-6. Franchimont D, Galon J, Gadina M, Visconti R, Zhou Y, Aringer M, Frucht DM, Chrousos GP, O'Shea JJ (2000) Inhibition of Th1 immune response by glucocorticoids: dexamethasone selectively inhibits IL-12-induced Stat4 phosphorylation in T lymphocytes. J Immunol. 164(4):1768-74. Francis DH and Willgohs JA (1991) Evaluation of a live avirulent Escherichia coli vaccine of K88+ , LT+ enterotoxigenic colibacillosis in weaned pigs. Am. J. Vet. Res. 52 : 4156-58. Fu TM, Guan L, Friedman A, Ulmer JB, Liu MA, Donnelly JJ (1998) Induction of MHC class I-restricted CTL response by DNA immunization with ubiquitin-influenza virus nucleoprotein fusion antigens. Vaccine 16(18), 1711-1717. Fukaura H, Kent SC, Pietrusewicz MJ, Khoury SJ, Weiner HL, Hafler DA. (1996) Induction of circulating myelin basic protein and proteolipid protein-specific transforming growth factor-beta1-secreting Th3 T cells by oral administration of myelin in multiple sclerosis patients. J Clin Invest. 98(1):70-7. Furth PA, Shamay A, Hennighausen L (1995) Gene transfer into mammalian cells by jet injection. Hybridoma. 14(2):149-52. Fuss IJ, Boirivant M, Lacy B, Strober W. (2002) The interrelated roles of TGF-beta and IL-10 in the regulation of experimental colitis. J Immunol. 168(2):900-8. Garba ML, Pilcher CD, Bingham AL, Eron J, Frelinger JA. (2002) HIV antigens can induce TGF-beta(1)-producing immunoregulatory CD8+ T cells. J Immunol. 168(5):2247-54. Gardner EM, Murasko DM. (2002) Age-related changes in Type 1 and Type 2 cytokine production in humans. Biogerontology. 3(5):271-90.

136

Garmory HS, Brown KA, Titball RW (2003) DNA vaccines: improving expression of antigens. Genet Vaccines Ther. 1(1):2. Gerosa F, Mingari MC, Moretta L (1986) Interleukin-2 production in response to phytohemagglutinin is not nessecarily dependent upon the T3-mediated pathway of T-cell activation. Clin. Immunol. Immunopathol. 40(3) : 525-31. Gilliland G, Perrins S, Blanchard K, Bunn F (1990) Analysis of cytokine mRNA and DNA : detection and quantitation by competitive polymerase chain reaction. Proc. Natl. Acad. Sci. USA 87, 2725. Giulietti A, Overbergh L, Valckx D, Decallonne B, Bouillon R, Mathieu C (2001) An overview of Real-Time Quantitative PCR : applications to quantify cytokine gene expression. Methods 25 : 386-401. Glasspool-Malone J, Somiari S, Drabick JJ, Malone RW (2000) Efficient nonviral cutaneous transfection. Mol Ther. 2(2):140-6 Glimcher LH (2001) Lineage commitment in lymphocytes: controlling the immune response. J Clin Invest. 108(7):s25-s30. Glimcher LH, Murphy KM. (2000) Lineage commitment in the immune system: the T helper lymphocyte grows up. Genes Dev. 14(14):1693-711. Gorelik L, Flavell RA. (2002) Transforming growth factor-beta in T-cell biology. Nat Rev Immunol. 2(1):46-53. Gorelik L, Constant S, Flavell RA. (2002) Mechanism of transforming growth factor beta-induced inhibition of T helper type 1 differentiation. J Exp Med. 195(11):1499-505. Grogan JL, Mohrs M, Harmon B, Lacy DA, Sedat JW, Locksley RM. (2001) Early transcription and silencing of cytokine genes underlie polarization of T helper cell subsets. Immunity. 14(3):205-15. Groux H. (2001) An overview of regulatory T cells. Microbes Infect. 3(11):883-9. Groux H, O'Garra A, Bigler M, Rouleau M, Antonenko S, de Vries JE, Roncarolo MG. (1997) A CD4+ T-cell subset inhibits antigen-specific T-cell responses and prevents colitis. Nature. 389(6652):737-42. Guilbert LJ (1996) There is a bias against type 1 (inflammatory) cytokine expression and function in pregnancy. J Reprod Immunol. 32(2):105-10. Guinée PAM and Jansen WH (1979) Behavior of Escherichia coli K antigens K88ab, K88ac and K88ad in immunoelectrophoresis, double diffusion and hemagglutination ? Infect. Immun 23 : 700-705. Gurunathan S, Klinman DM, Seder RA (2000) DNA vaccines: immunology, application, and optimization*. Annu Rev Immunol. 18:927-74. Gu Y, Kuida K, Tsutsui H, Ku G, Hsiao K, Fleming MA, Hayashi N, Higashino K, Okamura H, Nakanishi K, Kurimoto M, Tanimoto T, Flavell RA, Sato V, Harding MW, Livingston DJ, Su MS. (1997) Activation of interferon-gamma inducing factor mediated by interleukin-1beta converting enzyme. Science. 275(5297):206-9. Haddad D, Ramprakash J, Sedegah M, Charoenvit Y, Baumgartner R, Kumar S, Hoffman SL, Weiss WR (2000) Plasmid vaccine expressing granulocyte-macrophage colony-stimulating factor attracts infiltrates including immature dendritic cells into injected muscles. J. Immunol. 165(7) : 3772-81. Haensler J, Verdelet C, Sanchez V, Girerd-Chambaz Y, Bonnin A, Trannoy E, Krishnan S, Meulien P (1999) Intradermal DNA immunization by using jet-injectors in mice and monkeys. Vaccine. 17(7-8):628-38. Hanke T, Blanchard TJ, Schneider J, Hannan CM, Becker M, Gilbert SC, Hill AV, Smith GL, McMichael A (1998) Enhancement of MHC class I-restricted peptide-specific T cell induction by a DNA prime/MVA boost vaccination regimen. Vaccine 16 (5) : 439-445.

137

Hanninen A and Harrison LC. (2000) Gamma delta T cells as mediators of mucosal tolerance: the autoimmune diabetes model. Immunol Rev. 173:109-19. Hartmann G and Krieg AM. (2000) Mechanism and function of a newly identified CpG DNA motif in human primary B cells. J. Immunol. 164(2), 944-953. Hartmann G, Weiner GJ, Krieg AM (1999) A potent signal for growth activation and maturation of human dendritic cells. Proc. Natl. Acad. Sci. USA 96, 9305-9310. Hassett DE, Zhang J, Whitton JL (1997) Neonatal DNA immunization with a plasmid encoding an internal viral protein is effective in the presence of maternal antibodies and protects against subsequent viral challenge. J. Virol. 71 : 7881-7888. Heath VL, Murphy EE, Crain C, Tomlinson MG, O'Garra A. (2000) TGF-beta1 down-regulates Th2 development and results in decreased IL-4-induced STAT6 activation and GATA-3 expression. Eur J Immunol. 30(9):2639-49. Hemmi H, Takeuchi 0, Kawai T, Kaisho T, Sato S, Sanjo H, Matsumoto M, Hoshino K, Wagner H, Takeda K, Akira S (2000) A Toll-like receptor recognizes bacterial DNA. Nature, 408, 740-745. Heraud J-M, Lavergne A, Kazanji M (2002) Molecular cloning, characterization, and quantification of squirrel monkey (Saimiri sciureus) Th1 and Th2 cytokines. Immunogenetics 54 : 20-29. Higuchi R, Fockler C, Dollinger G, Watson R (1993) Kinetic PCR analysis : real-time monitoring of DNA amplification reactions. Biotechnology 11 : 1026-1030. Hirano T. (1998) Interleukin 6 and its receptor: ten years later. Int Rev Immunol. 16(3-4):249-84. Ho IC, Glimcher LH. (2002) Transcription: tantalizing times for T cells. Cell. 109 Suppl:S109-20. Ho IC, Hodge MR, Rooney JW, Glimcher LH. (1996) The proto-oncogene c-maf is responsible for tissue-specific expression of interleukin-4. Cell. 85(7):973-83. Hobbs MV, Weigle WO, Ernst DN. (1994) Interleukin-10 production by splenic CD4+ cells and cell subsets from young and old mice. Cell Immunol. 154(1):264-72. Hobbs MV, Weigle WO, Noonan DJ, Torbett BE, McEvilly RJ, Koch RJ, Cardenas GJ, Ernst DN. (1993) Patterns of cytokine gene expression by CD4+ T cells from young and old mice. J Immunol. 150(8):3602-14. Holscher C (2004) The power of combinatorial immunology: IL-12 and IL-12-related dimeric cytokines in infectious diseases. Med Microbiol Immunol (Berl). 193(1):1-17. Hori S, Nomura T, Sakaguchi S (2003) Control of regulatory T cell development by the transcription factor Foxp3. Science. 299(5609):1057-61. Hoshino K, Kashiwamura S, Kuribayashi K, Kodama T, Tsujimura T, Nakanishi K, Matsuyama T, Takeda K, Akira S. (1999) The absence of interleukin 1 receptor-related T1/ST2 does not affect T helper cell type 2 development and its effector function. J Exp Med. 190(10):1541-8. Hosken NA, Shibuya K, Heath AW, Murphy KM, O'Garra A. (1995) The effect of antigen dose on CD4+ T helper cell phenotype development in a T cell receptor-alpha beta-transgenic model. J Exp Med. 182(5):1579-84. Hsieh CL. (2000) Dynamics of DNA methylation pattern. Curr Opin Genet Dev. 10(2):224-8. Hsieh CS, Macatonia SE, Tripp CS, Wolf SF, O'Garra A, Murphy KM. (1993) Development of TH1 CD4+ T cells through IL-12 produced by Listeria-induced macrophages. Science. 260(5107):547-9. Hsieh CS, Heimberger AB, Gold JS, O'Garra A, Murphy KM. (1992) Differential regulation of T helper phenotype development by interleukins 4 and 10 in an alpha beta T-cell-receptor transgenic system. Proc Natl Acad Sci U S A. 89(13):6065-9.

138

Huang MT, Gorman CM (1990) Intervening sequences increase efficiency of RNA 3' processing and accumulation of cytoplasmic RNA. Nucleic Acids Res. 18(4):937-47. Hutchins AS, Mullen AC, Lee HW, Sykes KJ, High FA, Hendrich BD, Bird AP, Reiner SL. (2002) Gene silencing quantitatively controls the function of a developmental trans-activator. Mol Cell. 10(1):81-91. Isaacson RE (1994) Vaccines against E. coli diseases. In : Eschericiha coli in domestic animals and humans. C.L. Gyles (ed). CAB international, Wallingford, Oxon, UK pp. 629. Iwata H, Ueda T, Takayanagi K, Wada M, Inoue T (1993) Swine interleukin 2 activity produced by mesenteric lymph node cells. J. Vet. Med. Sci. 55 (5) : 729-734. Jakob T, Walker PS, Krieg AM, Udey MC, Vogel JC (1998) Activation of cutaneous dendritic cells by CpG-containing oligodeoxynucleotides: a role for dendritic cells in the augmentation of Th1 responses by immunostimulatory DNA. J. Immunol. 161, 3042-3049. Jankovic D, Liu Z, Gause WC (2001) Th1- and Th2-cell commitment during infectious disease: asymmetry in divergent pathways. Trends Immunol. 22(8):450-7. Jankovic D, Kullberg MC, Noben-Trauth N, Caspar P, Paul WE, Sher A. (2000) Single cell analysis reveals that IL-4 receptor/Stat6 signaling is not required for the in vivo or in vitro development of CD4+ lymphocytes with a Th2 cytokine profile. J Immunol. 164(6):3047-55. Jiang H, Chess L (2004) An integrated view of suppressor T cell subsets in immunoregulation. J Clin Invest. 114(9):1198-208. Johansson E, Wallgren P, Fuxler L, Domeika K, Lefevre F, Fossum C (2002) The DNA vaccine vector pcDNA3 induces IFN-alpha production in pigs. Vet. Immunol. Immunopathol. 87(1-2), 29-40. Johnsen CK, Botner A, Kamstrup S, Lund P, Nielsen J (2002) Cytokine mRNA profiles in bronchoalveolar cells of piglets experimentally infected in utero with porcine reproductive and respiratory syndrome virus : association of sustained expression of IFN-γ and IL-10 after viral clearance. Viral Immunology 15(4) : 549-556. Jones GW and Rutter JM (1972) Role of K88 antigen in the pathogenesis of neonatal diarrhoea caused by Escherichia coli in piglets. Infect. Immun. 6 : 918-927. Kalinski P, Hilkens CM, Wierenga EA, Kapsenberg ML. (1999) T-cell priming by type-1 and type-2 polarized dendritic cells: the concept of a third signal. Immunol Today. 20(12):561-7. Kamstrup S, Verthelyi D, Klinman DM (2001) Response of porcine peripheral blood monomorphonuclear cells to CpG-containing oligodeoxynucleotides. Vet. Microbiol. 78, 353-362. Kanda N, Tamaki K (1999) Estrogen enhances immunoglobulin production by human PBMCs. J Allergy Clin Immunol. 103(2 Pt 1):282-8. Kanellopoulos JM, De Petris S, Leca G, Crumpton MJ (1985) The mitogenic lectin from phaseolus vulgaris does not recognize the T3 antigen of human T lymphocytes. Eur. J. Immunol. 15(5) : 479-86. Kanellos TS, Sylvester ID, Butler VL, Ambali AG, Partidos CD, Hamblin AS, Russel PH (1999) Mammalian granulocyte-macrophage colony stimulating factor and some CpG motifs have an effect on the immunogenicity of DNA and subunit vaccines in fish. Immunology 96, 507. Kaplan MH, Schindler U, Smiley ST, Grusby MJ. (1996) Stat6 is required for mediating responses to IL-4 and for development of Th2 cells. Immunity. 4(3):313-9. Katamura K, Shintaku N, Yamauchi Y, Fukui T, Ohshima Y, Mayumi M, Furusho K (1995) Prostaglandin E2 at priming of naive CD4+ T cells inhibits acquisition of ability to produce IFN-gamma and IL-2, but not IL-4 and IL-5. J Immunol. 155(10):4604-12.

139

Kaufmann SH. (1993) Immunity to intracellular bacteria. Annu Rev Immunol. 11:129-63. Kemp M, Kurtzhals JA, Bendtzen K, Poulsen LK, Hansen MB, Koech DK, Kharazmi A, Theander TG (1993) Leishmania donovani-reactive Th1- and Th2-like T-cell clones from individuals who have recovered from visceral leishmaniasis. Infect Immun. 61(3):1069-73. Kelso A (1995) Th1 and Th2 subsets: paradigms lost? Immunol Today. 16(8):374-9. Kidd P (2003) Th1/Th2 balance: the hypothesis, its limitations, and implications for health and disease. Altern Med Rev. 8(3):223-46. Kim HR, Ryu SY, Kim HS, Choi BM, Lee EJ, Kim HM, Chung HT (1995) Administration of dehydroepiandrosterone reverses the immune suppression induced by high dose antigen in mice. Immunol Invest. 24(4):583-93 Kim J, Sif S, Jones B, Jackson A, Koipally J, Heller E, Winandy S, Viel A, Sawyer A, Ikeda T, Kingston R, Georgopoulos K. (1999) Ikaros DNA-binding proteins direct formation of chromatin remodeling complexes in lymphocytes. Immunity. 10(3):345-55. Kim JJ, Nottingham LK, Wilson DM, Bagarazzi ML, Tsai A, Morrison LD, Javadian A, Chalian AA, Agadjanyan MG, Weiner DB (1998) Engineering DNA vaccines via co-delivery of co-stimulatory molecule genes. Vaccine. 16(19):1828-35. Kim JJ, Tsai A, Nottingham LK, Morrison L, Cunning DM, Oh J, Lee DJ, Dang K, Dentchev T, Chalian AA, Agadjanyan MG, Weiner DB (1999) Intracellular adhesion molecule-1 modulates beta-chemokines and directly costimulates T cells in vivo. J Clin Invest. 103(6):869-77. Kitani A, Fuss IJ, Nakamura K, Schwartz OM, Usui T, Strober W. (2000) Treatment of experimental (Trinitrobenzene sulfonic acid) colitis by intranasal administration of transforming growth factor (TGF)-beta1 plasmid: TGF-beta1-mediated suppression of T helper cell type 1 response occurs by interleukin (IL)-10 induction and IL-12 receptor beta2 chain downregulation. J Exp Med. 192(1):41-52. Klinman DM, Barnhart KM, Conover J (1999) CpG motifs as immune adjuvants. Vaccine. 17(1):19-25. Klinman DM, Yi AK, Beaucage SL, Conover J, Krieg AM (1996) CpG motifs present in bacteria DNA rapidly induce lymphocytes to secrete interleukin 6, interleukin 12, and interferon gamma. Proc. Natl. Acad. Sci. U S A 93(7), 2879-2883. Kojima Y, Xin K-Q, Ooki T, Hamajima K, Oikawa T, Shinoda K, Ozaki T, Hoshino Y, Jounai N, Nakazawa M, Klinman D, Okuda K (2002) Adjuvant effect of multi-CpG motifs on an HIV-1 DNA vaccine. Vaccine 20, 2857-2865. Kontsek P, Martens E, Vandenbroeck K, Kontsekova E, Waschütza G, Sareneva T, Billiau A (1997) Structural immuno-analysis of human and porcine interferon gamma : identification of shared antigenic domain. Cytokine 9 (8) : 550-555. Kopf M, Le Gros G, Bachmann M, Lamers MC, Bluethmann H, Kohler G. (1993) Disruption of the murine IL-4 gene blocks Th2 cytokine responses. Nature. 362(6417):245-8. Kozak M (1987) At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells. J Mol Biol. 196(4):947-50. Kozak M (1997) Recognition of AUG and alternative initiator codons is augmented by G in position +4 but is not generally affected by the nucleotides in positions +5 and +6. EMBO J. 16(9):2482-92. Krieg AM, Davis HL (2001) Enhancing vaccines with immune stimulatory CpG DNA. Curr Opin Mol Ther. 3(1):15-24. Krieg AM, Yi A-K, Schorr J, Davis HL (1998) The role of CpG dinucleotides in DNA vaccines. Trends Microbiol. 6 (1), 23-27.

140

Krieg AM, Yi AK, Matson S, Waldschmidt TJ, Bishop GA, Teasdale R, Koretzky GA, Klinman DM (1995) CpG motifs in bacterial DNA trigger direct B-cell activation. Nature. 374(6522):546-9 Krieg AM, Love-Homan L, Yi AK, Harty JT (1998) CpG DNA induces sustained IL-12 expression in vivo and resistance to Listeria monocytogenes challenge. J Immunol. 161(5):2428-34. Kuchroo VK, Das MP, Brown JA, Ranger AM, Zamvil SS, Sobel RA, Weiner HL, Nabavi N, Glimcher LH. (1995) B7-1 and B7-2 costimulatory molecules activate differentially the Th1/Th2 developmental pathways: application to autoimmune disease therapy. Cell. 80(5):707-18. Kuhn R, Rajewsky K, Muller W. (1991) Generation and analysis of interleukin-4 deficient mice. Science. 254(5032):707-10. Kumar V, Bhardwaj V, Soares L, Alexander J, Sette A, Sercarz E. (1995) Major histocompatibility complex binding affinity of an antigenic determinant is crucial for the differential secretion of interleukin 4/5 or interferon gamma by T cells. Proc Natl Acad Sci U S A. 92(21):9510-4. Lane P. (2000) Role of OX40 signals in coordinating CD4 T cell selection, migration, and cytokine differentiation in T helper (Th)1 and Th2 cells. J Exp Med. 191(2):201-6. Larsson S, Linden M (1998) Effects of a corticosteroid, budesonide, on production of bioactive IL-12 by human monocytes. Cytokine. 10(10):786-9. Leclerc C, Deriaud E, Rojas M, Whalen RG (1997) The preferential induction of a Th1 immune response by DNA-based immunization is mediated by the immunostimulatory effect of plasmid DNA. Cell Immunol. 179(2), 97-106. Lederer JA, Perez VL, DesRoches L, Kim SM, Abbas AK, Lichtman AH. (1996) Cytokine transcriptional events during helper T cell subset differentiation. J Exp Med. 184(2):397-406. Lee DU, Agarwal S, Rao A. (2002) Th2 lineage commitment and efficient IL-4 production involves extended demethylation of the IL-4 gene. Immunity. 16(5):649-60. Lee AH, Suh YS, Sung JH, Yang SH, Sung YC (1997) Comparison of various expression plasmids for the induction of immune response by DNA immunization. Mol Cells. 7(4):495-501. Lee HJ, Takemoto N, Kurata H, Kamogawa Y, Miyatake S, O'Garra A, Arai N. (2000) GATA-3 induces T helper cell type 2 (Th2) cytokine expression and chromatin remodeling in committed Th1 cells. J Exp Med. 192(1):105-15. Leitner WW, Ying H, Restifo NP (2000) DNA and RNA-based vaccines: principles, progress and prospects. Vaccine. 18(9-10):765-77. Lenschow DJ, Walunas TL, Bluestone JA. (1996) CD28/B7 system of T cell costimulation. Annu Rev Immunol. 14:233-58. Lesnick CE, Derbyshire JB (1988) Activation of natural killer cells in newborn piglets by interferon induction. Vet Immunol Immunopathol. 18(2):109-17. Levings MK, Bacchetta R, Schulz U, Roncarolo MG. (2002) The role of IL-10 and TGF-beta in the differentiation and effector function of T regulatory cells. Int Arch Allergy Immunol. 129(4):263-76. Levings MK, Sangregorio R, Galbiati F, Squadrone S, de Waal Malefyt R, Roncarolo MG (2001) IFN-alpha and IL-10 induce the differentiation of human type 1 T regulatory cells. J Immunol. 166(9):5530-9. Libraty DH, Airan LE, Uyemura K, Jullien D, Spellberg B, Rea TH, Modlin RL (1997) Interferon-gamma differentially regulates interleukin-12 and interleukin-10 production in leprosy. J Clin Invest. 99(2):336-41.

141

Lighvani AA, Frucht DM, Jankovic D, Yamane H, Aliberti J, Hissong BD, Nguyen BV, Gadina M, Sher A, Paul WE, O'Shea JJ. (2001) T-bet is rapidly induced by interferon-gamma in lymphoid and myeloid cells. Proc Natl Acad Sci U S A. 98(26):15137-42. Lipford GB, Bauer M, Blank C, Reiter R, Wagner H, Heeg K (1997) CpG-containing synthetic oligodeoxynucleotides promote B and cytotoxic T cell responses to protein antigen : a new class of vaccine adjuvants. Eur. J. Immunol. 27, 2340-2344. Liu YJ (2001) Dendritic cell subsets and lineages, and their functions in innate and adaptive immunity. Cell 106, 259-262. Loehr BI, Rankin R, Pontarollo R, King T, Willson P, Babiuk LA, van Drunen Littel-van den Hurk S (2001) Suppository-mediated DNA immunization induces mucosal immunity against bovine herpesvirus-1 in cattle. Virology. 289(2):327-33. Lohning M, Richter A, Radbruch A. (2002) Cytokine memory of T helper lymphocytes. Adv Immunol 80:115-81. Lohning M, Stroehmann A, Coyle AJ, Grogan JL, Lin S, Gutierrez-Ramos JC, Levinson D, Radbruch A,Kamradt T. (1998) T1/ST2 is preferentially expressed on murine Th2 cells, independent of interleukin 4, interleukin 5, and interleukin 10, and important for Th2 effector function. Proc Natl Acad Sci U S A. 95(12):6930-5. London CA, Abbas AK, Kelso A. (1998) Helper T cell subsets: heterogeneity, functions and development. Vet Immunol Immunopathol. 63(1-2):37-44. Lorre K, Van Damme J, Verwilghen J, Baroja ML, Ceuppens JL (1990) IL-6 is an accessory signal in the alternative CD2-mediated pathway of T cell activation. J. Immunol. 144 (12) : 4681-7. Lu B, Yu H, Chow C, Li B, Zheng W, Davis RJ, Flavell RA. (2001) GADD45gamma mediates the activation of the p38 and JNK MAP kinase pathways and cytokine production in effector TH1 cells. Immunity. 14(5):583-90. Lucey DR, Clerici M, Shearer GM (1996) Type 1 and type 2 cytokine dysregulation in human infectious, neoplastic, and inflammatory diseases. Clin Microbiol Rev. 9(4):532-62. Luksch CR, Winqvist O, Ozaki ME, Karlsson L, Jackson MR, Peterson PA, Webb SR (1999) Intercellular adhesion molecule-1 inhibits interleukin 4 production by naive T cells. Proc Natl Acad Sci U S A. 96(6):3023-8. Macatonia SE, Hsieh CS, Murphy KM, O'Garra A. (1993) Dendritic cells and macrophages are required for Th1 development of CD4+ T cells from alpha beta TCR transgenic mice: IL-12 substitution for macrophages to stimulate IFN-gamma production is IFN-gamma-dependent. Int Immunol. 5(9):1119-28. Macatonia SE, Hosken NA, Litton M, Vieira P, Hsieh CS, Culpepper JA, Wysocka M, Trinchieri G, Murphy KM, O'Garra A. (1995) Dendritic cells produce IL-12 and direct the development of Th1 cells from naive CD4+ T cells. J Immunol. 154(10):5071-9. Maggi E, Parronchi P, Manetti R, Simonelli C, Piccinni MP, Rugiu FS, De Carli M, Ricci M, Romagnani S. (1992) Reciprocal regulatory effects of IFN-gamma and IL-4 on the in vitro development of human Th1 and Th2 clones. J Immunol. 148(7):2142-7. Magnusson M, Johansson E, Berg M, Eloranta ML, Fuxler L, Fossum C (2001) The plasmid pcDNA3 differentially induces production of interferon-alpha and interleukin-6 in cultures of porcine leukocytes. Vet. Immunol. Immunopathol. 78(1), 45-56. Magram J, Connaughton SE, Warrier RR, Carvajal DM, Wu CY, Ferrante J, Stewart C, Sarmiento U, Faherty DA, Gately MK. (1996) IL-12-deficient mice are defective in IFN gamma production and type 1 cytokine responses. Immunity. 4(5):471-81.

142

Maldonado-Lopez R, De Smedt T, Michel P, Godfroid J, Pajak B, Heirman C, Thielemans K, Leo O, Urbain J, Moser M. (1999) CD8alpha+ and CD8alpha- subclasses of dendritic cells direct the development of distinct T helper cells in vivo. J Exp Med. 189(3):587-92. Manetti R, Parronchi P, Giudizi MG, Piccinni MP, Maggi E, Trinchieri G, Romagnani S. (1993) Natural killer cell stimulatory factor (interleukin 12 [IL-12]) induces T helper type 1 (Th1)-specific immune responses and inhibits the development of IL-4-producing Th cells. J Exp Med. 177(4):1199-204. Manickan E, Yu Z, Rouse BT (1997) DNA immunisation of neonates induces immunity despite the presence of maternal antibody. J. Clin. Invest. 100 : 2371-2375. Marie JC, Kehren J, Trescol-Biemont MC, Evlashev A, Valentin H, Walzer T, Tedone R, Loveland B, Nicolas JF, Rabourdin-Combe C, Horvat B. (2001) Mechanism of measles virus-induced suppression of inflammatory immune responses. Immunity. 14(1):69-79. Matzinger P (1998) An innate sense of danger. Semin Immunol. 10(5):399-415. Ma X, Forns X, Gutierrez R, Mushahwar IK, Wu T, Payette PJ, Bukh J, Purcell RH, Davis HL (2002) DNA-based vaccination against hepatitis C virus (HCV) : effect of expressing different forms of HCV E2 protein and use of CpG-optimized vectors in mice. Vaccine 20, 3263-3271. McCluskie MJ, Weeratna RD, Davis HL (2000) The role of CpG in DNA vaccines. Springer Semin. Immunopathol. 22, 125-132. McGuirk P, Mills KH. (2002) Pathogen-specific regulatory T cells provoke a shift in the Th1/Th2 paradigm in immunity to infectious diseases. Trends Immunol. 23(9):450-5. McKenzie GJ, Emson CL, Bell SE, Anderson S, Fallon P, Zurawski G, Murray R, Grencis R, McKenzie AN. (1998) Impaired development of Th2 cells in IL-13-deficient mice. Immunity. 9(3):423-32. McKnight AJ, Perez VL, Shea CM, Gray GS, Abbas AK. (1994) Costimulator dependence of lymphokine secretion by naive and activated CD4+ T lymphocytes from TCR transgenic mice. J Immunol. 152(11):5220-5. Meyers JH, Ryu A, Monney L, Nguyen K, Greenfield EA, Freeman GJ, Kuchroo VK (2002) Cutting edge: CD94/NKG2 is expressed on Th1 but not Th2 cells and costimulates Th1 effector functions. J Immunol. 169(10):5382-6. Miletic VD, Frank MM (1995) Complement-immunoglobulin interactions. Curr Opin Immunol. 7(1):41-7. Miletic VD, Hester CG, Frank MM (1996) Regulation of complement activity by immunoglobulin. I. Effect of immunoglobulin isotype on C4 uptake on antibody-sensitized sheep erythrocytes and solid phase immune complexes. J Immunol. 156(2):749-57. Miller RA. (1996) The aging immune system: primer and prospectus. Science. 273(5271):70-4. Mills KH (2004) Regulatory T cells: friend or foe in immunity to infection? Nat Rev Immunol. 4(11):841-55. Minty A, Chalon P, Derocq JM, Dumont X, Guillemot JC, Kaghad M, Labit C, Leplatois P, Liauzun P, Miloux B, et al. (1993) Interleukin-13 is a new human lymphokine regulating inflammatory and immune responses. Nature. 362(6417):248-50. Mol O and Oudega B (1996) Molecular and structural aspect of fimbriae biosynthesis and assembly in Escherichia coli. FEMS Microbiology Reviews 19 : 25-52. Monney L, Sabatos CA, Gaglia JL, Ryu A, Waldner H, Chernova T, Manning S, Greenfield EA, Coyle AJ, Sobel RA, Freeman GJ, Kuchroo VK (2002) Th1-specific cell surface protein Tim-3 regulates macrophage activation and severity of an autoimmune disease. Nature. 415(6871):536-41 Moon H and Bunn T (1993) Vaccines for preventing enterotoxigenic Escherichia coli infections in animals. Vaccine 11 : 216-219.

143

Moore KW, de Waal Malefyt R, Coffman RL, O'Garra A. (2001) Interleukin-10 and the interleukin-10 receptor. Annu Rev Immunol. 19:683-765. Moser M, Murphy KM. (2000) Dendritic cell regulation of TH1-TH2 development. Nat Immunol. 1(3):199-205. Mosmann TR (1994) Properties and functions of interleukin-10. Adv. Immunol., 56 : 1-26. Mosmann TR, Cherwinski H, Bond MW, Giedlin MA, Coffman RL. (1986) Two types of murine helper T cell clone. I. Definition according to profiles of lymphokine activities and secreted proteins. J Immunol. 136(7):2348-57. Mosmann T, Yokota T, Kastelein R, Zurawski S, Arai N, Takebe Y (1987) Species-specificity of T cell stimulating activities of IL-2 and BSF-1 (IL-4) : comparison of normal and recombinant IL-2 and BSF-1 (IL-4). J. Immunol. 138 : 1813-1816. Mosmann TR, Coffman RL. (1989) TH1 and TH2 cells: different patterns of lymphokine secretion lead to different functional properties. Annu Rev Immunol. 7:145-73. Mullen AC, High FA, Hutchins AS, Lee HW, Villarino AV, Livingston DM, Kung AL, Cereb N, Yao TP, Yang SY, Reiner SL. (2001) Role of T-bet in commitment of TH1 cells before IL-12-dependent selection. Science. 292(5523):1907-10. Mumper RJ, Cui Z (2003) Genetic immunization by jet injection of targeted pDNA-coated nanoparticles. Methods. 31(3):255-62. Murata K, Ishii N, Takano H, Miura S, Ndhlovu LC, Nose M, Noda T, Sugamura K. (2000) Impairment of antigen-presenting cell function in mice lacking expression of OX40 ligand. J Exp Med. 191(2):365-74. Murphy KM, Reiner SL. (2002) The lineage decisions of helper T cells. Nat Rev Immunol. 2(12):933-44. Murphy E, Shibuya K, Hosken N, Openshaw P, Maino V, Davis K, Murphy K, O'Garra A. (1996) Reversibility of T helper 1 and 2 populations is lost after long-term stimulation. J Exp Med. 183(3):901-13. Murtaugh MP, Baarsch MJ, Zhou Y, Scamurra RW, Lin G (1996) Inflammatory cytokines in animal health and disease. Vet Immunol Immunopathol. 54(1-4):45-55. Mutwiri G, Pontarollo R, Babiuk S, Griebel P, van Drunen Little-van den Hurk S, Mena A, Tsang C, Alcon V, Nichani A, Ioannou X, Gomis S, Townsend H, Hecker R, Potter A, Babiuk LA (2003) Biological activity of immunostimulatory CpG DNA motifs in domestic animals. Vet. Immunol. Immunopathol. 91, 89-103. Nagy B and Fekete PZ (1999) Enterotoxigenic Escherichia coli (ETEC) in farm animals. Vet. Res. 30 : 259-284. Nakajima A, Watanabe N, Yoshino S, Yagita H, Okumura K, Azuma M. (1997) Requirement of CD28-CD86 co-stimulation in the interaction between antigen-primed T helper type 2 and B cells. Int Immunol. 9(5):637-44. Narum DL, Kumar S, Rogers WO, Fuhrmann SR, Liang H, Oakley M, Taye A, Sim BK, Hoffman SL (2001) Codon optimisation of gene fragments encoding Plasmodium falciparum merzoite proteins enhances DNA vaccine protein expression and immunogenicity in mice. Infect. Immun. 69 (12) : 7250-53. Nelms K, Keegan AD, Zamorano J, Ryan JJ, Paul WE (1999) The IL-4 receptor: signaling mechanisms and biologic functions. Annu Rev Immunol. 17:701-38. O'Garra A, Vieira PL, Vieira P, Goldfeld AE (2004) IL-10-producing and naturally occurring CD4+ Tregs: limiting collateral damage. J Clin Invest. 114(10):1372-8. O'Hagan D, Singh M, Ugozzoli M, Wild C, Barnett S, Chen M, Schaefer M, Doe B, Otten GR, Ulmer JB (2001) Induction of potent immune responses by cationic microparticles with adsorbed human immunodeficiency virus DNA vaccines. J. Virol. 75 (19) : 9037-43.

144

Ohshima Y, Yang LP, Uchiyama T, Tanaka Y, Baum P, Sergerie M, Hermann P, Delespesse G (1998) OX40 costimulation enhances interleukin-4 (IL-4) expression at priming and promotes the differentiation of naive human CD4(+) T cells into high IL-4-producing effectors. Blood. 92(9):3338-45. Okada E, Sasaki S, Ishii N, Aoki I, Yasuda T, Nishioka K, Fukushima J, Miyazaki J, Wahren B, Okuda K (1997) Intranasal immunisation of a DNA vaccine with IL-12 and granulocyte-macrophage colony-stimulating factor (GM-CSF)-expressing plasmids in liposome induces strong mucosal and cell-mediated immune responses against HIV-1 antigens. J. Immunol. 159 : 3638-47. Okamura H, Tsutsi H, Komatsu T, Yutsudo M, Hakura A, Tanimoto T, Torigoe K, Okura T, Nukada Y, Hattori K, et al.(1995) Cloning of a new cytokine that induces IFN-gamma production by T cells. Nature. 378(6552):88-91. Openshaw P, Murphy EE, Hosken NA, Maino V, Davis K, Murphy K, O'Garra A. (1995) Heterogeneity of intracellular cytokine synthesis at the single-cell level in polarized T helper 1 and T helper 2 populations. J Exp Med. 182(5):1357-67. Oppmann B, Lesley R, Blom B, Timans JC, Xu Y, Hunte B, Vega F, Yu N, Wang J, Singh K, Zonin F, Vaisberg E, Churakova T, Liu M, Gorman D, Wagner J, Zurawski S, Liu Y, Abrams JS, Moore KW, Rennick D, de Waal-Malefyt R, Hannum C, Bazan JF, Kastelein RA. (2000) Novel p19 protein engages IL-12p40 to form a cytokine, IL-23, with biological activities similar as well as distinct from IL-12. Immunity. 13(5):715-25. Orlando C, Pinzani P, Pazzagli M (1998) Developments in quantitative PCR. Clin. Chem. Lab. Med. 36, 255-269. Ørskov I, Ørskov F, Sojka WJ, Witting WK (1964) antigens K88ab (L) and K88ac (L) in E. coli. A new O antigen : O147 an a new K antigen : K89 (B). Acta Pathol. Microbiol. Scand. Sect. B 62 : 439-447. O'Shea JJ, Paul WE. (2002) Regulation of T(H)1 differentiation--controlling the controllers. Nat Immunol. 3(6):506-8. Ouyang W, Lohning M, Gao Z, Assenmacher M, Ranganath S, Radbruch A, Murphy KM. (2000) Stat6-independent GATA-3 autoactivation directs IL-4-independent Th2 development and commitment. Immunity. 12(1):27-37. Ouyang W, Ranganath SH, Weindel K, Bhattacharya D, Murphy TL, Sha WC, Murphy KM. (1998) Inhibition of Th1 development mediated by GATA-3 through an IL-4-independent mechanism. Immunity. 9(5):745-55. Pai SY, Truitt ML, Ho IC (2004) GATA-3 deficiency abrogates the development and maintenance of T helper type 2 cells. Proc Natl Acad Sci U S A. 101(7):1993-8. Paliard X, de Waal Malefijt R, Yssel H, Blanchard D, Chretien I, Abrams J, de Vries J, Spits H. (1988) Simultaneous production of IL-2, IL-4, and IFN-gamma by activated human CD4+ and CD8+ T cell clones. J Immunol. 141(3):849-55. Parham C, Chirica M, Timans J, Vaisberg E, Travis M, Cheung J, Pflanz S, Zhang R, Singh KP, Vega F, To W, Wagner J, O'Farrell AM, McClanahan T, Zurawski S, Hannum C, Gorman D, Rennick DM, Kastelein RA, de Waal Malefyt R, Moore KW. (2002) A receptor for the heterodimeric cytokine IL-23 is composed of IL-12Rbeta1 and a novel cytokine receptor subunit, IL-23R. J Immunol. 168(11):5699-708. Parnet P, Garka KE, Bonnert TP, Dower SK, Sims JE (1996) IL-1Rrp is a novel receptor-like molecule similar to the type I interleukin-1 receptor and its homologues T1/ST2 and IL-1R AcP. J Biol Chem. 271(8):3967-70. Parronchi P, De Carli M, Manetti R, Simonelli C, Sampognaro S, Piccinni MP, Macchia D, Maggi E, Del Prete G, Romagnani S. (1992) IL-4 and IFN (alpha and gamma) exert opposite regulatory effects on the development of cytolytic potential by Th1 or Th2 human T cell clones. J Immunol. 149(9):2977-83. Pfaffl MW, Georgieva TM, Georgiev IP, Ontsacka E, Hageleit M, Blum JW (2002) Real-time RT-PCR quantification of insulin-like growth factor (IGF)-1, IGF-1 receptor, IGF-2, IGF-2 receptor, insulin receptor,

145

growth hormone receptor, IGF-binding proteins 1, 2 and 3 in the bovine species. Dom. Anim. Endocrin. 22 : 91-102. Pflanz S, Timans JC, Cheung J, Rosales R, Kanzler H, Gilbert J, Hibbert L, Churakova T, Travis M, Vaisberg E, Blumenschein WM, Mattson JD, Wagner JL, To W, Zurawski S, McClanahan TK, Gorman DM, Bazan JF, de Waal Malefyt R, Rennick D, Kastelein RA. (2002) IL-27, a heterodimeric cytokine composed of EBI3 and p28 protein, induces proliferation of naive CD4(+) T cells. Immunity. 16(6):779-90. Piccotti JR, Li K, Chan SY, Ferrante J, Magram J, Eichwald EJ, Bishop DK (1998) Alloantigen-reactive Th1 development in IL-12-deficient mice. J Immunol. 160(3):1132-8. Pisetsky DS (1996) Immune activation by bacterial DNA: a new genetic code. Immunity. 5(4):303-10. Pisetsky DS and Reich CF 3rd. (1998) The influence of base sequence on the immunological properties of defined oligonucleotides. Immunopharmacology 40(3), 199-208. Pisetsky DS (1999) The influence of base sequence on the immunostimulatory properties of DNA. Immunol Res. 19(1):35-46. Pontarollo RA, Babiuk LA, Hecker R, van Drunen Littel-van den Hurk S (2002) Augmentation of cellular immune responses to bovine herpesvirus-1 glycoprotein D by vaccination with CpG-enhanced plasmid vectors. J. Gen. Virol. 83, 2973-81. Pontarollo RA, Rankin R, Babiuk LA, Godson DL, Griebel PJ, Hecker R, Krieg AM, van Drunen Little-van den Hurk S (2002) Monocytes are required for optimum in vitro stimulation of bovine peripheral blood mononuclear cells by non-methylated CpG motifs. Vet. Immunol. Immunopathol. 84, 43-59. Powrie F, Coffman RL. (1993) Cytokine regulation of T-cell function: potential for therapeutic intervention. Trends Pharmacol Sci. 14(5):164-8. Presky DH, Yang H, Minetti LJ, Chua AO, Nabavi N, Wu CY, Gately MK, Gubler U (1996) A functional interleukin 12 receptor complex is composed of two beta-type cytokine receptor subunits. Proc Natl Acad Sci U S A. 93(24):14002-7. Pulendran B, Smith JL, Caspary G, Brasel K, Pettit D, Maraskovsky E, Maliszewski CR. (1999) Distinct dendritic cell subsets differentially regulate the class of immune response in vivo. Proc Natl Acad Sci U S A. 96(3):1036-41. Punnonen J, Aversa G, Cocks BG, McKenzie AN, Menon S, Zurawski G, de Waal Malefyt R, de Vries JE. (1993) Interleukin 13 induces interleukin 4-independent IgG4 and IgE synthesis and CD23 expression by human B cells. Proc Natl Acad Sci U S A. 90(8):3730-4. Qin S, Tang H, Zhao LS, He F, Lin Y, Liu L, He XM (2003) Cloning of HBsAg-encoded genes in different vectors and their expression in eukaryotic cells. World J Gastroenterol. 9(5):1111-3. Ramer-Quinn DS, Baker RA, Sanders VM (1997) Activated T helper 1 and T helper 2 cells differentially express the beta-2-adrenergic receptor: a mechanism for selective modulation of T helper 1 cell cytokine production. J Immunol. 159(10):4857-67. Ramirez F (1998) Glucocorticoids induce a Th2 response in vitro. Dev Immunol. 6(3-4):233-43. Rankin R, Pontarollo R, Ioannou X, Krieg AM, Hecker R, Babiuk LA, van Drunen Little-van den Hurk S (2001) CpG motif identification for veterinary and laboratory species demonstrates that sequence recognition is highly conserved. Antisense Nucleic Acids Drug Dev. 11 (5), 333-340. Rankin R, Pontarollo R, Gomis S, Karvonen B, Willson P, Lochr B., Godson DL, Babiuk LA, Hecker R, van Drunen Littel-van den Hurk S (2002) CpG-containing oligodeoxunucleotides augment and switch the immune responses of cattle to bovine herpesvirus-1 glycoprotein D. Vaccine 20 (23/24), 3014-3022.

146

Raymond CR, Wilkie BN (2004) Th-1/Th-2 type cytokine profiles of pig T-cells cultured with antigen-treated monocyte-derived dendritic cells. Vaccine. 22(8):1016-23. Raz E and Spiegelberg HL (1999) Deviation of the allergic IgE to an IgG response by gene immunotherapy. Int. Rev. Immunol. 18(3), 271-289. Read S, Malmstrom V, Powrie F. (2000) Cytotoxic T lymphocyte-associated antigen 4 plays an essential role in the function of CD25(+)CD4(+) regulatory cells that control intestinal inflammation. J Exp Med. 192(2):295-302. Reddy NR, Borgs P, Wilkie BN (2000) Cytokine mRNA expression in leukocytes of efferent lymph from stimulated lymph nodes in pigs. Vet Immunol Immunopathol. 74(1-2):31-46. Reiner SL, Locksley RM. (1995) The regulation of immunity to Leishmania major. Annu Rev Immunol. 13:151-77. Reiner SL, Seder RA. (1995) T helper cell differentiation in immune response. Curr Opin Immunol. 360-6. Reiner SL, Wang ZE, Hatam F, Scott P, Locksley RM. (1993) TH1 and TH2 cell antigen receptors in experimental leishmaniasis. Science. 259(5100):1457-60. Rengarajan J, Szabo SJ, Glimcher LH. (2000) Transcriptional regulation of Th1/Th2 polarization. Immunol Today. 21(10):479-83. Rincon M, Enslen H, Raingeaud J, Recht M, Zapton T, Su MS, Penix LA, Davis RJ, Flavell RA. (1998) Interferon-gamma expression by Th1 effector T cells mediated by the p38 MAP kinase signaling pathway. EMBO J. 17(10):2817-29. Rissoan MC, Soumelis V, Kadowaki N, Grouard G, Briere F, de Waal Malefyt R, Liu YJ. (1999) Reciprocal control of T helper cell and dendritic cell differentiation. Science. 283(5405):1183-6. Robertson KD, Wolffe AP. (2000) DNA methylation in health and disease. Nat Rev Genet. 1(1):11-9. Robinson DS, O'Garra A. (2002) Further checkpoints in Th1 development. Immunity. 16(6):755-8. Robinson D, Shibuya K, Mui A, Zonin F, Murphy E, Sana T, Hartley SB, Menon S, Kastelein R, Bazan F, O'Garra (1997) A. IGIF does not drive Th1 development but synergizes with IL-12 for interferon-gamma production and activates IRAK and NFkappaB. Immunity. 7(4):571-81. Rodriguez-Palmero M, Hara T, Thumbs A, Hunig T. (1999) Triggering of T cell proliferation through CD28 induces GATA-3 and promotes T helper type 2 differentiation in vitro and in vivo. Eur J Immunol. 29(12):3914-24. Rogge L, Barberis-Maino L, Biffi M, Passini N, Presky DH, Gubler U, Sinigaglia F. (1997) Selective expression of an interleukin-12 receptor component by human T helper 1 cells. J Exp Med. 185(5):825-31. Rogge L, D'Ambrosio D, Biffi M, Penna G, Minetti LJ, Presky DH, Adorini L, Sinigaglia F. (1998) The role of Stat4 in species-specific regulation of Th cell development by type I IFNs. J Immunol. 161(12):6567-74. Rogge L, Papi A, Presky DH, Biffi M, Minetti LJ, Miotto D, Agostini C, Semenzato G, Fabbri LM, Sinigaglia F (1999) Antibodies to the IL-12 receptor beta 2 chain mark human Th1 but not Th2 cells in vitro and in vivo. J Immunol. 162(7):3926-32. Romagnani S (1991) Human Th1 and Th2 subsets : doubt no more. Immunol. Today 12(8) : 256-257. Romagnani S. (1994) Lymphokine production by human T cells in disease states. Annu Rev Immunol. 12:227-57. Romagnani S (2000) T-cell subsets (Th1 versus Th2). Ann Allergy Asthma Immunol.85(1):9-18.

147

Roman M, Martin-Orozco E, Goodman JS, Nguyen MD, Sato Y, Ronaghy A, Kronbluth RS, Richmann DD, Carson DA, Raz E (1997) Immunostimulatory DNA sequences function as T helper-1-promoting adjuvants. Nat. Med. 3 (8), 849-54. Roncarolo MG, Bacchetta R, Bordignon C, Narula S, Levings MK (2001) Type 1 T regulatory cells. Immunol Rev. 182:68-79. Rothel JS, Waterkeyn JG, Strugnell RA, Wood PR, Seow HF, Vadolas J, Lightowlers MW (1997) Nucleic acid vaccination of sheep : use in combination with a conventional adjuvanted vaccine against Taenia ovis. Immunol. Cell Biol. 75 : 41-46. Ryan EJ, Daly LM, Mills KH. (2001) Immunomodulators and delivery systems for vaccination by mucosal routes. Trends Biotechnol. 19(8):293-304. Sad S, Marcotte R, Mosmann TR. (1995) Cytokine-induced differentiation of precursor mouse CD8+ T cells into cytotoxic CD8+ T cells secreting Th1 or Th2 cytokines. Immunity. 2(3):271-9. Saikh KU, Sesno J, Brandler P, Ulrich RG (1998) Are DNA-based vaccines useful for protection against secreted bacterial toxins? Tetanus toxin test case. Vaccine 16 : 1029-1038. Sallusto F, Lanzavecchia A, Mackay CR. (1998) Chemokines and chemokine receptors in T-cell priming and Th1/Th2-mediated responses. Immunol Today. 19(12):568-74. Salomon B, Bluestone JA. (1998) LFA-1 interaction with ICAM-1 and ICAM-2 regulates Th2 cytokine production. J Immunol. 161(10):5138-42. Sanders VM, Baker RA, Ramer-Quinn DS, Kasprowicz DJ, Fuchs BA, Street NE (1997) Differential expression of the beta2-adrenergic receptor by Th1 and Th2 clones: implications for cytokine production and B cell help. J Immunol. 158(9):4200-10. Santra S, Barouch DH, Jackson SS, Kuroda MJ, Schmitz JE, Lifton MA, Sharpe AH, Letvin NL (2000) Functional equivalency of B7-1 and B7-2 for costimulating plasmid DNA vaccine-elicited CTL responses. J Immunol. 165(12):6791-5. Sato Y, Roman M, Tighe H, Lee D, Corr M, Nguyen MD, Silverman GJ, Lotz M, Carson DA, Raz E (1996) Immunostimulatory DNA sequences necessary for effective intradermal gene immunisation. Science 273, 352-354. Sawamura D, Ina S, Itai K, Meng X, Kon A, Tamai K, Hanada K, Hashimoto I (1999) In vivo gene introduction into keratinocytes using jet injection. Gene Ther. 6(10):1785-7 Scheerlinck JP, Casey G, McWaters P, Kelly J, Woollard D, Lightowlers MW, Tennent JM, Chaplin PJ (2001) The immune response to a DNA vaccine can be modulated by co-delivery of cytokine genes using a DNA prime-protein boost strategy. Vaccine 19 (28-29) : 4053-60. Schmitz J, Thiel A, Kuhn R, Rajewsky K, Muller W, Assenmacher M, Radbruch A. (1994) Induction of interleukin 4 (IL-4) expression in T helper (Th) cells is not dependent on IL-4 from non-Th cells. J Exp Med. 179(4):1349-53. Schneider J, Gilbert SC, Blanchard TJ, Hanke T, Robson KJ, Hannan CM, Becker M, Sinden R, Smith GL, Hill AV (1998) Enhanced immunogenicity for CD8+ T cell induction and complete protective efficacy of malaria DNA vaccination by boosting with modified vaccinia virus Ankara. Nat. Med. 4 : 397. Schrijver RS, Langedijk JP, Keil GM, Middel WG, Maris-Veldhuis M, Van Oirschot JT, Rijsewijk FA (1997) Immunisation of cattle with BHV1 vector vaccine or a DNA vaccine both encoding for the G protein of BRSV. Vaccine 15 (17-18) : 1908-16. Scott P. (1991) IFN-gamma modulates the early development of Th1 and Th2 responses in a murine model of cutaneous leishmaniasis. J Immunol. 147(9):3149-55.

148

Seder RA, Paul WE. (1994) Acquisition of lymphokine-producing phenotype by CD4+ T cells. Annu Rev Immunol. 12:635-73. Seder RA, Gazzinelli R, Sher A, Paul WE. (1993) Interleukin 12 acts directly on CD4+ T cells to enhance priming for interferon gamma production and diminishes interleukin 4 inhibition of such priming. Proc Natl Acad Sci U S A. 90(21):10188-92. Seder RA, Paul WE, Davis MM, Fazekas de St Groth B. (1992) The presence of interleukin 4 during in vitro priming determines the lymphokine-producing potential of CD4+ T cells from T cell receptor transgenic mice. J Exp Med. 176(4):1091-8. Seo N, Tokura Y, Takigawa M, Egawa K (1999) Depletion of IL-10- and TGF-beta-producing regulatory gamma delta T cells by administering a daunomycin-conjugated specific monoclonal antibody in early tumor lesions augments the activity of CTLs and NK cells. J Immunol. 163(1):242-9. Sharma AK, Khuller GK (2001) DNA vaccines: future strategies and relevance to intracellular pathogens. Immunol Cell Biol.79(6):537-46. Sharp PM and Li W-H (1987) The codon adaptation index – a measure of directional synonymous codon usage bias and its potential applications. Nucleic Acids Res. 15 (3) : 1281-1295. Shearer GM. (1997) Th1/Th2 changes in aging. Mech Ageing Dev. 94(1-3):1-5. Shedlock DJ, Weiner DB (2000) DNA vaccination: antigen presentation and the induction of immunity. J Leukoc Biol. 68(6):793-806. Sher A, Coffman RL (1992) Regulation of immunity to parasites by T cells and T cell-derived cytokines. Annu Rev Immunol. 10:385-409. Shevach EM. (2000) Regulatory T cells in autoimmmunity. Annu Rev Immunol. 18:423-49. Shimoda K, van Deursen J, Sangster MY, Sarawar SR, Carson RT, Tripp RA, Chu C, Vignali DA, Doherty PC, Grosveld G, Paul WE, Ihle JN. (1996) Lack of IL-4-induced Th2 response and IgE class switching in mice with disrupted Stat6 gene. Nature. 380(6575):630-3. Shimizu T, Streilein JW (1994) Influence of alpha-melanocyte stimulating hormone on induction of contact hypersensitivity and tolerance. J Dermatol Sci. 8(3):187-93. Shkreta L, Talbot BG, Lacasse P (2003) Optimization of DNA vaccination immune responses in dairy cows: effect of injection site and the targeting efficacy of antigen-bCTLA-4 complex. Vaccine. 21(19-20):2372-82. Siegal FP, Kadowaki N, Shodell M (1999) The nature of the principal type I interferon-producing cells in human blood. Science. 284, 1835-1837. Sierra-Honigmann MR, Murphy PA (1992) T cell receptor-independent immunosuppression induced by dexamethasone in murine T helper cells. J Clin Invest. 89(2):556-60. Sin JI, Kim JJ, Zhang D, Weiner DB (2001) Modulation of cellular responses by plasmid CD40L: CD40L plasmid vectors enhance antigen-specific helper T cell type 1 CD4+ T cell-mediated protective immunity against herpes simplex virus type 2 in vivo. Hum Gene Ther. 12(9):1091-102. Singh VK, Mehrotra S, Agarwal SS (1999) The paradigm of Th1 and Th2 cytokines: its relevance to autoimmunity and allergy. Immunol Res. 20(2):147-61. Singh M, Vajdy M, Gardner J, Briones M, O’Hagan D (2002) Mucosal immunisation with HIV-1 gag DNA on cationic microparticles prolongs gene expression and enhances local and systemic immunity. Vaccine 20 : 594-602. Sinigaglia F, D'Ambrosio D, Panina-Bordignon P, Rogge L (1999) Regulation of the IL-12/IL-12R axis: a critical step in T-helper cell differentiation and effector function. Immunol Rev. 170:65-72.

149

Sizemore DR, Branstrom AA, Sadoff JC (1995) Attenuated shigella as a DNA delivery vehicle for DNA-mediated immunisation. Science 270 : 299-302. Skeen MJ, Miller MA, Ziegler HK (1996) Interleukin-12 as an adjuvant in the generation of protective immunity to an intracellular pathogen. Ann N Y Acad Sci. 795:416-9. Smeltz RB, Chen J, Hu-Li J, Shevach EM (2001) Regulation of interleukin (IL)-18 receptor alpha chain expression on CD4(+) T cells during T helper (Th)1/Th2 differentiation. Critical downregulatory role of IL-4. J Exp Med. 194(2):143-53 Smith AL, Fazekas de St Groth B. (1999) Antigen-pulsed CD8alpha+ dendritic cells generate an immune response after subcutaneous injection withouthoming to the draining lymph node. J Exp Med. 189(3):593-8. Snapper CM, Mond JJ (1993) Towards a comprehensive view of immunoglobulin class switching. Immunol Today. 14(1):15-7. Snapper CM, Peschel C, Paul WE (1988) IFN-gamma stimulates IgG2a secretion by murine B cells stimulated with bacterial lipopolysaccharide. J Immunol. 140(7):2121-7. Solano Aguilar GI, Beshah E, Vengroski KG, Zarlenga D, Jauregui L, Cosio M, Douglass LW, Dubey JP, Lunney JK (2001) Cytokine and lymphocyte profiles in miniature swine after oral infection with Toxoplasma gondii oocysts. Int. J. Parasitol. 31 (2) : 187-95. Somasundaram C, Takamatsu H, Andréoni C, Audonnet J-C, Fischer L, Lefèvre F, Charley B (1999) Enhanced protective response and immuno-adjuvant effects of porcine GM-CSF on DNA vaccination of pigs against Aujeszky’s disease virus. Vet. Immunol. Immunopathol. 70 : 277-287. Sonoda KH, Faunce DE, Taniguchi M, Exley M, Balk S, Stein-Streilein J (2001) NK T cell-derived IL-10 is essential for the differentiation of antigen-specific T regulatory cells in systemic tolerance. J Immunol. 166(1):42-50. Sparwasser T, Koch ES, Vabulas RM, Heeg K, Lipford GB, Ellwart JW, Wagner H (1998) Bacterial DNA and immunostimulatory CpG oligonucleotides trigger maturation and activation of murine dendritic cells. Eur J Immunol. 28(6):2045-54. Spellberg B, Edwards JE Jr (2001) Type 1/Type 2 immunity in infectious diseases. Clin Infect Dis. 32(1):76-102. Steele BK, Meyers C, Ozbun MA (2002) Variable expression of some “housekeeping” genes during human keratinocyte differentiation. Anal. Biochem. 307 : 341-347. Steinberg T, Ohlschlager P, Sehr P, Osen W, Gissmann L (2005) Modification of HPV 16 E7 genes: correlation between the level of protein expression and CTL response after immunization of C57BL/6 mice. Vaccine. 23(9):1149-57. Stevens TL, Bossie A, Sanders VM, Fernandez-Botran R, Coffman RL, Mosmann TR, Vitetta ES (1988) Regulation of antibody isotype secretion by subsets of antigen-specific helper T cells. Nature. 334(6179):255-8 Stoll S, Jonuleit H, Schmitt E, Muller G, Yamauchi H, Kurimoto M, Knop J, Enk AH. (1998) Production of functional IL-18 by different subtypes of murine and human dendritic cells (DC): DC-derived IL-18 enhances IL-12-dependent Th1 development. Eur J Immunol. 28(10):3231-9. Stratford R, Douce G, Zhang-Barber L, Fairweather N, Eskola J, Dougan G (2000) Influence of codon usage on the immunogenicity of a DNA vaccine against tetanus. Vaccine. 19(7-8):810-5. Suberville S, Bellocq A, Fouqueray B, Philippe C, Lantz O, Perez J, Baud L (1996) Regulation of interleukin-10 production by beta-adrenergic agonists. Eur J Immunol. 26(11):2601-5 Sutherland M, Blaser K, Pene J (1993) Effects of interleukin-4 and interferon-gamma on the secretion of IgG4 from human peripheral blood mononuclear cells. Allergy. 48(7):504-10.

150

Swain SL, Weinberg AD, English M, Huston G. (1990) IL-4 directs the development of Th2-like helper effectors. J Immunol. 145(11):3796-806. Szabo SJ, Dighe AS, Gubler U, Murphy KM. (1997) Regulation of the interleukin (IL)-12R beta 2 subunit expression in developing T helper 1 (Th1) and Th2 cells. J Exp Med. 185(5):817-24. Szabo SJ, Jacobson NG, Dighe AS, Gubler U, Murphy KM.(1995) Developmental commitment to the Th2 lineage by extinction of IL-12 signaling. Immunity. 2(6):665-75. Szabo SJ, Kim ST, Costa GL, Zhang X, Fathman CG, Glimcher LH. (2000) A novel transcription factor, T-bet, directs Th1 lineage commitment. Cell. 100(6):655-69. Szabo SJ, Sullivan BM, Stemmann C, Satoskar AR, Sleckman BP, Glimcher LH (2002) Distinct effects of T-bet in TH1 lineage commitment and IFN-gamma production in CD4 and CD8 T cells. Science. 295(5553):338-42. Szekeres-Bartho J, Wegmann TG (1996) A progesterone-dependent immunomodulatory protein alters the Th1/Th2 balance. J Reprod Immunol. 31(1-2):81-95. Tachedjian M, Boyle JS, Lew AM, Horvatic B, Scheerlinck JP, Tennent JM, Andrew ME (2003) Gene gun immunization in a preclinical model is enhanced by B7 targeting. Vaccine. 21(21-22):2900-5. Taga K, Mostowski H, Tosato G. (1993) Human interleukin-10 can directly inhibit T-cell growth. Blood. 81(11):2964-71. Takagi T, Hashiguchi M, Mahato RI, Tokuda H, Takakura Y, Hashida M (1998) Involvement of specific mechanism in plasmid DNA uptake by mouse peritoneal macrophages.Biochem Biophys Res Commun. 245(3):729-33. Takahashi T, Tagami T, Yamazaki S, Uede T, Shimizu J, Sakaguchi N, Mak TW, Sakaguchi S (2000) Immunologic self-tolerance maintained by CD25(+)CD4(+) regulatory T cells constitutively expressing cytotoxic T lymphocyte-associated antigen 4. J Exp Med. 192(2):303-10. Takakura Y, Takagi T, Hashiguchi M, Nishikawa M, Yamashita F, Doi T, Imanishi T, Suzuki H, Kodama T, Hashida M (1999) Characterization of plasmid DNA binding and uptake by peritoneal macrophages from class A scavenger receptor knockout mice. Pharm Res. 16(4):503-8 Takeda K, Tanaka T, Shi W, Matsumoto M, Minami M, Kashiwamura S, Nakanishi K, Yoshida N, Kishimoto T, Akira S. (1996) Essential role of Stat6 in IL-4 signalling. Nature. 380(6575):627-30. Takeda A, Hamano S, Yamanaka A, Hanada T, Ishibashi T, Mak TW, Yoshimura A, Yoshida H (2003) Cutting edge: role of IL-27/WSX-1 signaling for induction of T-bet through activation of STAT1 during initial Th1 commitment. J Immunol.;170(10):4886-90. Takemoto N, Kamogawa Y, Jun Lee H, Kurata H, Arai KI, O'Garra A, Arai N, Miyatake S. (2000) Cutting edge: chromatin remodeling at the IL-4/IL-13 intergenic regulatory region for Th2-specific cytokine gene cluster. J Immunol. 165(12):6687-91. Tang DC, Devit M, Johnston SA (1992) Genetic immunisation is a simple method for eliciting an immune response. Nature (London) 356 : 152-154. Tanghe A, D'Souza S, Rosseels V, Denis O, Ottenhoff TH, Dalemans W, Wheeler C, Huygen K (2001) Improved immunogenicity and protective efficacy of a tuberculosis DNA vaccine encoding Ag85 by protein boosting. Infect. Immun. 69 (5) : 3041-47. Taoufik Y, Lantz O, Wallon C, Charles A, Dussaix E, Delfraissy JF. (1997) Human immunodeficiency virus gp120 inhibits interleukin-12 secretion by human monocytes: an indirect interleukin-10-mediated effect. Blood. 89(8):2842-8.

151

Thellin O, Zorzi W, Lakaye B, De borman B, Coumans B, Hennen G, Grisar T, Igout A, Heinen E (1999) Housekeeping genes as internal standards : use and limits. J. Biotechnol 75(2-3) : 291-295. Tighe H, Corr M, Roman M, Raz E (1998) Gene vaccination : plasmid DNA is more than just a blueprint. Immunol. Today 19, 89-97. Townsend MJ, Fallon PG, Matthews DJ, Jolin HE, McKenzie AN.J. (2000) TS1/ST2-deficient mice demonstrate the importance of T1/ST2 in developing primary T helper cell type 2 responses. J Exp Med. 191(6):1069-76. Tregaskes CA and Young JR (1997) Cloning of chicken lymphocyte marker cDNAs from eukaryotic expression libraries, p. 2295-2314. In I. Lefkovits (ed.), Immunology methods manual, London Academic Press, London, England. Trinchieri G. (1993) Interleukin-12 and its role in the generation of TH1 cells. Immunol Today. 14(7):335-8. Trinchieri G (2003) Interleukin-12 and the regulation of innate resistance and adaptive immunity. Nat Rev Immunol. 2003 Feb;3(2):133-46. Trinchieri G, Scott P (1999) Interleukin-12: basic principles and clinical applications. Curr Top Microbiol Immunol. 238:57-78. Uchijima M, Yoshida A, Nagata T, Koide Y (1998) Optimisation of codon usage of plasmid DNA vaccine is required for the effective MHC class I-restricted T cell responses against intracellular bacterium. J. Immunol. 161 : 5594-99. Ulmer JB, Donnelly JJ, Parker SE, Rhodes GH, Felgner PL, Dwarki VJ, Gromkowski SH, Deck RR, DeWitt CM, Friedman A, et al (1993) Heterologous protection against influenza by injection of DNA encoding a viral protein. Science 259 : 1745-1749. Ulmer JB, Fu TM, Deck RR, Friedman A, Guan L, DeWitt C, Liu X, Wang S, Liu MA, Donnelly JJ, Caulfield MJ (1998) Protective CD4+ and CD8+ T cells against influenza virus induced by vaccination with nucleoprotein DNA. J Virol. 72(7):5648-53. Urban JF, Madden KB, Svetic A, Cheever A, Trotta PP, Gause WC, Katona IM, Finkelman FD (1992) The importance of Th-2 cytokines in protective immunity to nematodes. Immunol. Rev. 127 : 205-220. Usui T, Nishikomori R, Kitani A, Strober W (2003) GATA-3 suppresses Th1 development by downregulation of Stat4 and not through effects on IL-12Rbeta2 chain or T-bet. Immunity. 18(3):415-28. Vandenbroeck K, Dijkmans R, Van Aerschot A, Billiau A (1991) Engineering by PCR-based exon amplification of the genomic porcine interferon-gamma DNA for expression on Escherichia Coli. Biochem. Biophys. Res. Commun. 180 (3) : 1408-1415. Van den Broeck W, Cox E, Goddeeris B (1999) Receptor-dependent immune response in pigs after oral immunization with F4 fimbriae. Infect. Immun. 67(2) : 520-526. Van den Broeck W, Cox E, Goddeeris BM (1999b) Induction of immune responses in pigs following oral administration of purified F4 fimbriae. Vaccine 17 : 2020-2029. Van der Kleij D, Van Remoortere A, Schuitemaker JH, Kapsenberg ML, Deelder AM, Tielens AG, Hokke CH, Yazdanbakhsh M. (2002) Triggering of innate immune responses by schistosome egg glycolipids and their carbohydrate epitope GalNAc beta 1-4(Fuc alpha 1-2Fuc alpha 1-3)GlcNAc. J Infect Dis. 185(4):531-9. Van der Stede Y, Cox E, Verdonck F, Vancaeneghem S, Goddeeris BM (2003) Reduced faecal excretion of F4+-E. coli by the intramuscular immunisation of suckling piglets by the addition of 1alpha,25-dihydroxyvitamin D(3) or CpG-oligodeoxynucleotides. Vaccine 21(9-10) : 1023-1032. Van der Stede Y, Verdonck F, Vancaeneghem S, Cox E, Goddeeris BM (2002) CpG-oligonucleotides as an effective adjuvant in pigs for intramuscular immunisations. Vet. Immunol. Immunopathol. 86 : 31-41.

152

Van Donkersgoed J, Dubeski PL, Aalhus JL, VanderKop M, Dixon S, Starr WN (1999) The effect of vaccines and antimicrobials on the formation of injection site lesions in subprimals of experimentally injected beef calves. Can Vet J. 40(4):245-51. Van Drunen Littel-van den Hurk S, Braun RP, Lewis PJ, Karvonen BC, Babiuk LA, Griebel PJ (1999) Immunisation of neonates with DNA encoding a bovine herpesvirus glycoprotein is effective in the presence of maternal antibodies. Viral. Immunol. 12 : 67-77. van Drunen Littel-van den Hurk S, Babiuk SL, Babiuk LA (2004) Strategies for improved formulation and delivery of DNA vaccines to veterinary target species. Immunol Rev. 199:113-25. van Oirschot JT, Kaashoek MJ, Rijsewijk FA, Stegeman JA (1996) The use of marker vaccines in eradication of herpesviruses. J Biotechnol. 44(1-3):75-81. Vanrompay D, Cox E, Mast J, Goddeeris BM, Volckaert G (1998) High-level expression of Chlamydia psittaci major outer membrane protein in COS cells and in skeletal muscles of turkeys. Infect. Immun. 66 (11) : 5494-5500. Vella AT and Pearce EJ (1992) CD4+ Th2 response induced by Schistosoma mansoni eggs develops rapidly through an early, transient, Th0-like stage. J. Immunol. 148 (7) : 2283-2290. Verfaillie T, Cox E, LT To, Vanrompay D, Bouchaut H, Buys N, Goddeeris BM (2001) Comparative analysis of porcine cytokine production by mRNA and protein detection. Vet. Immunol. Immunopathol. 81 : 97-112. Verfaillie T, Melkebeek V, Snoek V, Douterlungne S, Verdonck F, Vanrompay D, Goddeeris B, Cox E (2004) Priming of piglets against F4 fimbriae by immunisation with FaeG DNA. Vaccine 22(13-14), 1640-1647. Vieira PL, Kalinski P, Wierenga EA, Kapsenberg ML, de Jong EC (1998) Glucocorticoids inhibit bioactive IL-12p70 production by in vitro-generated human dendritic cells without affecting their T cell stimulatory potential. J Immunol. 161(10):5245-51. Vinner L, Nielsen HV, Bryder K, Corbet S, Nielsen C, Fomsgaard A (1999) Gene gun DNA vaccination with Rev-independent synthetic HIV-1 gp160 envelope gene using mammalian codons. Vaccine. 17(17):2166-75. Vordermeier HM, Lowrie DB and Hewinson RG (2003) Improved immunogenicity of DNA vaccination with mycobacterial HSP65 against bovine tuberculosis by protein boosting. Vet. Microbiol. 93 : 349-359. Walsh PT, Taylor DK, Turka LA (2004) Tregs and transplantation tolerance. J Clin Invest. 114(10):1398-403. Wang AM, Doyle MV, Mark DF (1989) Quantitation of mRNA by the polymerase chain reaction. Proc. Natl. Acad. Sci. USA 86, 9717-21. Watts AM, Kennedy RC (1999) DNA vaccination strategies against infectious diseases. Int J Parasitol. 29(8):1149-63. Weiss A, Shields R, Newton M, Manger B, Imboden J (1987) Ligand-receptor interactions required for commitment to the activation of the interleukin 2 gene. J. Immunol. 138(7) : 2169-76. Wenner CA, Guler ML, Macatonia SE, O'Garra A, Murphy KM. (1996) Roles of IFN-gamma and IFN-alpha in IL-12-induced T helper cell-1 development. J Immunol. 156(4):1442-7. Wernette CM, Smith BF, Barksdale ZL, Hecker R, Baker HJ (2002) CpG oligodeoxynucleotides stimulate canine and feline immune cell proliferation. Vet. Immunol. Immunopathol. 84 (3/4), 223-236. Westerman RB, Mills KW, Phillips RM, Fortner GW, Greenwood JM (1988) Predominance of the ac variant in K88-positive Escherichia coli isolates from swine. J. Clin. Microbiol. 26 : 149-150. Wickert L, Steinkrüger S, Abiaka M, Bolkenuis U, Purps O, Schnabel C, Gressner AM (2002) Quantitative monitoring of the mRNA expression pattern of the TGF-b isoforms (b1, b2, b3) during transdifferentiation of

153

hepatic stellate cells using a newly developed real-time SYBR green PCR. Biochem. Biophys. Res. Com. 295 : 330-335. Widera G, Austin M, Rabussay D, Goldbeck C, Barnett SW, Chen M, Leung L, Otten GR, Thudium K, Selby MJ, Ulmer JB (2000) Increased DNA vaccine delivery and immunogenicity by electroporation in vivo. J Immunol. 164(9):4635-40. Wills-Karp M, Luyimbazi J, Xu X, Schofield B, Neben TY, Karp CL, Donaldson DD. (1998) Interleukin-13: central mediator of allergic asthma. Science. 282(5397):2258-61. Wloch MK, Pasquini S, Ertl HC. Pisetsky DS (1998) The influence of DNA sequence on the immunostimulatory properties of plasmid DNA vectors. Hum. Gene Ther. 9(10), 1439-1447. Wolff JA, Malone RW, Williams P, Chong W, Acsadi G, Jani A, Felgner PL (1990) Direct gene transfer into mouse muscle in vivo. Science. 247:1465-8. Wood KJ, Sakaguchi S (2003) Regulatory T cells in transplantation tolerance. Nat Rev Immunol. 3(3):199-210. Wu CY, Demeure C, Kiniwa M, Gately M, Delespesse G. (1993) IL-12 induces the production of IFN-gamma by neonatal human CD4 T cells. J Immunol. 151(4):1938-49. Wu L, Li CL, Shortman K (1996) Thymic dendritic cell precursors: relationship to the T lymphocyte lineage and phenotype of the dendritic cell progeny. J Exp Med. 184(3):903-11. Wu Y, Wang X, Csencsits KL, Haddad A, Walters N, Pascual DW (2001) M cell-targeted DNA vaccination. PNAS 98 (5) : 9318-23. Wynn TA, Eltoum I, Cheever AW, Lewis FA, Gause WC, Sher A (1993) Analysis of cytokine mRNA expression during primary granuloma formation induced by eggs of schistosoma mansoni. J. Immunol. 151 : 1430-40. Xu D, Chan WL, Leung BP, Huang F, Wheeler R, Piedrafita D, Robinson JH, Liew FY. (1998b) Selective expression of a stable cell surface molecule on type 2 but not type 1 helper T cells. J Exp Med. 187(5):787-94. Xu D, Chan WL, Leung BP, Hunter D, Schulz K, Carter RW, McInnes IB, Robinson JH, Liew FY. (1998) Selective expression and functions of interleukin 18 receptor on T helper (Th) type 1 but not Th2 cells. J Exp Med. 188(8):1485-92. Xu-Amano J, Jackson RJ, Fujihashi K, Kiyono H, Staats HF, McGhee JR (1994) Helper Th1 and Th2 cell responses following mucosal or systemic immunization with cholera toxin. Vaccine 12(10) : 903-11. Yamamoto S, Yamamoto T, Kataoka T, Kuramoto E, Yano O, Tokunaga T (1992) Unique palindromic sequences in synthetic oligonucleotides are required to induce IFN [correction of INF] and augment IFN-mediated [correction of INF] natural killer activity. J Immunol.148(12):4072-6. Yamamoto T, Yamamoto S, Kataoka T, Tokunaga T (1994) Lipofection of synthetic oligodeoxyribonucleotide having a palindromic sequence of AACGTT to murine splenocytes enhances interferon production and natural killer activity. Microbiol. Immunol. 38(10), 831-836. Yancy H, Ayers SL, Farrell DE, Day A, Myers MJ (2001) Differential cytokine mRNA expression in swine whole blood and peripheral mononuclear cell cultures. Vet. Immunol. Immunopathol. 79 (1-2) : 41-52. Yang J, Murphy TL, Ouyang W, Murphy KM. (1999) Induction of interferon-gamma production in Th1 CD4+ T cells: evidence for two distinct pathways for promoter activation. Eur J Immunol. 29(2):548-55. Yang J, Zhu H, Murphy TL, Ouyang W, Murphy KM. (2001) IL-18-stimulated GADD45 beta required in cytokine-induced, but not TCR-induced, IFN-gamma production. Nat Immunol. 2(2):157-64.

154

Yankauckas MA, Morrow JE, Parker SE, Abai A, Rhodes GH, Dwarki VJ, Gromkowski SH (1993) Long-term anti-nucleoprotein cellular and humoral immunity is induced by intramuscular injection of plasmid DNA containing the NP gene. DNA cell Biol. 12 : 771-776. Yasuda K, Kawano H, Yamane I, Ogawa Y, Yoshinaga T, Nishikawa M, Takakura Y (2004) Restricted cytokine production from mouse peritoneal macrophages in culture in spite of extensive uptake of plasmid DNA. Immunology. 111(3):282-90. Yates A, Callard R, Stark J (2004) Combining cytokine signalling with T-bet and GATA-3 regulation in Th1 and Th2 differentiation: a model for cellular decision-making. J Theor Biol. 231(2):181-96. Yoshida H, Hamano S, Senaldi G, Covey T, Faggioni R, Mu S, Xia M, Wakeham AC, Nishina H, Potter J, Saris CJ, Mak TW. (2001) WSX-1 is required for the initiation of Th1 responses and resistance to L. major infection. Immunity. 15(4):569-78. Yi AK, Tuetken R, Redford T, Waldschmidt M, Kirsch J, Krieg AM (1998) CpG motifs in bacterial DNA activate leukocytes through the pH-dependent generation of reactive oxygen species. J Immunol. 160(10):4755-61. Yoshimoto T, Takeda K, Tanaka T, Ohkusu K, Kashiwamura S, Okamura H, Akira S, Nakanishi K (1998) IL-12 up-regulates IL-18 receptor expression on T cells, Th1 cells, and B cells: synergism with IL-18 for IFN-gamma production. J Immunol. 161(7):3400-7. Zhang Y, Shoda LK, Brayton KA, Estes DM, Palmer GH, Brown WC (2001) Induction of interleukin-6 and interleukin-12 in bovine B lymphocytes, monocytes, and macrophages by a CpG oligodeoxynucleotide (ODN 2059) containing the GTCGTT motif. J. Interferon Cytokine Res. 21 (10), 871-881. Zhao H, Cheng SH, Yew NS (2000) Requirements for effective inhibition of immunostimulatory CpG motifs by neutralizing motifs. Antisense Nucleic Acid Drug Dev. 10(5), 381-389. Zheng W, Flavell RA. (1997) The transcription factor GATA-3 is necessary and sufficient for Th2 cytokine gene expression in CD4 T cells. Cell. 89(4):587-96. Zimmerman K and Mannhalter JW (1996) Technical aspects of quantitative competitive PCR. BioTechniques 21 : 268-279. Zingoni A, Soto H, Hedrick JA, Stoppacciaro A, Storlazzi CT, Sinigaglia F, D'Ambrosio D, O'Garra A, Robinson D, Rocchi M, Santoni A, Zlotnik A, Napolitano M. (1998) The chemokine receptor CCR8 is preferentially expressed in Th2 but not Th1 cells. J Immunol. 161(2):547-51. Zuckermann FA, Husmann RJ, Schwartz R, Brandt J, Mateu de Antonio E, Martin S (1998) Interleukin-12 enhances the virus-specific interferon gamma response of pigs to an inactivated pseudorabies virus vaccine. Vet Immunol Immunopathol. 63(1-2):57-67

155

PART IV

GENERAL

DISCUSSION

AND

CONCLUSIONS

Chapter 8 : General discussion

156

CHAPTER 8 : GENERAL DISCUSSION AND CONCLUSIONS

8.1. DETECTION OF CYTOKINE PROFILES DURING IMMUNE RESPONSES IN PIGS

Analyzing cytokine profiles in pigs during the course of infection or following

vaccination is essential to gain insight into the induced immune responses and to help clarify

possible immunostimulatory and/or -suppressive mechanisms. However, the accurate

determination of cytokine levels can be difficult. In general, released cytokines interact with

their target cells, which are often adjacent to the producer cells resulting in short lifetimes of

the circulating protein. In addition, producer cells may secrete very small quantities of

cytokine, resulting in the need for highly sensitive assays.

Existing methods for evaluating expression of Th1 and Th2 cytokines can be divided

into two major groups. At the protein level, immunohistochemical staining, ELISA,

bioassays, radioimmunoassays (RIA) and flow cytometry can be used. At the transcriptional

level, (semi)-quantitative RT-PCR, in situ hybridization, Northern blotting and RNAse

protection assays (RPA) are described. Each method however has his own limitations. For

example, commonly used bioassays which measure the biological activity of the secreted

cytokines are often not sufficiently specific and may be influenced by the presence of

inhibitory factors. Other assays such as ELISA or RIA measure the net amount of a secreted

cytokine after production, absorption and degradation has taken place. These methods also do

not provide information about secreting cell types. Immunohistochemistry on the other hand,

does allow for the identification of cytokine-secreting cell types and detects cytokine proteins

directly (Salguero et al., 2002). However, it gives variable results, lacks a high degree of

sensitivity and the process of generating statistically meaningful data are tedious. Flow

cytometric analysis of intracellular cytokine staining allows quantification of cellular cytokine

protein production and concurrent identification of the secreting cell type (Stinn et al., 1998).

Northern blotting and RPA have traditionally been used to measure cytokine mRNA, but

these methods are time consuming, labour intensive, require large amounts of high quality

RNA and often do not give an accurate quantification. Using in situ hybridization, secreting

cell types can be identified but it is technically difficult and levels of cytokine transcripts in

vivo may be insufficient for detection. At present, (semi)-quantitative RT-PCR is the method

of choice used to quantify mRNA expression of cytokines which are often expressed at very

low levels (Giulietti et al., 2001). However, RT-PCR results give no information about the

source of the detected transcript.

Chapter 8 : General discussion

157

8.1.1. Comparing cytokine mRNA and protein levels

The first aim of this study was to design, optimize and validate techniques for

measuring cytokine gene expression in pigs. RT-PCR is commonly used to study gene-

specific mRNA based on the assumption that this is correlated with protein production. In this

context it is interesting to note that most cytokines are primarily regulated at the

transcriptional level by the initiation of RNA synthesis e.g. IL-2, IFN-γ, IL-4, IL-5 and TNF-

α (Brorson et al., 1991 ; Dokter et al., 1993 ; Swoboda et al., 1991 ; Naora and Young, 1995 ;

Raabe et al., 1998 ; Han et al., 1990). However, for some cytokines such as IL-6 and IL-10,

production likely is also mediated at the posttranscriptional level by enhancement of mRNA

stability. Additionally, not only the cytokine but also the nature of the stimulus used to

activate T cells should be considered. Indeed, Dokter et al. (1993) showed that ConA induced

the transcription of the IL-4 and IL-3 genes in human T cells, whereas phorbol myristate

acetate (PMA) had an effect on the posttranscriptional level by increasing the stability of both

mRNAs.

An important question to resolve in this thesis was whether a good correlation exists in

pigs between the amount of cytokine mRNA determined by RT-PCR and the amount of

secreted cytokines quantified by ELISA or bioassay using different stimuli. Or better, can

mRNA levels of cytokines be used to quantify their biologically active counterparts, i.e.

proteins? For the cytokines IL-2, IFN-γ and IL-10 produced in in vitro stimulated PBMC, we

found that the kinetics of the gene levels corresponded to the protein levels detected in

supernatans of stimulated PBMC if the time after stimulation is restricted to the first 24 hours.

Good correlation between cytokine mRNA expression and protein levels were also described

in humans for IL-1β, IL-2, IL-4, IL-10, IFN-γ, TNF-α and TGF-β in PBMC as well as in

tissue samples (Mocellin et al., 2003 ; Halminen et al., 1997 ; Altfeld et al., 2000 ; Dokter et

al., 1993). Nevertheless, in a study on the measurement of IL-4 mRNA expression and protein

production in PBMC stimulated with PHA or PMA it was shown that misleading information

can be obtained by only using one method (Burns et al., 1997). The differences could be

explained by the fact that PMA has an effect on the mRNA stability as reported by Dokter et

al. (1993) showing higher protein levels and lower mRNA transcripts than PHA.

Another important point to take into account for heterodimeric cytokines such as IL-

12, IL-23 and IL-27 is that they need the expression of both their subunits to generate a

biologically active protein and that both their subunits may be differentially regulated

(Trinchieri and Scott, 1999). Moreover, subunits exist that are part of different cytokines. This

Chapter 8 : General discussion

158

is the case for IL-12 and IL-23 which both contain the subunit p40 (Oppmann et al., 2000).

Thus, when studying IL-12 cytokine expression, it is important to evaluate both IL-12p35 as

well as IL-12p40 gene expression levels to generate accurate result whereas this is not needed

when detecting protein levels.

8.1.2. Possible pitfalls of quantitative RT-PCR

Initially, a semi-quantitative RT-PCR assay was developed to detect IL-2, IFN-γ, IL-4

and IL-10. To generate more quantitative results, this assay was expanded to a competitive

RT-PCR for IFN-γ, IL-10 and TGF-β and subsequently, with the advent of a LightCycler

PCR machine in our lab, to real-time RT-PCR for the cytokines IL-1α, IL-6, TNF-α (pro-

inflammatory cytokines), IL-2, IFN-γ (Th1-like cytokines), IL-4, IL-10 (Th2-like cytokines)

and TGF-β (Th3-like cytokine). In chapter 5, we compared the developed competitive RT-

PCR and real time RT-PCR assays and showed that both techniques are equally accurate to

quantitate gene expression in swine. However, real-time RT-PCR showed major advantages

over competitive RT-PCR including its conceptual simplicity, practical ease and high

throughput making this technique the method of choice in future experiments. The same

findings were also reported by other research groups (Wall and Edwards, 2002 ; Desjardin et

al., 1998 ; Kim et al., 2002 ; Goerke et al., 2001 ; Schwarz et al., 2002 ; Yuan et al., 2000 ;

Wattjes et al., 2000).

Today, both competitive and real-time RT-PCR have become frequently used tools in

in vitro as well as in in vivo research for measuring cytokine mRNA expression (IL-2, IL-4,

IL-6, IL8, IL-10, IL-12p35, IL-12p40, IL-13, IFN-γ, TGF-β and TNF-α) in pigs (Fischer et

al., 2000 ; Yates et al., 2002 ; Choi et al., 2002 ; Katoh et al., 2004 ; Lee et al., 2004 ; Peuster

et al., 2004 ; Dawson et al., 2005 ; Kawahara et al., 2002 ; Raymond and Wilkie, 2004). In

our lab, the developed real-time RT-PCR assay has already been used to evaluate the

immuno-modulating/stimulating effects of agents such as vitamin D3, CpG-motifs and β-

glucans in in vitro studies and in vivo immunization experiments (Van der Stede et al., 2002 ;

Van der Stede et al., 2004 ; Verfaillie T. et al., 2005 ; Vancaeneghem S. et al., unpublished

results).

While real-time RT-PCR adresses many of the difficulties inherent to conventional

end-point RT-PCR, it has become increasingly clear that it engenders new problems that

require urgent attention. To generate reliable and comparable data using quantitative RT-

PCR, some critical considerations concerning the standardization of the assay and the

Chapter 8 : General discussion

159

appropriate normalization should be made which are too often bypassed (reviewed by Bustin,

2002 ; Bustin and Nolan, 2004) :

- First, the variability of RT-PCR results obtained even from identical samples

assayed in different laboratories is a problem. The most likely source of this variation

is the person carrying out the experiment as has been documented by Bustin (2002).

When presenting RT-PCR results as a ratio of the target gene/housekeeping gene some

of the operator variability may be neutralized. In our experiments, cytokine analysis

has always been done in a standardized manner by the same investigator to exclude

this interpersonal variability and by using the same batches of reagents to minimize

batch influences. The recent introduction of robotics preparing template and

dispensing reagents may be a helpfull tool (Mifflin et al., 2000). Additionally, it is

very important that when results are being published, an accurate and comprehensive

description of the protocol used is included.

- Second, for the interpretation of quantitative gene expression measurements, a

"normalizer" is necessary to correct for differences in cellular input, RNA quality and

RT efficiency between samples. Inaccurate normalization results in inadequate

quantification and spurious conclusions. Untill now most studies are using a single

housekeeping gene, which regulate basic and ubiquitous cellular functions, for

normalization. Some of the most frequently used code for components of the

cytoskelet (β-actin), major histocompatibility complex (β-2-microglobulin), glycolytic

pathway (glyceraldehyde-3-phospate (GAPDH)), metabolic salvage of nucleotides

(hypoxanthine ribosyltransferase (HPRT)), protein folding (cyclophilin) or synthesis

of ribosome units (rRNA). It's becoming more and more clear that differences in

expression levels of housekeeping genes may exist between different individuals (de

Leeuw et al., 1989) or occur as a result of pathological changes (Bhatia et al., 1994) or

cell differentiation (Shimokawa et al., 1998). A lot of attention now is focussed on the

validation of housekeeping genes in different experimental settings and different

tissues because without the appropriate choice of housekeeping gene(s), the

expression profile of a target gene may be misinterpreted (de Kok et al. 2005 ; Aerts et

al., 2004 ; Hamalainen et al., 2001 ; Tricarico et al., 2002 ; Steele et al., 2002 ; Thellin

et al., 1999 ; Dheda et al., 2004 ; Biederman et al., 2004 ; Mahoney et al., 2004).

Especially when studying in vivo cytokine responses in different tissues, it is

suggested that the best option is to measure the expression of multiple (2 or 3)

housekeeping genes and to normalize using the mean expression (Vandesompele et

Chapter 8 : General discussion

160

al., 2002). An alternative strategy that often is suggested is normalization against

accurately quantified total RNA (Tricario et al., 2002). An important consideration

when using total RNA for normalization is the lack of control of the RNA quality and

RT and PCR efficiency.

In our RT-PCR assays, cyclophilin A, a peptidyl-prolyl isomerase with a function in

protein folding, was chosen as the housekeeping gene since Dozois et al. (1997) had

demonstrated that cyclophilin A could be used to study cytokine profiles in porcine PBMC

after in vitro stimulation. Other studies in pigs as well as in humans used cyclophilin A for

normalization when cytokine responses in PBMC were analyzed (Choi et al., 2001 ; Yap et

al., 1999). Moreover, cyclophilin A expression levels have been described as relative

consistent in a variety of tissues (brain, liver, heart, duodenum and skin) and under a variety

of conditions (Danielson et al., 1988 ; Griffiths et al., 1990 ; Steele et al., 2002). Nevertheless,

caution is needed when using cyclophilin A in in vivo experiments to detect cytokine

responses in different tissues. For example, Biederman et al. (2004) demonstrated that

cyclophiline A is a poor reference gene in diabetic glomeruli showing that the validation of

housekeeping genes is highly specific for a particular experimental model.

8.1.3. Influence of sample processing on the cytokine expression pattern

In studying cytokine responses during the course of infection or in vaccination

experiments, it has been shown that the method of sample collection and processing may

influence the level of cytokine mRNA (Härtel et al., 2001 ; Duvigneau et al., 2003).

Therefore, it is generally accepted that blood samples for analysis of cytokine expression are

processed as soon as possible and under standardized conditions. Because immediate sample

processing is not always possible, the following should be considered. Blood withdrawal and

sample processing represent stimulatory events since immune cells are subjected to non-

physiological conditions such as contact with artificial surfaces and the application of shear

stress (Pomianek et al., 1996 ; Härtel et al., 2001). Moreover, anticoagulants also have an

influence on certain functional parameters of PBMC (Repo et al., 1995 ; Conklyn et al., 1996

; Müller-Steinhardt et al., 1998). It should be assumed that all these conditions may act as

early activation signals. A delay in sample processing then gives the cells time to process

these signals into changed cytokine expression levels.

Chapter 8 : General discussion

161

In human blood, 2 hours after sampling a significant increase of IL-2, IL-4 and TNF-α

expression was observed which further increased during subsequent manipulation of the

PBMC preparation (Härtel et al., 2001).

Duvigneau et al. (2003) investigated the effect of storage time and storage temperature

(room temperature and 4°C) on the gene expression of IL-1α, IL-2, IL-6, IL-8, IL-10 and

IFN-γ in porcine blood samples. Results showed that the expression of monocyte-derived

cytokines, such as IL-1α and IL-6 but also the expression of IL-10 was already increased 2

hours after storage at both temperatures demonstrating the sensitivity of monocytes to

environmental changes. Expression of IL-8 was only increased in the samples stored at room

temperature and expression of IFN-γ was raised exclusively in the samples stored at 4°C.

These results indicate that refrigeration, in contrast to what is generally assumed, cannot be

used to delay or suppress undesired activation processes leading to abberant cytokine

expression patterns. Duvigneau et al. (2003) concluded that porcine blood samples should be

processed within 2 hours to prevent undesired stimulatory effect on the cytokine expression

pattern.

8.1.4. IL-4 in pigs

In in vitro as well as in vivo studies in our lab, IL-4 mRNA expression was either not

detected or only at very low levels (Verfaillie et al., 2001 ; 2004 ; 2005 ; Van der Stede et al.,

2004). The same was observed in studies in pig efferent lymph leukocytes following

stimulation of lymph nodes with hen egg white lysozyme (HEWL), LPS, PHA,

Mycobacterium bovis (Reddy et al., 2000) and in swine T-cells incubated with pig monocyte-

derived dentritic cells treated with HEWL or killed M. tuberculosis (Raymond and Wilkie,

2004). In mice and humans, IL-4 has several immunoregulatory roles including steering Th2

differentiation following antigenic stimulation and simultaneously inhibiting the proliferation

of Th1 cells (Swain et al., 1990 ; Hsieh et al., 1993). It is suggested that in pigs other

cytokines may substitute IL-4 in the development of Th2 responses. An important candidate is

IL-13. IL-13 is produced by several cell types, including activated T cells and shares many

structural and functional properties with IL-4 (de waal Malefyt et al., 1993 ; Wills-Karp,

2001). Shared activities include stimulation of murine B cells, inhibition of the production of

pro-inflammatory cytokines, induction of IL-1 receptor antagonist by monocyte/macrophages

and the regulation of isotype class switching in B cells to IgE synthesis (de waal Malefyt et

al., 1993b ; Defrance et al., 1994 ; Cocks et al., 1993). These shared functions are due to a

Chapter 8 : General discussion

162

common receptor chain (Wills-Karp, 2001). Therefore, it seems likely that in pigs, IL-13

substitutes IL-4 in regulating immune responses making IL-13 definitely an interesting

candidate to include in future studies on Th1/Th2 responses in pigs.

8.2. A NEW VACCINATION STRATEGY AGAINST F4+ ETEC INFECTIONS IN PIGS

In spite of the numerous efforts to develope an effective and safe vaccine against F4+

ETEC infection in pigs, at present none of them have proven to be succesfull in protecting

newly weaned piglets. Attempts have been made using parenteral or oral vaccines without

success (Moon and Bunn, 1993 ; Isaacson, 1994 ; Bozic et al., 2002). In our lab, parenteral

vaccination was able to prime the mucosal immune system but this did not result in protection

(Van der Stede et al., 2001 ; Van der Stede et al., 2003). Only oral vaccination of weaned pigs

with purified F4 fimbriae showed to be successful (Van den Broeck et al., 1999b), whereas

attempts to vaccinate suckling piglets either with fimbrial solutions (Bertschinger et al., 1979

; Francis and Willgohs, 1991) or with F4 fimbrial pellets (Snoeck et al., 2003) only resulted in

a marginal but significant reduction in F4+ E. coli colonization.

8.2.1. A DNA prime/protein boost model for vaccination against F4+ ETEC in pigs

A relatively novel immunization strategy is "heterologous prime/boost" vaccination

which uses DNA vaccines, recombinant virus and protein in different assortments, which

"prime" the immune system to the vaccine antigen first, followed by a subsequent "booster"

immunization, which enhances the preliminary response (reviewed by Woodland, 2004 ;

McShane, 2002 ; Ramshaw and Ramsay, 2000). Strategies gaining the most attention

typically involve the consecutive delivery of a DNA vaccine followed by protein or a

recombinant virus vector expressing the homologous antigen. Several studies have

demonstrated the efficacy of such prime/boost vaccination strategies in different animal

models against a variety of pathogens (Scheerlinck et al., 2001 ; Vordermeier et al., 2003 ;

Hammond et al., 2001 ; Nam et al., 2002 ; Tapia et al., 2003 ; Wang et al., 2004 ; Horton et

al., 2002 ; McShane et al., 2001 ; Tanghe et al., 2001 ; Takeda et al., 2003 ; Gilbert et al.,

2002 ; Schneider et al., 2001 ; Gonzalo et al., 2003 ; Schneider et al., 1999). Moreover, some

studies have shown that prime/boost vaccination also represents an interesting strategy for

early life immunization (Martinez et al., 1999 ; Siegriest et al., 1998 ; Rasmussen et al.,

2002).

Chapter 8 : General discussion

163

At weaning, pigs are about 4 weeks old. To be protected at this stage, the first

immunization, which probably will only prime the immune system, should happen at the age

of about one week. As most suckling piglets will have maternal antibodies, oral and systemic

immunization with classical protein vaccines are unefficient. To circumvent these problems

we proposed a new strategy using an FaeG DNA vaccine to prime the piglets since DNA

vaccines are believed to be superior to protein vaccines in these circumstances. Thus, priming

with DNA during the suckling period combined with an oral F4 protein boost after weaning

could be an interesting approach to obtain protection shortly after weaning.

A first step was to construct and test the pcDNA1/faeG19 DNA vaccine in a

heterologous prime/boost model on its ability to prime the immune response against F4+

ETEC in weaned pigs (chapter 6).

We investigated the influence of 2 different methods of DNA delivery (IM injection vs

gene gun inoculation) as the method of antigen delivery can affect the type of immune

response induced. It is well documented that injection tend to bias the response raised towards

a Th1 response whereas the response raised by gene gun vaccination is biased towards a Th2

response (Feltquate et al., 1997). In our study, IM needle injection was superior to the

intradermal gene gun immunization with respect to priming of humoral immune responses.

The same was observed by Deml et al. (2001) although in most studies comparing both

techniques the opposite results are usually obtained (Barfoed et al., 2004 ; Lodmell et al.,

2001 ; Stasikova et al., 2003). Cytokine profiles evaluated after IM priming of the pigs with

pcDNA1/faeG19 showed the anticipated Th1-like pattern (high IFN-γ and low IL-4 levels). It

is often hypothesized that only the injected amount of DNA (correlating with the amount of

CpG motifs) is responsible for the Th1/Th2 polarization observed using both methods.

However, Weiss et al. (2002) recently demonstrated that the gene gun bombardement

procedure itself may also provide for a danger signal that promotes a strong Th2 response. In

this study, we can not conclude that the observed Th1-like pattern is simply the result of the

delivery method used since cytokine profiles were not evaluated using the gene gun. This was

due to practical limitations. Nevertheless, future studies may address this question.

Another point to consider in deciding the route of inoculation is the target site of

vaccination. IM injection and gene gun delivery preferentially elicit systemic responses

whereas topical delivery (vaginal, intranasal, tongue) is preferred when a mucosal immune

response is required. Protective antibody responses against ETEC mainly require activation of

local IgA production. However, our results with pcDNA1/faeG19 administered IM by needle

injection or ID using a gene gun followed by an IM protein boost showed a systemic priming

Chapter 8 : General discussion

164

but not a mucosal one since no IgA antibodies were raised. To surmount this shortcoming,

mucosal targeting of a DNA vaccine which has already been proven its effect in other studies

(Wang et al., 2003 ; Vecino et al., 2004 ; Wang et al., 2004b ; Wu et al., 2001 ; Singh et al.,

2002 ; Okada et al., 1997 ; Jones et al., 1998 ; Loehr et al., 2001 ; Macklin et al., 1998 )

and/or orally boosting with purified F4 fimbriae may be the answer to this problem.

8.2.2. The role of CpG-motifs in DNA vaccination

It is generally believed that 2 factors contribute to the efficacy of a DNA expression

vector : (1) the quality of the foreign gene expression unit and (2) the intrinsic adjuvant

properties of the DNA, which are determined by the complex interaction of

immunostimulatory and inhibitory sequence motifs (Gurunathan et al., 2000). Thus, a

possible consideration for optimizing DNA vaccines is through the adjuvant effects provided

by immunostimulatory CpG motifs within the inoculated vector. We evaluated in vitro the

immunostimulating properties of the pcDNA1 vector used in our DNA vaccin compared to

the vectors pcDNA3.1 and pCI, which vary in the nature and the amount of certain CpG

motifs present on their backbone (Chapter 7). Results showed that pcDNA1 had no

immunostimulating activity on both proliferation as well as on cytokine-induction in PBMC

compared to pcDNA3.1 and pCI. For increasing the efficacy of the pcDNA1/faeG19 DNA

vaccine, insertion of a number of optimal porcine-specific CpG motifs, such as the motif

5'ATCGAT3' described by Kamstrup et al. (2001) into the plasmid backbone should

definitely be an option.

To do so, some facts should be considered. (1) The choice of the immunostimulatory

CpG-motif inserted in the vector is very important because its immunostimulatory capacity is

species-specific. Observations made in rodents cannot automatically be extrapolated to

domestic animals. Caution is also recommended for extrapolation of in vitro results to in vivo

immunization experiments since Van der Stede et al. (2002, 2003) showed that a certain CpG-

motif had no immunostimulating effect on porcine PBMCs in vitro as opposed to his in vivo

findings where this motif did have an adjuvant effect in IM immunization experiments.

Moreover, the optimal number and sites of CpG motifs to be cloned into a DNA vaccine are

yet to be determined. (2) Several studies in mice have shown that insertion of an optimal

number of immunostimulatory CpG motifs in the plasmid construct could enhance the

immunogenicity of DNA vaccines (Sato et al., 1996 ; Krieg et al., 1998 ; Ma et al., 2002 ;

Kojima et al., 2002). Only few studies however are reported in large animals. One study in

Chapter 8 : General discussion

165

cattle did show a dose dependent enhancement of antigen-specific cellular immune responses

by insertion of CpG-motifs in the plasmid backbone of a DNA vaccine (Pontarollo et al.,

2002). (3) This approach is complicated by putative neutralizing motifs as described in mice

(Krieg et al., 1998) and the immunogenicity of a DNA vector may therefore depend on the

balance between stimulatory and neutralizing motifs. If so, their efficacy might also be

improved by removal of neutralizing motifs instead of addition of species-specific stimulatory

motifs (Davis, 2000 ; Zhao et al., 2000). Krieg et al. (1998) demonstrated that removal of 52

of the 134 identified suppressive motifs in a DNA vaccine enhanced its induction of Th1-type

responses in vivo and this induction was further enhanced by the addition of CpG motifs. On

the other hand, Ma et al. (2002) showed that removal of 55 neutralizing motifs did not affect

the immune response, but the addition of 64 immunostimulatory motifs significantly

augmented the antibody titers. (4) It should be noted that too many motifs can result in

decreased responses. Because IFN-γ is reported to downregulate the activity of viral

promoters, it has been suggested that the high levels of IFN-γ induced by CpG motifs might

reduce the amount of antigen expressed by the cytomegalovirus (CMV) promoter used in a

number of DNA vaccines (McCluskie et al., 2000) (5) Instead of inserting CpG motifs into

the DNA vaccine vector, it would be easier to improve the immunogenicity by simply the co-

administration of a CpG-enriched plasmid or CpG-ODN with the DNA vaccine. An

interesting result was obtained by Kojima et al. (2002) who examined the time course over

which CpG-enriched plasmids optimally may boost DNA vaccinated immunogenicity.

Highest cellular (2x higher) and humoral (5x higher) responses were detected when the CpG-

enriched plasmid was administered 2 days after DNA vaccination instead of concommitant

with the DNA vaccine. This was explained by the fact that delivering the CpG motifs at

precisely the time of maximal antigen production may be the key to optimally boost

immunogenicity. Addition of synthetic CpG-ODN as an adjuvant for DNA vaccines have also

been described. Unfortunately, it has been shown in mice that mixing high doses of CpG-

ODN with antigen-encoding plasmid DNA may result in a dose-dependent reduction of the

immune response. This is likely due to competitive interference by ODN on entry of plasmid

DNA into the target cells (Weeratna et al., 1998 ; Deml et al., 2001 ; McCluskie et al., 2000).

8.2.3. CpG-ODN as vaccine adjuvants

Besides their use in DNA vaccination studies with limited effects, CpG-ODN have

clearly proven its adjuvant activity with a variety of vaccine antigens in several animal

Chapter 8 : General discussion

166

species including pigs (Alcon et al., 2003 ; Chu et al., 1997 ; Davis et al., 1998 ; Ioannou et

al., 2002a ; Jones et al., 1999 ; Davis et al., 2000 ; Ioannou et al., 2002b ; Rankin et al., 2002

; Van der Stede et al., 2002 ; Van der Stede et al., 2003 ; Kanellos et al., 1999). Secondly,

because of its immunomodulatory capacity (favoring the development of Th1 responses),

CpG-ODN may serve as a potent adjuvant for various antigens favoring the development of

Th1 responses since most adjuvants used today, e.g. aluminium salts and Freund's type

adjuvants, induce primarily Th2 responses which may in some cases not be adequate for

protection (Ballas et al., 1996 ; Chu et al., 1997 ; Lipford et al., 1997 ; Roman et al., 1997;

Zimmermann et al., 1998). Moreover, due to the Th2 biased immune system of neonates

(Morein et al., 2002) and the interest in using DNA vaccines to induce protective immunity in

neonatal animals, (additional) CpG-motifs incorporated in de DNA vaccine vector may switch

immune responses from Th2 to Th1-like responses in neonates. This has already been

demonstrated for protein vaccines using CpG-ODN as an adjuvant (Kovarik et al., 1998 ;

Brazolot et al., 1998 ; Weeratna et al., 2001 ; Mutwiri et al., 2003).

8.2.4. Other optimization strategies to be explored

Some aspects are already under investigation in our lab. The introduction of a Kozak

sequence and an intron A into the vector and optimization of the codon usage resulted in

increased immune responses. Moreover, as ETEC replicate extracellularly and DNA vectored

antigen is synthesized and processed intracellular, the use of a plasmid vector which promotes

the secretion of the encoded antigen improves the responses (Melkebeek et al., submitted *

welke referentie moet ik hier gebruiken???). This was also the case for CFA/I fimbriae of

ETEC where antibody responses significantly improved using plasmid vectors promoting the

secretion of the encoded antigens (Alves et al., 2001 ; Boyle et al., 1997).

8.3. MAIN CONCLUSIONS AND FUTURE PERSPECTIVES

DNA vaccination in pigs is still in its infancy. However, several studies have been

done to show that DNA vaccines can work in pigs, but they not always result in protection as

is the case for a lot of other constructs. In the development of a DNA vaccine against F4+

ETEC, a first step was taken within this thesis. In a next step, the vaccine construct and

vaccination conditions should be further improved and evaluated in our prime/boost model to

Chapter 8 : General discussion

167

eventually start with immunization experiments using 1 week old piglets in the presence of

maternal antibodies.

Evaluating cytokine responses by quantitive RT-PCR is an important tool to study the

nature of the immune response induced in vaccination studies as well as for evaluating

possible immunomodulating factors. Expanding this technique to detect other important

cytokines such as IL-12, IL-18, IL-23, IL-27 (Th1-like cytokines) and IL-13 (Th2-like

cytokine) might provide additional information on immune responses generated in

immunization studies.

If DNA vaccines are to be used in the pig "industry", it must be possible to deliver

them easily and en masse, they must be efficacious (if not in producing complete protection,

but at least in priming the subject) and they must be affordable. There is much yet to be done

in understanding and improving DNA vaccines for pigs. However, studies to date have shown

that this new type of vaccine will on the long term find its way to farms as part of the arsenal

used against diseases.

168

CURRICULUM VITAE

Tine Verfaillie werd geboren op 20 maart 1972 te Brugge. In 1990 beëindigde zij haar

secundaire opleiding, richting Latijn-Wiskunde, aan het Sint-Lodewijkscollege te Brugge.

Vervolgens begon ze aan de studies Geneeskunde aan de Katholieke Universiteit Leuven. In

1993 behaalde ze het diploma van kandidaat in de Geneeskunde met onderscheiding. Twee

jaar later besloot ze echter een andere weg in te slaan en begon aan de licentie Biotechnologie

aan de Universiteit Gent. In 1997 studeerde ze af als licentiate in de Biotechnologie met grote

onderscheiding. Vrijwel onmiddellijk daarna startte ze haar onderzoek aan het Laboratorium

voor Immunologie van de Huisdieren. Gedurende 5 jaar verdiepte zij zich in de wereld van de

cytokines bij het varken en begon zij met de ontwikkeling van een DNA vaccin gericht tegen

Enterotoxigene E. coli infecties. Dit onderzoek werd uitgevoerd onder leiding van Prof. Dr. E.

Cox en Prof. Dr. B. Goddeeris en leidde tot dit proefschrift. Tevens behaalde zij in 2005 het

getuigschrift voor de doctoraatsopleiding in de diergeneeskundige wetenschappen. Tine is

auteur en co-auteur van wetenschappelijke publicaties.

169

PUBLICATIONS

- Rottiers P, Verfaillie T, Contreras R, Revets H, Desmedt M, Dooms H, Fiers W, Grooten J

(1998) Differentiation of EL4 lymphoma cells by tumoral environment is associated with

inappropriate expression of the large chondroitin sulfate proteoglycan PG-M and the tumor-

associated antigen Htgp-175., Int. J. Cancer. 78, 503-510.

- Verfaillie T, Cox E, To LT, Vanrompay D, Bouchaut H, Buys H, Goddeeris BM (2001)

Comparative analysis of porcine cytokine production by mRNA and protein detection., Vet.

Immunol. and Immunopathol. 81, 97-112.

- Van Der Stede Y, Verfaillie T, Cox E, Verdonck F, Goddeeris BM (2004) 1alpha,25-

dihydroxyvitamin D3 increases IgA serum antibody responses and IgA antibody-secreting

cell numbers in the Peyer's patches of pigs after intramuscular immunization. Clin Exp

Immunol. 135(3):380-90.

- Verfaillie T, Verdonck F, Cox E (2004) A simple PCR-based test for the detection of canine

leukocyte adhesion deficiency. Vet Rec. 154(26), 821-3.

- Verfaillie T, Melkebeek V, Snoek V, Douterlungne S, Cox E, Verdonck F, Vanrompay D,

Goddeeris B, Cox E (2004) Priming of piglets against enterotoxigenic E. coli F4 fimbriae by

immunisation with FAEG DNA. Vaccine. 22(13-14):1640-7.

- Verfaillie T, Cox E, Goddeeris BM (2005) Immunostimulatory capacity of DNA vaccine

vectors in porcine PBMC: a specific role for CpG-motifs? Vet. Immunol. Immunopathol.

103(1-2):141-51.

- Van der Stede Y, Verdonck F, Verfaillie T, Goddeeris BM, Cox E (2005) Porcine-specific

CpG-oligonucleotide activates B-cells and increases the expression of MHC-II molecules on

lymphocytes. Vet. Immunol. Immunopathol. In press.

170

ABSTRACTS, POSTERS AND ORAL PRESENTATIONS

- Rottiers P, Verfaillie T, Dooms H, Desmedt M, Contreras R, Fiers W, Grooten J (1997) A

monoclonal antibody reactive with a tumor antigen that is expressed upon tumor progression.

Immunology Letters, Abstracts of the 13th European Immunology Meeting, Amsterdam, Vol

56, 1-3, P.5.16.05, P336.

- Verfaillie T, Cox E, To LT, Vanrompay D, Bouchaut H, Buys H, Goddeeris BM (1998)

Kinetics of porcine cytokines in mitogen- and F4 fimbriae-stimulated peripheral blood

monomorphonuclear cells. Oral presentation and abstract, Fourth annual Meeting of the group

du contact du FNR : Human Vaccines, University of Liège.

- Van der Stede Y, Verfaillie T, Cox E, Goddeeris BM (1999) Modulation by calcitriol of the

IgA response in pigs against intramuscularly injected antigens. Abstract and poster.

Immunology Letters, 69 (1) : 60, 11.21. 10th International Congres of Mucosal Immunology,

june 27-juli 1, Amsterdam.

- Van der Stede Y, Verfaillie T, Bouchaut H, Cox E, Goddeeris BM (2000) The use of 1.25

dihydroxyvitamin D3 to modulate an intramusculary induced immune response in pigs., 2nd

International Veterinary Vaccines and Diagnostics Conference, Oxford 23-28 july 2000,

Poster and Abstract, P17 ; p63.

- Cox E, Van der Stede Y, Verfaillie T, Goddeeris BM (2000) Calcitriol as modulator of the

IgA resonse in pigs. Keystone Symposia: Innate and acquired Immunity at Mucosal Surfaces.

January 18-23, Sagebrush Inn, Taos, New Mexico. Abstract and Poster.

- Van der Stede Y, Verfaillie T, Bouchaut H, Cox E, Goddeeris BM (2000) The use of

calcitriol to modulate an IM induced immune response in pigs. Vaccines: new concepts and

strategies. Belgian Immunological society and the FRSM-contact group on human vaccines.

BIS meeting 24 november 2000, Charleroi. Poster

171

- Verfaillie T, Van der Stede Y, Van Caeneghem S., Verdonck E., Cox E, Goddeeris BM

(2001) Detection of porcine cytokines using real-time fluorescence PCR. Sixth International

Veterinary Immunology Symposium, July 15-20, 2001, Uppsala, Sweden. Poster PS10:21.

- Van der Stede Y, Van Caeneghem S, Verfaillie T, Verdonck E, Cox E, Goddeeris BM

(2001) Detection of porcine cytokines using real-time fluorescence PCR. Sixth International

Veterinary Immunology Symposium, July 15-20, 2001, Uppsala, Sweden. Abstract PS10:21.

- Verfaillie T, Douterlungne S, Cox E, Verdonck F, Vanrompay D, Van der Stede Y,

Goddeeris BM (2002) A FaeG DNA vaccine against F4ac+ enterotoxigenic E. coli infections

in pigs. Extended Abstract and Poster, The Gene Vaccine Conference, Edinburgh Scotland,

UK, 23-25 October 2002.

Summary

172

SUMMARY

Intestinal infections caused by enterotoxigenic Escherichia coli can lead to neonatal

and post-weaning diarrhoea in swine which may result in severe economic losses. In general,

most neonatal infections can be prevented by vaccination of the sows hereby providing

lactogenic immunity to the offspring. However, this passive protection decreases with aging

and at weaning lactogenic immunity disappears making newly weaned animals highly

susceptible to enteropathogens. In order to protect newly weaned piglets against ETEC

infections they should be vaccinated during the suckling period. However, at present no

commercial vaccine allows successful vaccination which is partly due to the presence of

maternally derived antibodies. A more recent approach in vaccine development is DNA

vaccination. As maternal antibodies will not inhibit the DNA vaccine itself because antigen is

not available untill de novo synthesis occurs in the transfected cells, this may be an interesting

approach to face this problem. In the present thesis, we determined whether the fimbrial

adhesin (FaeG) of F4ac+ ETEC could be used as a plasmid DNA vaccine in pigs. Hereto, the

capacity of a newly constructed DNA vaccine (pcDNA1/faeG19) to prime the immune

response against F4+ ETEC was studied in a heterologous prime/boost model.

In vaccination studies, antibody and proliferative responses are the most frequently

used parameters to measure immune responses generated. Additionally, cytokine profiles may

also give valuable information on the type of immune response elicited. They can influence

the outcome of vaccination by exerting effects on various stages in the immune response,

including enhancement of antigen presentation, polarization of T helper subsets, regulation of

antibody isotype production and expansion of the T and B cell memory pool. Attempts to

define the immune response mechanisms operating in vaccinations or in elimination of

foreign pathogens should involve studies on the regulatory functions of these cytokines. In

our search for a reliable (semi)-quantitative method for measuring cytokine levels we

designed, optimized and validated several techniques for measuring cytokine gene expression

in pigs.

One of the most interesting proposals in immunology has been the division of T helper

cells into two classes (Th1 and Th2 cells) based on their cytokine profiles. Chapter 1 reviews

the current status on the Th1/Th2 paradigm in humans and mice. The functional and

phenotypical differences between Th1 and Th2 cells, the factors responsible for their

Summary

173

polarization, the transcriptional regulation of Th1 and Th2 cell development and the

regulatory mechanism involved are described.

In chapter 2 the present knowledge on the Th1/Th2 paradigm in pigs is discussed and

an overview is given of the cloned porcine cytokines known to date.

Chapter 3 briefly reviews the potential of DNA vaccines in veterinary medicin. The

advantages and disadvantages compared to conventional vaccines as well as the possible

mechanisms by which a DNA vaccine induces an immune response in the host are being

discussed. Finally, a number of strategies to increase the efficacy of DNA vaccines in large

animals are presented.

Chapters 4 to 7 present the experimental work of this research. The aim of this study

was to answer the following questions :

• Can we use a (semi)-quantitative RT-PCR technique to accurately quantify

cytokine transcripts in pigs?

• Can the fimbrial adhesin (FaeG) of F4+ ETEC be used in a plasmid DNA

vaccine in pigs?

• In view of improving the efficacy of DNA vaccines in pigs, is it possible that

the nature and the amount of certain CpG motifs present on plasmid DNA

might have an effect on their immunostimulatory capacity in pigs?

A reliable quantitative method for measuring cytokine levels is necessary in

investigating the relationship between cytokines and the immune response induced by

pathogens. An important question to resolve in this thesis was whether a good correlation

exists in pigs between the amount of cytokine mRNA determined by RT-PCR and the amount

of secreted cytokines quantified by ELISA or bioassay using different stimuli. Or better, can

mRNA levels of cytokines be used to quantify their biologically active counterparts, i.e.

proteins? Therefore, in chapter 4 we assessed the cytokine profiles (IL-2, IFN-γ (Th1-like

cytokines) and IL-4, IL-10 (Th2-like cytokines)) of PBMC induced by 3 different mitogens

Summary

174

(concanavalin A, pokeweed mitogen and phytohemagglutinin) at the mRNA level as well as

at the protein level. As the production of a cytokine is highly dependent of the time after

stimulation, we also defined the time kinetic profiles of the cytokine production. For the

cytokines IL-2, IFN-γ and IL-10, we found that the kinetics of the gene levels corresponded to

the protein levels detected in supernatans of stimulated PBMC if the time after stimulation is

restricted to the first 24 hours.

Initially, a conventional end-point RT-PCR assay was developed to detect IL-2, IFN-γ,

IL-4 and IL-10 (cfr. chapter 4). To generate more quantitative results, we needed to expand

this assay. In chapter 5, a competitive RT-PCR assay using homologous DNA competitors

and a LightCycler RT-PCR assay using SYBR green I were developed and compared for their

value in studying cytokine mRNA expression in pigs. Both techniques were tested for their

ability to quantify the transcription of porcine IFN-γ (Th1-like), IL-10 (Th2-like) and TGF-β

(Th3-like) in concanavalin A-stimulated PBMC. Comparison of the quantities of IFN-γ, IL-10

and TGF-β mRNA expression, measured using either competitive or real-time RT-PCR,

showed a significant similarity. Inter-assay variability remained below 16% for both assays

but a higher sensitivity (10 vs 100-1000 copies per reaction) and an increased dynamic range

(8 vs 4 log units) were demonstrated for the real-time RT-PCR. Moreover, competitive RT-

PCR is labour intensive and time-consuming thereby limiting the number of samples that can

be analyzed at a given time. In conclusion, this makes real-time RT-PCR the preferable

technique for the analysis of cytokine mRNA expression in pigs. The technique was further

expanded to include other cytokines such as IL-1α, IL-2, IL-4, IL-6 and TNF-α. In all three

RT-PCR assays, the housekeeping gene cyclophilin A was used for normalization.

In chapter 6, the potential of a newly constructed FaeG DNA vaccine

(pcDNA1/faeG19) to induce B cell and T cell priming in 6-week-old pigs in a DNA prime-

protein boost model was examined. We investigated the influence of 2 different methods of

DNA delivery (IM vs gene gun injection) as this can affect the type of immune response

induced. First, pcDNA1/faeG19 was constructed and expression of rFaeG in Cos-7 cells was

demonstrated. Thereafter, pigs were immunized (days 0, 21 and 42) intramuscularly by

injection or intradermally by gene gun and humoral and cellular immune responses were

analyzed. Even though responses were low, results demonstrated that intramuscular injection

was superior to gene gun delivery for priming the humoral immune response since higher

Summary

175

antibody titres were raised, whereas gene gun delivery better induced a cellular response,

evaluated by a lymphocyte proliferation assay. Nevertheless, the pcDNA1/faeG19 vaccine

was shown to efficiently prime the immune system as judged by the rapid increase in IgG

antibody titres (4 to 5-fold) one week following the protein boost with purified F4. A rapid

anamnestic response upon exposure with the pathogen might be critical in the swift

elimination of disease before the host is overwhelmed by the infection. Moreover, since little

is known about porcine cytokine responses following DNA vaccination, we used the newly

developed real-time RT-PCR technique to determine cytokine profiles generated by this DNA

vaccine. Following only one intramuscular immunization, pigs demonstrated a bias towards a

Th1 type cytokine response as evidenced by the predominance of IFN-γ mRNA and

diminished IL-4 mRNA in PBMC after in vitro antigen-specific restimulation. It is well

established that IM injection of DNA has been associated with a predominant Th1 type

response. In this study however, we can not conclude that the observed Th1-like pattern is

simply the result of the delivery method used since cytokine profiles were not evaluated using

the gene gun. In conclusion, the elicited responses to the pcDNA1/faeG19 DNA vaccination

were low making further investigations into the delivery parameters and improvement of the

expression of the faeG gene in pigs necessary to enhance the efficacy of the DNA vaccine.

A possible consideration for optimizing DNA vaccines is through the adjuvant effects

provided by immunostimulatory CpG motifs within the inoculated vector. In chapter 7, we

evaluated in vitro the immunostimulating properties of the pcDNA1 vector used in our DNA

vaccin. Hereto, a panel of three CpG-ODN and three eukaryotic expression vectors currently

used in experimental DNA vaccines in pigs (pcDNA1, pcDNA3.1 and pCI) were screened for

their immunostimulatory activity on porcine PBMC by evaluating in vitro the lymphocyte

proliferative responses and cytokine profiles (IL-1α, IL-2, IL-4, IL-6, IL-10, IFN-γ, TGF-β,

TNF-α). The vectors were choosen so that they differed in number and nature of certain CpG-

motifs present on their backbone. CpG-ODN A (5’ATCGAT3’) and to a lesser extent CpG-

ODN C (5’AACGTT3’) significantly enhanced the proliferation of porcine PBMC in contrast

to CpG-ODN B (5’GACGTT3’) where no effect was observed. Furthermore, CpG-ODN A

significantly induced IL-6 and TNF-α together with elevated levels of IFN-γ and IL-2 mRNA

expression even though considerable heterogeneity was observed in the response of individual

pigs. Comparison of the 3 vectors showed significantly increased proliferative responses for

both pcDNA3.1 and pCI combined with a significant increase in IL-6 mRNA levels for pCI.

Summary

176

PcDNA1 had no immunostimulating activity on both proliferation as well as on cytokine-

induction in PBMC compared to pcDNA3.1 and pCI. CpG-ODN and plasmids both

suppressed the TGF-β and IL-1α mRNA expression. Taken together, these data confirm the

identity of an optimal immunostimulating CpG-motif in pigs (5’-ggTGCATCGATGCAG-3’)

and demonstrates that the choice of the vector or the insertion of a number of optimal porcine-

specific CpG motifs, such as the motif 5'ATCGAT3' into the plasmid backbone definitely is

an option to improve DNA vaccines.

The final chapter (chapter 8) represents the general discussion and conclusions with

respect to the obtained results. In this thesis it was demonstrated that cytokine expression in

pigs can be accurately studied using a (semi)-quantitative RT-PCR assay. Nevertheless, to

generate reliable and comparable data, some critical considerations concerning the

standardization of the assay, appropriate normalization and the sample processing should be

made. Expansion of the technique to detect other important cytokines such as IL-12, IL-18,

IL-23, IL-27 (Th1-like cytokines) and IL-13 (Th2-like cytokine) might provide additional

information on immune responses generated in our immunization studies. Secondly, within

this thesis, a first step was taken in the development of a DNA vaccine against F4+ ETEC.

The vaccine construct and vaccination conditions should be further improved and evaluated in

our prime/boost model to eventually start with immunization experiments using 1 week old

piglets in the presence of maternal antibodies.

There is much yet to be done in understanding and improving DNA vaccines for pigs.

However, studies to date have shown that this new type of vaccine will on the long term find

its way to farms as part of the arsenal used against diseases.