Post on 14-Jan-2016
description
Tutorial BioBricks
Jan MertensElke Van Assche
BioBrick: definitie
Het part zelf begint met eerste letter (A, C, T, G) die volgt op de prefix cloning site van het plasmide en eindigt met de laatste letter voor de suffix cloning site van het plasmide Part sequentie in de registry: start met de eerste base van het part en
eindigt met de laatste base Vb. Start met ATG en eindigt met TAATAA Exclusief prefix en suffix
Prefix en suffix liggen op plasmide waarin het part zit Prefix en suffix hebben knipplaatsen voor EcoRI, XbaI, SpeI,
PstI BioBrick heeft dus geen knipplaatsen voor restrictie-enzymen
Prefix en suffix BioBrick Prefix
Als het part dat volgt een coderende sequentie is of een ander part dat start met "ATG", dan is de BioBrick prefix :
gaattcgcggccgcttctag Anders is de BioBrick prefix :
gaattcgcggccgcttctagag BioBrick Suffix
De standaard BioBrick suffix is :tactagtagcggccgctgcag
BioBrick Scar Als BioBricks met deze prefix and suffix sequenties geassembleerd
worden is er een "scar“ tussen de parts. Als het tweede part met "AT“ begint, is de scar
tactag Anders is de scar
tactagag
Soorten Biobricks
Basic Parts Basic Parts zijn atomische eenheden van DNA De oorsprong is de-novo synthese, genbank, primer extension en PCR,
of andere technieken Zoals alle parts wordt ook een Basic part gehouden in een plasmide In het plasmide is het omgeven door een restrictie-enzym cloning
region, maar de cloning region is geen onderdeel van de sequentie
Composite Parts Composite Parts zijn functionele eenheden gevormd door een
geordende serie Basic of Composite parts De sequentie zit niet in de registry Functie en design worden wel gedocumenteerd
Soorten BioBricks (vervolg)
Construction Intermediates Construction Intermediates hebben geen specifieke functie Resultaat van de assembly van twee parts Geen documentatie nodig Naam van part is dan: 'BBa_Snnnnn‘, automatisch toegewezen door
registry software
Biobrick nomenclature
Zoeken van BioBrick per type
Voorbeeld inverters
Tabellen met parts
Letter code definities
Plasmiden Plasmide backbone
Plasmide backbone: elk part wordt gezet op een plasmide
Dit bevat de prefix en suffix en een antibioticumresistentiegen voor selectie
Construction plasmide Het ccdB toxic gen verzekert dat
cellen getransformeerd met niet geknipte of gereligeerde plasmiden niet groeien
Gevormde kolonies zijn waarschijnlijk juist geligeerd
Plasmiden (vervolg)
Plasmide met biobrick parts
Structuur van een plasmide: ori, ab-resistentie en cloningsite
Plasmiden: nomenclatuur
pSB#X#
plasmid Synthetic Biology
ori
Ab-resistentiemerker
versienummer
Number Replication origin Copy number Purpose
1 modified pMB1 derived from pUC19
500-700 Easy plasmid DNA purification
2 F and P1 lytic derived from pSCANS-1-BNL
1-2 inducible to high copy
Inducible copy number
3 p15A derived from pMR101 10-12 Multi-plasmid engineered systems
4 rep101, repA derived from pSC101
~5 Small cell to cell copy number variation
5 derived from F plasmid 1-2 Improved plasmid stability
6 pMB1 derived from pBR322 15-20 Multi-plasmid engineered systems
Code Antibiotic
A ampicillin
C chloramphenicol
E erythromycin
G gentamycin
K kanamycin
N neomycin
Na nalidixic acid
R rifampicin
S spectinomycin
St streptomycin
T tetracycline
Tm trimethoprim
Z zeocin
Zoeken naar plasmiden
Restrictie-enzymen en knipplaatsen Restrictie op herkenningssequentie
Enzyme EcoRI Herkent GAATTC en knipt tussen G en de A op
beide strengen. Sticky ends: AATT Gebruikt voor verplaatsing van stuk DNA van ene
plasmide naar andere Knippen uit ene plasmide Andere plasmide openknippen met zelfde enzyme Zuiveren (enzyme werkt niet optimaal,
steractiviteit) De sticky ends annealen via baseparing
(complementair). Na ligatie is de originele restrictiesite hersteld
Restrictie-enzymen en knipplaatsen (vervolg)
SpeI - XbaI (Mixed Sites) Deze twee enzymes hebben compatible sticky
ends maar incompatible recognition sequences Dezelfde sticky ends worden verkregen, CTAG Na ligation vormt de resulterende sequentie geen
knipplaats voor XbaI noch voor SpeI = mixed site.
4 restrictie-enzymen (XbaI, SpeI, EcoRI, PstI) zijn voldoende voor alle DNA manipulaties
Biobrick parts zelf mogen deze herkenningssequenties niet bevatten.
Biobrick assembly Standard assembly
EcoRI and XbaI knipplaatsen links and SpeI and PstI rechts
Knippen van het fragment (blauw) met EcoRI en SpeI
Knippen van plasmide met groen fragment met EcoRI en XbaI
Zuivering m.b.v. gelelektroforese
Ligatie: E-sticky ends met elkaar, S en X
Transformatie naar E.coli en expressie van het construct
Biobrick assembly (vervolg)
Parallel assembly Standard assembly duurt te lang als je
verschillende parts aan elkaar wilt lassen Oplossing: parallel
Rolling assembly Als assembly van 2 parts faalt, zal dit zich in een
later stadium oplossen
Ribosoombindingssites (RBS)
Verschillende RBS binden ribosomen met verschillende efficiëntie Opm. Hoewel dit de
globale efficiëntie niet direct bepaalt is dit toch een belangrijke variabele
Standaard assembly: De RBS zit fysisch nabij het startcodon (Bij BioBricks is dit altijd ATG.)
Protocol voor gebruik Biobricks
“The Spring 2008 Distribution binder” bevat alle parts uit de registry
Het DNA voor alle parts is geïsoleerd en gespot op een filterpapier
Extensieve kwaliteitscontrole
Kwaliteitscontrole Bekijken van platen
In de registry DNA repositories Spring 2008 Bevat alle platen van 2008 Spring DNA Distribution Bekijken van kwaliteitscontrole van elk part
Protocol voor gebruik Biobricks
Lokaliseren van een part in de distributie Nummer intikken in search box Klikken op Physical DNA Alle lokaties van een bepaald part Enkel Physical DNA voor parts die Available zijn
Protocol voor gebruik Biobricks
Paper Punches
Geschatte duur: 1 minuut per spot Nodige materialen:
TE (10:1, pH 8.0) = tris(hydroxymethyl)aminomethane en EDTA Desired spot location information Olfa cutting materiaal (back of binder) Punch tool 1.5ml PCR tubes
Protocol voor gebruik Biobricks
Paper Punches
Werkwijze Warm up 5 μl aliquots of TE buffer to 50ºC in 1.5 ml (PCR) Eppendorf tubes.
Warm a water bath to 42 degrees. Slide the cutting mat under the page in the binder containing the DNA of your
part. Using the punch tool, press down firmly on the spot you want to punch out
while rotating the punch tool BUT NOT while pressing the ejector plunger (see the instructions on the punch tool wrapper). The spot is large enough to allow several punches, so punch at the edge of the spot.
Eject the punched paper spot into the tube containing 5 µL of TE buffer by pressing down on the top part of the punch tool.
Spin the tubes containing filter paper spot and TE for ~3 minutes at 15,000 x g.
Be sure to clean the punch tool before punching out another spot, to prevent cross-contamination of parts.
Protocol voor gebruik Biobricks
Punch Tool Cleaning
Geschatte duur: 5 minuten per spot Nodige materialen:
Blotting paper (back of binder) 10% bleach diH2O 95% ethanol
Protocol voor gebruik Biobricks
Punch Tool Cleaning
Werkwijze Punch a blank sheet of blotting paper and remove the punched paper. Pull
the punch tool apart, so that the black rod is separated from the column. Dip both the rod and the column briefly into a series of solutions of 10%
bleach, distilled water, a second bath of distilled water, and a final bath of 95% ethanol. Opm: We have found that strong detergents tend to remain on the punch tool and can inhibit transformation of the DNA. Ethanol is preferred over isopropanol for the final cleaning bath, as it dries much faster.
Blot with a Kimwipe (= opkuisdoekje) and allow to dry for 5 minutes. Note that the ethanol can wick up inside the column of the punch tool. It is important that the punch tool be completely dry before punching out another DNA spot, as the ethanol will affect the transformation efficiency.
Protocol voor gebruik Biobricks
Transformatie
Geschatte duur: 3 uur (plus 12-14 uur incubation) Materials needed:
Spots soaked in TE 2.0ml conical bottom tubes (one per spot) Ice Competent cells 42º water bath / 37º incubator SOC (check for contamination!) Petri plates with appropriate antibiotic
Protocol voor gebruik Biobricks
Transformatie
Werkwijze Soak the spots in 5 µL of the warmed TE for 20 minutes. This allows the
maximum concentration of DNA in solution. Start thawing the competent cells on wet crushed ice.
Chill labeled 2 ml conical bottom tubes on wet ice. Add 2 µL of DNA in TE and 50 µL of thawed TOP10 competent cells to the tubes. In our experience, these volumes have the best transformation efficiency. The 2 ml tubes allow better liquid movement during incubation. Extra eluted DNA may be held at least several weeks frozen or at refrigerator temperature.
Hold the DNA and competent cells on ice for 30 minutes. This improves transformation efficiency by a significant amount.
Heat shock the cells by immersion in a pre-heated water bath at 42ºC for 60 seconds. A water bath is important to improve heat transfer to the cells.
Protocol voor gebruik Biobricks
Transformatie
Werkwijze (vervolg) Incubate the cells on ice for 2 minutes. Add 200 μl of SOC broth (check that this broth is not turbid, which would
indicate previous contamination and bacterial growth). This broth should contain no antibiotics.
Incubate the cells at 37ºC for 2 hours while the tubes are rotating or shaking. We have found that growth for 2 hours helps in transformation efficiency, especially for plasmids with antibiotic resistance other than ampicillin.
Label an LB agar plate containing the appropriate antibiotic(s) with the part number, plasmid, and antibiotic resistance. Plate 250 µl of the incubated cell culture on the plate.
Incubate the plate at 37ºC for 12-14 hours, making sure the agar side of the plate is up. If incubated for too long the antibiotics, especially ampicillin, start to break down and un-transformed cells will begin to grow.
Protocol voor gebruik Biobricks
Transformatie
Opmerkingen Bij problemen: testen competente cel efficiëntie
http://www.openwetware.org/wiki/TOP10_chemically_competent_cells Plasmide DNA verdunnen tot 10 pg/ul plasmide DNA in TE Efficientie van 108 cfu/ug is goed
Protocol voor gebruik Biobricks
Making your own Glycerol Stock
Geschatte duur: ~1 hour (after overnight incubation of single colony liquid culture)
Nodige materialen: Single E. coli colony of transformed part LB broth with appropriate antibiotic 15ml tubes Cryotubes (see below) 80% glycerol Label with appropriate information
Protocol voor gebruik Biobricks Making your own Glycerol Stock
Werkwijze Pick a single colony from the above plate into 10 ml of LB broth with appropriate
antibiotic and grow 12-14 hours to create an overnight liquid culture. Combine 1 ml of overnight culture and 150 μl of a sterile 80% glycerol solution in a
screw-top cryotube. Vortex briefly. Incubate at room temperature for 1/2 hour, and place directly into a –80 degree
freezer. Prior to freezing, label the tube with the Biobrick part number, plasmid, and antibiotic
resistance. Glycerol stocks may be used for future access to the part by scraping small amounts
of frozen culture from the tube without thawing. The culture can be plated or used directly to infect a liquid culture. Plates containing transformed parts may be held in plastic bags at refrigerator temperature for at least two weeks.
The overnight culture can be used to prepare plasmid DNA with any standard miniprep. We have had good luck with the Qiagen miniprep kits.
Protocol voor gebruik Biobricks
Antibiotica
Ampicillin: 100mg/ml stock solution (add 1ml/L medium) Kanamycin: 50mg/ml stock solution (add 1ml/L medium) Chloramphenicol: 35mg/ml stock solution (add 1ml/L medium) Tetracycline: 5mg/ml stock solution (add 3ml/L medium)
Opmerkingen Oplossingen in ethanol of 50% ethanol bevriezen niet bij –20
graden, wat handig is voor opslag en gebruik Antibiotica mogen niet toegevoegd worden aan heet medium, koel
het medium tot 55°C vooraleer antibiotica toe te voegen Tetracycline is lichtgevoelig, platen en medium uit het licht bewaren
Meten van promotoractiviteit
Testpromotor, GFP-reporter, backbone plasmide isoleren
Ligeren en cellen transformeren Selectie m.b.v. antibioticumresistentie Activiteit promotor vergelijken met standaardpromotor
(BBa_J23101). Uitgedrukt in Standard Promoter Units (SPUs) zo dat je “part”
vergelijkbaar is met andere in de registry.
Je kan eigen metingen laten omzetten naar SPUs door de online registry calculator te gebruiken
Meten van promotoractiviteit
Promotor- en ribosoomactiviteit in relatieve eenheden van Standard Promoting Units (SPU) of Standard Ribosome Units (SRU)
Karakterisatie Metingen van het populatiegemiddelde
Wanneer is het meten van het gedrag van de populatie of het gemiddelde voldoende?
Als we enkel geïnteresseerd zijn in het gedrag van de meerderheid van de cellen.
1 enkele populatie Tijdsafhankelijk gedrag kan weergegeven worden (via the plate reader)
DNA Plasmide copy nummer
RNA Northern-bloths RT-PCR
Proteins Quantitative westernblots Plate reader
Karakterisatie Population distributions
Wanneer ben je geïnteresseerd in de populatiedistributies van een groot aantal cellen?
Als er meerder populaties zijn Wanneer je duizenden cellen wil onderzoeken i.p.v. 10 of 100den Wanneer je enkel statisch gedrag nodig hebt
DNA Mogelijkheid tot DNAkleuring met DAPI of iets anders om de DNAinhoud
in levende E. coli cellen te karakteriseren? Plasmide copy number? RNA
Versmelt reporters van single cel metingen met flowcytometrie Ontwikkel een hight troughput microscopieversie van één van de single
cell technieken hieronder Proteins
Flow Cytometry gebruikmakende van fluorescent proteïne
Karakterisatie Single cell metingen
Wanneer willen we het gedrag weten in een enkele cel? Wanneer stochastische effecten belang hebben Single molecule resolutie Dynamisch gedrag(want time resolved behavior of each cell
lineage) DNA
Hoe meet je plasmide kopie nummer in een enkele cel? Misschien FCS gebruiken met een DNA-bindend proteïne specifiek
voor je plasmide geconjugeerd met GFP. Vereist veel werk omtrent de methode
Karakterisatie
Single cell measurements RNA
Endy: Journal Club: Le et al 2005 Ido Golding approach Beide benaderingen zijn gebaseerd op hetzelfde soort RNA-MS2
proteïne binding. Le et al. Gebruikt dan FCS om niveaus van gebonden proteïne aan RNA te meten terwijl Golding et al. Individueel RNA tracht te traceren via fluorescentie microscopie. Beide methodes zijn zeer gevoelig maar beiden verstoren waarschijnlijk het systeem dat gemeten wordt.
Protein Fluorescence correlation spectroscopy
Voorbeeld Part:BBa_F2620
Signaling part (want F)
Beschrijving: Een transcriptiefactor [LuxR] (BBa_C0062) die actief is in
aanwezigheid van cel-cel signaalmolecule 3OC6HSL gecontrolleerd door tetR reguleerbare operator (BBa_R0040). Device input is 3OC6HSL. Device output is PoPS van een LuxR-gereguleerde operator.
Voorbeeld: legende
BBa_C0062: luxR repressor/activator Als gecomplexeerd met HSL, bindt LuxR aan de Luxpromotor en activeert de transcriptie van
Pr BBa_R0062, 3OC6HSL
Afkomstig van V. fischeri, bindt met het LuxRgenproduct van het Lux operon. Het resulterende complex kan binden met de lux box en regelt transcriptie van de luxpromotors.
Part:BBa_R0040 Sequenties voor pTet inverting regulator. De promotor staat constitiutief aan en wordt
gerepressed door Tet R. TetR repressie wordt geïnhibeerd door toevoeging van tetracycline en of zijn analoog aTc.
Polymerase Per Second: Polymerase Per Second (PoPS) ; aantal keren dat een RNA polymerase molecule een specifieke locatie (bvb. Promotor, RBS) op het DNA passeert per tijdseenheid. PoPS wordt indirect gemeten door een test gen te introduceren met dezelfde regulatorische regio, maar met een CFP proteïne coderend gen. De fluorescentie wordt hiervan gemeten.
Voorbeeld: transferfunctie De transferfunctie beschrijft het evenwicht tussen input (exogene HSL
concentratie) en output (PoPS) signaal. Een fluorescent reporter device werd hiervoor gebruikt om de output te meten bij verschillende exogene concentraties HSL.
Voorbeeld transferfunctie (2)
Voorbeeld: specificiteit Specificiteit: onderscheid moet gemaakt kunnen worden tussen de echte
input en andere gelijkende inputs (veel AHL molecules met een gelijkende structuur aan 3OC6HSL ). Karakterisatie van de respons van BBa_F2620 op andere AHL molecules is nodig.
Transferfuncties voor 8 verschillende AHL molecules als input
Voorbeeld: responstijd
Responstijd meet de tijd voor de respons van de output op de input. In dit voorbeeld: respons van BBa_F2620 gemeten d.m.v. stijging van het
inputsignaal (AHL concentratie van 0 tot 100 nM )stap voor stap
Voorbeeld: stabiliteit
“Device” stabiliteit beschrijft hoe de transferfunctie van het device verandert na verschillende rondes van celdeling en in cultuur brengen.
reporter device, BBa_E0240 to indirectly measure the output from BBa_F2620
Performantie van het device werd gemeten onder hoge en lage inputcondities over 92 generaties. Performantie
constantPerformantie daalt snel na 74 generaties
Voorbeeld stabiliteit (2)
Oorzaak van dalende performantie na 74 generaties: Deletiemutant mutant die in het begin al in een fractie
van de cellen aanwezig was (die na 74 generaties de cultuur overheerst bij hoge input)
Voorbeeld Part:BBa_F2620
Compatibiliteit Bacteriële stam:
transcriptie hangt af van de gebruikte stam (juiste sigmafactoren, RNApolymerases)
Plasmiden Device werkt niet op alle plasmiden
Devices Mogelijke interferentie met andere devices
Cel signalisatie Crosstalk tussen verschillende quorum sensing systemen
Let’s start building!